ID: 1198640958

View in Genome Browser
Species Human (GRCh38)
Location X:138756252-138756274
Sequence CAGAGAAAAGAGAAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1327
Summary {0: 1, 1: 2, 2: 12, 3: 164, 4: 1148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198640952_1198640958 15 Left 1198640952 X:138756214-138756236 CCTCCAGATGAAAACCTTTGCTA 0: 1
1: 0
2: 2
3: 10
4: 140
Right 1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG 0: 1
1: 2
2: 12
3: 164
4: 1148
1198640954_1198640958 1 Left 1198640954 X:138756228-138756250 CCTTTGCTACAATTCCTGTCAAA 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG 0: 1
1: 2
2: 12
3: 164
4: 1148
1198640953_1198640958 12 Left 1198640953 X:138756217-138756239 CCAGATGAAAACCTTTGCTACAA 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG 0: 1
1: 2
2: 12
3: 164
4: 1148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198640958 Original CRISPR CAGAGAAAAGAGAAGGCAGC TGG Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900957181 1:5893246-5893268 GAGATAAAAGAAAAGACAGCTGG + Intronic
901194918 1:7435062-7435084 AAGAAAAAAAAGAAGGCAGAGGG + Intronic
901329818 1:8397658-8397680 TAGAGAACTGAGAAGCCAGCAGG - Intronic
901543508 1:9937544-9937566 CAGAAAAAAAAAAAGGCAGCTGG + Intronic
901974357 1:12932518-12932540 CAGAGGAGAGAGATGGCAGCAGG - Intronic
902010817 1:13269250-13269272 CAGAGGAGAGAGATGGCAGCAGG + Intergenic
902129100 1:14243208-14243230 CAAAGAAAAGAGAAAGATGCTGG - Intergenic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902804998 1:18855486-18855508 CATAGAGAAGAGAAGGAACCAGG - Intronic
902822139 1:18949930-18949952 CCCAGAAAAGAAAAGGAAGCAGG - Intronic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903657242 1:24956868-24956890 CAGAGGAAACAGAGGGCATCTGG - Intronic
904078790 1:27858959-27858981 CAGAGAAATGGGAGGGCGGCTGG - Intergenic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904336718 1:29802616-29802638 CGGAGAAGAGAGAAGCCAGGAGG + Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
904910019 1:33927767-33927789 CAGGCAGAAGAGAAGGGAGCAGG - Intronic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905312010 1:37055866-37055888 CAGGGAAGAGAGCAGCCAGCAGG - Intergenic
905323938 1:37137192-37137214 AAGAGAAAAGCTAAGGCAGGTGG + Intergenic
905781035 1:40709506-40709528 CGGAGGAAACAAAAGGCAGCAGG - Intronic
906112945 1:43336794-43336816 GAGATAAAAGAAAAGACAGCTGG + Intergenic
906153821 1:43602635-43602657 CAGAGAGAAGAGTGGGAAGCAGG - Intronic
906247099 1:44283993-44284015 CAGAGAAAGGAGAACACACCGGG - Intronic
906258448 1:44368123-44368145 CAGAAGAAAGAGAGGGCAGCTGG + Intergenic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907177465 1:52538364-52538386 CTGAGAAAAAAAAAGGGAGCTGG + Intronic
907350804 1:53829191-53829213 CAAAGTAAAGAGATGGCAGGAGG + Intronic
907401066 1:54225080-54225102 CATAGAAAACAGAGGGCACCAGG + Intronic
907609084 1:55849791-55849813 GAGAGACATGAGAAGGCAGAAGG + Intergenic
908205017 1:61838054-61838076 AAGACAAAAGAGAAAGCAACAGG + Intronic
908316509 1:62937794-62937816 CTGAGGAAAGGGCAGGCAGCCGG + Intergenic
908499962 1:64733340-64733362 GCAAGAACAGAGAAGGCAGCAGG - Intergenic
908854530 1:68409897-68409919 CAGAGAAAGAAGAAGTCAGTAGG - Intergenic
909079078 1:71087324-71087346 CACAGAAAAGAAAAAGCAGTTGG + Intergenic
909455337 1:75843285-75843307 GAGATAAAAGAAAAGGCAGCTGG - Intronic
909564504 1:77039569-77039591 CAGAGGATAGATAAGGCAGGGGG + Intronic
910084679 1:83385377-83385399 CAGTCAAAACAGAAGGCATCAGG + Intergenic
910524880 1:88166156-88166178 CAGAGAGAAGAGAAGCCTGAAGG + Intergenic
910910399 1:92227977-92227999 AAGAGAAAAGAGAATGGAGCAGG - Intronic
910976226 1:92908910-92908932 CAGAGAAAACAGAAATCATCTGG - Intronic
911277781 1:95882799-95882821 GAGAGAAAATAGAAGACAGATGG + Intergenic
911537488 1:99117942-99117964 CAGACACAAGAGAAAGTAGCTGG + Intergenic
911804602 1:102189963-102189985 CAGAGAAAACAGTAGTCATCAGG - Intergenic
911958012 1:104262727-104262749 GAGATAAGAGAAAAGGCAGCTGG + Intergenic
911973460 1:104464412-104464434 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
912046587 1:105466380-105466402 GAGAGAAAAAAAAAGGCAGAAGG + Intergenic
912184667 1:107260907-107260929 CAGAGAAAGGAGATTCCAGCTGG + Intronic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912812165 1:112802713-112802735 CAAAAAAAAAAGAAGCCAGCAGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
912908935 1:113736843-113736865 CTGAGAGAAGAGCAGGCACCAGG + Intronic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
912948816 1:114106582-114106604 CAGAGAAGGGAGAGAGCAGCAGG - Intronic
913404810 1:118477840-118477862 CAGAGGAAAGAGAAGATAGATGG - Intergenic
913558688 1:119996503-119996525 CAGAGAAAATCAAGGGCAGCTGG + Intronic
913639155 1:120793968-120793990 CAGAGAAAATCAAGGGCAGCTGG - Intergenic
913697017 1:121336462-121336484 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914096974 1:144552293-144552315 GAGAGAACAGACAAGGGAGCGGG - Intergenic
914140542 1:144943582-144943604 GAGAGGGAAGAGAAGGCAGAGGG + Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914238317 1:145832621-145832643 CAGAGAAAATAGAAGACACTAGG - Intronic
914279295 1:146155990-146156012 CAGAGAAAATCAAGGGCAGCTGG + Intronic
914540339 1:148606920-148606942 CAGAGAAAATCAAGGGCAGCTGG + Intronic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914626305 1:149464294-149464316 CAGAGAAAATCAAGGGCAGCTGG - Intergenic
914721646 1:150294114-150294136 AGAAGAAAAGAGATGGCAGCAGG - Exonic
914735502 1:150412535-150412557 AAGAGAAAACACAAGGTAGCAGG + Intronic
915047292 1:153029023-153029045 CAGTGAAAAAAAAAAGCAGCAGG + Intergenic
915122873 1:153642462-153642484 AAGAGAAAAGGGAAGGGAGTAGG - Intronic
915157606 1:153891269-153891291 AAGAAAAAAGGGAAGGCAGCCGG + Intronic
915314416 1:155019945-155019967 GAGAGAGCAGAGCAGGCAGCTGG - Intronic
915339125 1:155166817-155166839 CAGAGAAAAGGGAGAGCAGTAGG - Intergenic
915473122 1:156137521-156137543 CAGAGGACAGAGTAAGCAGCAGG + Intronic
915664751 1:157434354-157434376 GAGAGAAAAGATGAGGCAGATGG - Intergenic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916486313 1:165262785-165262807 CAGATAAATGAAAAGGTAGCTGG - Intronic
916488248 1:165278547-165278569 GAGAGAAGAGAGAATGCAGCAGG - Intronic
917216249 1:172681061-172681083 CAGAGAGCAGAGAAGGCAATGGG - Intergenic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
917443981 1:175091258-175091280 GAGAGAAAAGGGAAGGCAGGGGG + Intronic
917448525 1:175127110-175127132 CACACAGAAGAGAAGGCACCAGG - Intronic
917512194 1:175677913-175677935 GAGAGGAAAGAGAAGCCAGGGGG + Intronic
917676347 1:177322591-177322613 CAGAGAACAGAAAATGGAGCAGG + Intergenic
918093505 1:181316839-181316861 AAGAGAGAAGAGGAGGCAGTGGG - Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918453697 1:184685645-184685667 CAGGAAAAAGAGAAGGCTCCTGG - Intergenic
919256994 1:195138692-195138714 CAGAGAAAAGAAAATTGAGCAGG + Intergenic
919303996 1:195806663-195806685 CAGACAAAAGAGAAGGCCATGGG + Intergenic
919443770 1:197674587-197674609 CAGAGAAAAGGGAATGAAGTTGG + Intronic
919769204 1:201146543-201146565 AAGAGAGCAGAGAAGGGAGCTGG + Intronic
919902575 1:202055172-202055194 CAGAGGAAAGAGGAAACAGCAGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920079594 1:203362626-203362648 CAGAGACAATAGCAAGCAGCAGG - Intergenic
920484348 1:206354799-206354821 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
920793384 1:209114187-209114209 AAATGAAAAGAGAAGGGAGCAGG + Intergenic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
921131045 1:212220306-212220328 CAGAGACAAGCAAAGGCAGTGGG + Intergenic
922031507 1:221804645-221804667 GAGAGAACAGAGAAGGCAGAGGG - Intergenic
922206981 1:223456491-223456513 CAGACAAATGAGAAGGCACCCGG + Intergenic
922334456 1:224607366-224607388 AAGGGAAAAGAGCAGGCAGCAGG + Intronic
922503334 1:226112087-226112109 CAGCCAAAAGTGAAGGCAGCTGG - Intergenic
922984988 1:229859420-229859442 CAGCAAACAGAAAAGGCAGCAGG - Intergenic
923016428 1:230130063-230130085 CAGAGACAAGAGAGGACTGCAGG - Intronic
923438483 1:233992809-233992831 CTTAGAAAAGAGAGGGCATCTGG + Intronic
923644948 1:235810075-235810097 CTGATAACAGACAAGGCAGCTGG + Exonic
923727230 1:236517183-236517205 GAAAGAAAAGAGAAGGCTGAAGG + Intergenic
923811189 1:237318634-237318656 CTGACAAAAGAGAAGACAGAAGG - Intronic
923863535 1:237916177-237916199 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
923863940 1:237919075-237919097 GAGATAAAAGAAACGGCAGCTGG + Intergenic
923876652 1:238056905-238056927 AAGAGGAAAGAGCAGGCAGTAGG - Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
1063168321 10:3483996-3484018 CAGAGAAAAAGGCAAGCAGCTGG - Intergenic
1063447463 10:6128327-6128349 CAGAGACCAGAGAAGTCAGTGGG + Intergenic
1063451762 10:6154787-6154809 CAGATCAGACAGAAGGCAGCTGG - Intronic
1063985181 10:11494515-11494537 GAGATAAAAGAAAAGACAGCTGG + Intronic
1064018869 10:11793542-11793564 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1064050672 10:12056832-12056854 CAGAGAAGAGAGAAAGGAGGGGG - Intergenic
1064397327 10:14992358-14992380 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1064400224 10:15014819-15014841 GAGAGAGAAAAGATGGCAGCCGG - Intergenic
1064494176 10:15890143-15890165 GAAAGACAAGAGAAGGCAGAAGG - Intergenic
1064971038 10:21067458-21067480 CATAAAAAAGAGAAAGCAGGAGG + Intronic
1065149391 10:22806616-22806638 CAGAGAACAGAGATTGGAGCTGG - Intergenic
1065242739 10:23724010-23724032 CAGAGACAAGAGAAAGCAAGCGG + Intronic
1065390246 10:25175390-25175412 CAGAGAGAAGAGGAGGGAACGGG - Exonic
1066292871 10:34029795-34029817 CAGAGAAAACAGAAAATAGCAGG + Intergenic
1066466293 10:35653277-35653299 AAAAGAAAAGAAAAGGGAGCAGG - Intergenic
1066479355 10:35780441-35780463 CAGTGAGAAGTGAAGCCAGCTGG - Intergenic
1067225728 10:44374548-44374570 CAGGTAAAAGAGATAGCAGCGGG + Intronic
1067259668 10:44678083-44678105 GAGATAAAAAAGAAGGCAGAAGG + Intergenic
1067383274 10:45794837-45794859 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067790312 10:49282942-49282964 CAGAGAAGAGAGCTGGCATCTGG - Intergenic
1067842216 10:49690097-49690119 CAGCAAAAAGCGAAGGCAGCAGG + Intronic
1067890980 10:50135385-50135407 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067963599 10:50884301-50884323 AAGGGAAAAAAGAAGACAGCTGG - Intronic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068683044 10:59840604-59840626 GAGAGAACAGACAAGGCAGTGGG - Intronic
1069273598 10:66561983-66562005 CAGAGAAGAGAGAAGATAACAGG + Intronic
1070153394 10:73818951-73818973 TAGATAAAAGACAAGGCAGTAGG - Intronic
1070238046 10:74651007-74651029 CAGAGAAAACAGAAGCCATTAGG - Intronic
1070244856 10:74721236-74721258 CAGACAAAATAGAAGCCTGCCGG - Intergenic
1070265649 10:74900008-74900030 CAGAAAAAAGAGAGGTCAGTAGG + Intronic
1070727014 10:78799345-78799367 CAGAGGAAAGAAAAGGTAGAAGG - Intergenic
1070745043 10:78928594-78928616 GAAAGAATAGAGAAGGCAGTGGG + Intergenic
1070803233 10:79255559-79255581 CAGAGAAATAAGAGGGGAGCGGG - Intronic
1071511156 10:86263359-86263381 CTGGGAAATGAGACGGCAGCGGG + Intronic
1071547372 10:86538737-86538759 CAGTGAGAAGTGAAGCCAGCTGG - Intergenic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1072863228 10:99029385-99029407 GAGATAAAAGAAAAGCCAGCTGG + Intronic
1073137793 10:101229374-101229396 CAGAGAAGAGAGAAGAGAGAGGG - Exonic
1073241049 10:102058381-102058403 CAAAGAGAAGAAAAGACAGCTGG - Intergenic
1073580679 10:104663079-104663101 CAGAGTGAAAGGAAGGCAGCCGG - Intronic
1073759831 10:106617291-106617313 CAGAGAGAGGAGGAGGCAGAAGG - Intronic
1073809010 10:107132150-107132172 GAGAGAAAAGAGAAAGAAGAGGG - Intronic
1074061372 10:109969172-109969194 CAGAGATCAGAGCTGGCAGCAGG + Intergenic
1074335955 10:112575996-112576018 AAAAGAAAAGAAAAGGCAGGGGG - Intronic
1074522861 10:114240374-114240396 CAGACAGAAGAGAAGGGAGGAGG + Intronic
1074634948 10:115304498-115304520 GAAAGAAAAGAAAAGGCAGAAGG + Intronic
1075049821 10:119175308-119175330 CGGAGTGAAGAGCAGGCAGCAGG + Intronic
1075237977 10:120748913-120748935 TAGAGAAAAGGGCAGGCAACTGG + Intergenic
1075287583 10:121200711-121200733 CAGAGAGGAGAAAAGGCAGGGGG + Intergenic
1075490383 10:122862747-122862769 CAAAGAAAATATAAGGCAGAAGG - Intronic
1076419690 10:130322146-130322168 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1076631397 10:131854300-131854322 GAGAGAAGGGAGAAGGCAGAAGG - Intergenic
1076642065 10:131924695-131924717 CAAAAAAAAAAAAAGGCAGCTGG + Intronic
1076862350 10:133144489-133144511 GAGATAAAAGAAAAGACAGCGGG - Intergenic
1076894844 10:133305491-133305513 GAGATAAAAGAAAAGACAGCGGG - Intronic
1076927088 10:133496965-133496987 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077388272 11:2285967-2285989 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1077520155 11:3028344-3028366 GAGATAAAAGAGAAGACAGCTGG - Intronic
1077736091 11:4792802-4792824 CAGAGAAAAGAAGAAGGAGCGGG + Intronic
1077852995 11:6093407-6093429 AACAGGAAAGAGAAAGCAGCAGG - Intergenic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1078626355 11:12962379-12962401 AAGAGAAGACAGAAGGCAGGAGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079441204 11:20516446-20516468 AAAAGAAAAAAGAAGGCAGAAGG + Intergenic
1080001312 11:27353322-27353344 AAAAGAAAAAAGAAGGCACCAGG + Intronic
1080370336 11:31631772-31631794 CAAAGAAAAGATCAGGCAGTAGG + Intronic
1080609641 11:33892843-33892865 AGGACAAAAGAGAAGACAGCCGG - Intergenic
1080740935 11:35063780-35063802 GACAGAAAAGAGAAGTCATCCGG + Intergenic
1080948316 11:36999838-36999860 AAAAAAAAAGTGAAGGCAGCAGG - Intergenic
1081373975 11:42337961-42337983 CAGTGAAAAGAGAAGCCATATGG - Intergenic
1081623983 11:44635690-44635712 CAGGGAGATCAGAAGGCAGCAGG + Intergenic
1081810935 11:45913832-45913854 CATAGAAAGGAGAGCGCAGCAGG + Exonic
1082580130 11:54855844-54855866 CAGATAATAGAAAAGGCAGCTGG - Intergenic
1082689105 11:56278006-56278028 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1082739480 11:56894731-56894753 AAGAGAAAAGAGAAAGCAGAGGG + Intergenic
1082858785 11:57833682-57833704 CAGATAGAAGAGAAAGGAGCAGG - Intergenic
1083216485 11:61223430-61223452 CAATGAAAAGAACAGGCAGCAGG + Intronic
1083219367 11:61242256-61242278 CAATGAAAAGAACAGGCAGCAGG + Intronic
1083349479 11:62017200-62017222 AAGATAAAAGAAAAGACAGCTGG - Intergenic
1083714940 11:64569739-64569761 CATAGAGGAGAGGAGGCAGCAGG - Exonic
1083910633 11:65707158-65707180 GAGATAAACGAAAAGGCAGCTGG - Intergenic
1084093419 11:66894289-66894311 GAGAACAAAGAGGAGGCAGCTGG - Intronic
1084227815 11:67728335-67728357 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1084261222 11:67980017-67980039 GAGAGAGAAAAGATGGCAGCCGG - Intergenic
1084664967 11:70571412-70571434 CAGAGAAAGGGCATGGCAGCAGG + Intronic
1084807409 11:71588531-71588553 GAGAGAGAAAAGATGGCAGCTGG + Intronic
1084811433 11:71614080-71614102 GAGAGAGAAAAGATGGCAGCCGG + Intergenic
1084844499 11:71888539-71888561 GAGAGAGAAAAGATGGCAGCTGG + Intronic
1084847354 11:71910995-71911017 GAGAGAGAAAAGATGGCAGCTGG + Intronic
1084957318 11:72698204-72698226 GGAAGAGAAGAGAAGGCAGCTGG - Intronic
1085099846 11:73791183-73791205 CTCAGAAAAGAAAAAGCAGCGGG - Intronic
1085265642 11:75236435-75236457 CAGAGGGATGGGAAGGCAGCAGG + Intergenic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1086168596 11:83809049-83809071 AAGAGAAGAGAGGATGCAGCAGG - Intronic
1086193462 11:84108631-84108653 CTGAGGCAAGAGAAGGTAGCAGG + Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086911925 11:92482614-92482636 CTGAGAAAAGAGAAAGCATGTGG - Intronic
1087264125 11:96042415-96042437 GAGAAAAAAGAGAAGGCAGCTGG - Intronic
1087601318 11:100319447-100319469 CAGAAAAAAGGGAAGTCAGCTGG - Intronic
1088235527 11:107718997-107719019 GAGAGAAAATAGAAGGAAGTGGG + Intronic
1088593356 11:111421910-111421932 CAGACAAAAAAAAAGGCAGAAGG + Intronic
1088618795 11:111661345-111661367 GAGGGAAAAGAAAAGGAAGCAGG + Intronic
1088735186 11:112722987-112723009 CAGAGAACAGAGACGGGAGCAGG + Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089342450 11:117767628-117767650 CAGAGAGTGGAAAAGGCAGCTGG - Intronic
1089413318 11:118265451-118265473 CAGGAACAAGAGAAGGCGGCAGG + Intergenic
1089453930 11:118614809-118614831 CAGAGACAAGGGAAGCAAGCTGG - Intronic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089744947 11:120610066-120610088 GAGAGACAGGAGAAGGCAGATGG - Intronic
1090643496 11:128748649-128748671 GAAAGAAAAGAAAAGTCAGCCGG + Intronic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1091407575 12:218797-218819 CAGAGAGATGAGAATGCTGCTGG - Intergenic
1091631761 12:2166834-2166856 CAGGGAGAAGACTAGGCAGCAGG + Intronic
1092168783 12:6360335-6360357 CAGAGCAAAGGGAGGGCATCGGG + Intronic
1092224987 12:6742425-6742447 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1092444225 12:8538591-8538613 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1092449093 12:8585253-8585275 GAGACAAGAGAAAAGGCAGCTGG - Intergenic
1092538942 12:9407694-9407716 CAGAGAGAAAAGATGGCAGCTGG + Intergenic
1092556486 12:9567226-9567248 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1093180551 12:15962246-15962268 TAAAGAAAAGAGAATGCAGGAGG - Intronic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093763352 12:22935297-22935319 CAGAGAAAAGAAAGGGGCGCTGG - Intergenic
1094303221 12:28989498-28989520 CAGAGAATAGAAAAGGAAACAGG - Intergenic
1094515606 12:31123414-31123436 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
1094603893 12:31934083-31934105 CACAGAAATGAGAAGGTAACTGG - Intergenic
1095871554 12:47033889-47033911 CAGGCAACAGAGAAGGCAGATGG + Intergenic
1095921617 12:47537376-47537398 TAGAGAAAAGAGTAGACAGAAGG + Intergenic
1096009494 12:48201119-48201141 AAGAGAAAAAGGAAGGCAGTAGG + Intergenic
1096031436 12:48419206-48419228 CAAAGACCAGAGAAGGCAGCAGG + Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096541323 12:52308843-52308865 CAAAAAAAACAGAAGGCAGGCGG - Exonic
1096584727 12:52612499-52612521 CAGAAAGCAGAGAAGGCAGAAGG + Intronic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096817074 12:54208528-54208550 AGGGGAAAAGAGAGGGCAGCAGG + Intergenic
1097090020 12:56497480-56497502 GAGACAAGAGAAAAGGCAGCTGG - Intergenic
1097090488 12:56500790-56500812 GAGACAAGAGAAAAGGCAGCTGG + Intergenic
1097466959 12:59938351-59938373 AGGAGAGAAGAGAAGACAGCAGG + Intergenic
1097565073 12:61257903-61257925 AAGAGCAAAGAGAAGGCAAAAGG - Intergenic
1097591638 12:61582264-61582286 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1097695143 12:62768214-62768236 AGGAGAAAGGAAAAGGCAGCAGG + Intronic
1098034505 12:66288356-66288378 CAAGGAAATGAGAAGGTAGCTGG + Intergenic
1098476055 12:70905030-70905052 CAGACATAAGAGAATGCAGCTGG + Intronic
1098484703 12:71007051-71007073 CAGGGAAAACAGCAGGCACCAGG + Intergenic
1098554975 12:71808107-71808129 AAGAGAGAGGAGAAGACAGCAGG - Intergenic
1098958767 12:76715994-76716016 AAGAGAAAACGGAAGTCAGCTGG + Intergenic
1099014429 12:77327038-77327060 CAGAGAATAGATCAGGCAGAAGG + Intergenic
1099675833 12:85759490-85759512 AAGAGAAAAGAAAAGGAAGAGGG + Intergenic
1099864727 12:88265283-88265305 GATAGAAAAGACAATGCAGCTGG - Intergenic
1099885860 12:88529692-88529714 AAGACAAAAGATAAGGCAGCTGG + Intronic
1100009695 12:89938446-89938468 TCTAGAAGAGAGAAGGCAGCAGG + Intergenic
1100040510 12:90311821-90311843 CAGAGAATAAAGAAGACAGAGGG + Intergenic
1100754120 12:97731553-97731575 CAGAGAAGAGGAAAGGCTGCAGG + Intergenic
1101364175 12:104056152-104056174 CAAAGCATAGAGAGGGCAGCTGG - Intronic
1101390260 12:104293745-104293767 GAGATAAGAGAAAAGGCAGCTGG + Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101435061 12:104657556-104657578 CAGAGAAAAAACATGGGAGCGGG - Intronic
1101802172 12:108032013-108032035 CCGAGAAAAGAGAAGGACCCAGG + Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102152356 12:110697524-110697546 CAGAGAAATGGGAGGACAGCTGG + Intronic
1102402856 12:112645831-112645853 CAGAGATGAGAGCAGACAGCCGG + Intronic
1102756144 12:115342520-115342542 CAGAGAGGAGAGAAGAGAGCAGG + Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103358027 12:120336209-120336231 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1103401127 12:120643430-120643452 CAGAACCAAGAGAAGGCAGATGG + Intronic
1103614475 12:122143342-122143364 CAGACAAGAGGGCAGGCAGCTGG - Exonic
1103617313 12:122162514-122162536 GAGGGAAAAGAGGAGGGAGCAGG - Intergenic
1103675534 12:122652806-122652828 CTGAGAAAAGATAATGTAGCTGG - Intergenic
1103712650 12:122924247-122924269 CAGAGAAAAGAAATGACTGCAGG - Intronic
1104071765 12:125352015-125352037 CAGAAAATATAGATGGCAGCAGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104761045 12:131297715-131297737 CTGAGAAAAGAGAAGACACAGGG + Intergenic
1104818733 12:131663077-131663099 CTGAGAAAAGAGAAGACACAGGG - Intergenic
1104871432 12:132001135-132001157 GAGATAAAAGAAAAGACAGCTGG + Intronic
1104907284 12:132220095-132220117 CAGCAAAATGACAAGGCAGCTGG + Intronic
1105019872 12:132808931-132808953 GAGACAAGAGAAAAGGCAGCTGG + Intronic
1105517827 13:21105993-21106015 CACAGACAAAAGAAGGCAGAGGG - Intergenic
1105856407 13:24376288-24376310 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1105876079 13:24554641-24554663 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1105941136 13:25149077-25149099 CTGAGAAAAGAGAAGCCATCAGG + Intergenic
1107035943 13:35902545-35902567 AAGAGAAAAGGGTAGGCATCAGG + Intronic
1107544272 13:41422147-41422169 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1107941282 13:45380810-45380832 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1107941879 13:45382827-45382849 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1108053306 13:46465158-46465180 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
1108053738 13:46466994-46467016 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
1108054008 13:46468057-46468079 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
1108561147 13:51645523-51645545 GAGAGAAAAGGGAAGGCTGGGGG - Intronic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109322303 13:60826010-60826032 CAAAAAAAAAAAAAGGCAGCAGG - Intergenic
1109545756 13:63838479-63838501 GAGAGAAAATAGATGGCAGCTGG + Intergenic
1110319781 13:74148346-74148368 CAGAGAAATGGGATGGGAGCTGG - Intergenic
1110891738 13:80705174-80705196 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
1111884854 13:94007333-94007355 CAGTGAACAGTGAAGACAGCAGG + Intronic
1112187598 13:97142911-97142933 CAAAAAAATGAGAAGGTAGCAGG + Intergenic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1113148035 13:107230692-107230714 GAGAGAGAAGAGAAGATAGCTGG + Intronic
1113368384 13:109699879-109699901 CAGGGAACAGAAAACGCAGCAGG + Intergenic
1113503516 13:110796839-110796861 AAGAGAAAAGAAAAGAAAGCAGG - Intergenic
1113775456 13:112942505-112942527 GAGATAAAAGAAAAGACAGCTGG - Intronic
1113856709 13:113450448-113450470 GAGATAAGAGAAAAGGCAGCTGG + Intronic
1113880384 13:113622244-113622266 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1113898873 13:113784750-113784772 GAGAGAAAAGACAAGGCAGGTGG + Intronic
1113982533 13:114288463-114288485 CAGTGAAAAGCGACAGCAGCCGG - Intronic
1114165720 14:20216564-20216586 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1114414820 14:22535004-22535026 GGGAGAAAAGAGAGGGGAGCTGG + Intergenic
1114571747 14:23674104-23674126 AAGTGCAAAGAGAAGGCATCAGG - Intergenic
1114658189 14:24328713-24328735 GAGATAAGAGAAAAGGCAGCTGG - Intronic
1115176094 14:30563040-30563062 GAGATAAAAGAAAAGACAGCTGG - Intronic
1115274069 14:31587012-31587034 CGGAAAACAGAGGAGGCAGCTGG + Intronic
1115767187 14:36635329-36635351 CATAGAAAAGAAAAGGCATCTGG + Intergenic
1115821340 14:37215342-37215364 GAGATAAAAGAAAAGACAGCTGG - Intronic
1116030517 14:39565575-39565597 CCTAGAAAACAGAAGGCAGATGG - Intergenic
1116394298 14:44429718-44429740 GAGAGAAAAGACAGGGCAGGTGG - Intergenic
1117006845 14:51429063-51429085 AAGAGAAAAGAGAAGAGAACAGG + Intergenic
1117632524 14:57708690-57708712 GAGATAAAAGAAAAGACAGCTGG + Intronic
1117670317 14:58099630-58099652 CAGAGAAAATAGGGGGCAGGTGG + Intronic
1118139261 14:63062293-63062315 TAGACAAAAGAGAATGCAGAGGG - Intronic
1118284448 14:64458737-64458759 AATAGAAAAGAGAAGGAAACAGG + Intronic
1118436869 14:65779573-65779595 CAAGGAAAAAAGAAGGCAGAAGG + Intergenic
1118768721 14:68927654-68927676 CGGAGGAAAGAGGACGCAGCAGG + Intronic
1118770002 14:68936409-68936431 GAGAGAAATGGGAAGGCAGGGGG + Intronic
1118879949 14:69817446-69817468 AAGAGAAAGGCGAAGGCAGCAGG - Intergenic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1120023969 14:79561136-79561158 GAGAGAAGAGAGAAAGAAGCAGG + Intronic
1121083070 14:91124337-91124359 CAGAGAGAAGAGGAGGCATCAGG - Intronic
1121631976 14:95427792-95427814 GAGATAAAAGAAAAGACAGCTGG - Intronic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1122755940 14:103980195-103980217 GAGATAAAAGAAAAGACAGCTGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1123166347 14:106328980-106329002 GACAGAAGAGAGAAGGCAGGAGG + Intergenic
1123193190 14:106591319-106591341 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1202893557 14_KI270722v1_random:182550-182572 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1124163241 15:27294198-27294220 AAAAGAAAAGAAAAGGTAGCAGG - Intronic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1125181543 15:36885337-36885359 TAGAGAAAAAGGAAGGCAGGTGG + Intergenic
1125214855 15:37259935-37259957 CAGAAGAAAGAGCAGGCAGGAGG - Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125518830 15:40337312-40337334 CAGAGAAAAGAGAGGACAAGGGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125760327 15:42092048-42092070 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1125899548 15:43332167-43332189 CAGAGAAAACAGAAGCCATCAGG - Intronic
1126061161 15:44784270-44784292 CAAAGAGAAGAAAAGACAGCTGG + Intergenic
1126455577 15:48858316-48858338 CAGGGAAAAGGGGTGGCAGCGGG - Intronic
1126663210 15:51052318-51052340 CAGAAAAAGGAGAGGTCAGCTGG - Intergenic
1126919712 15:53507530-53507552 CAGAGGACAGGGAAGGCAGATGG - Intergenic
1127480607 15:59373373-59373395 AAAAGAAAAGAAAAAGCAGCCGG - Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127733578 15:61821350-61821372 CAGAAATAGGAGAAGGCATCAGG - Intergenic
1127752222 15:62057044-62057066 GAGATAAAAGAAAAGACAGCTGG - Intronic
1127877516 15:63123512-63123534 GAGATAAAAGAAAAGACAGCTGG + Intronic
1128349133 15:66877488-66877510 CAGAGACAGGAGAAAGAAGCAGG + Intergenic
1128668860 15:69559269-69559291 CAGCGCAAAGAGAAGGCTGTGGG - Intergenic
1128681917 15:69658643-69658665 CAGGAAACAGAGAAGGCAGAAGG - Intergenic
1129064603 15:72890265-72890287 CAGAGAGCTGAGACGGCAGCTGG + Intergenic
1129234874 15:74218051-74218073 CAGAGAAAAGTAAAGTGAGCTGG + Intergenic
1129419239 15:75410258-75410280 CAGAGAAATGCCAAGGAAGCTGG - Exonic
1129497012 15:75993304-75993326 AGGAGAAAAGAGAACACAGCAGG - Intronic
1129617086 15:77107131-77107153 CAAAGAAAAAAGTAGGCAGTTGG - Exonic
1129661008 15:77552907-77552929 AAAAAAAAAGAGAAGCCAGCAGG + Intergenic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1130112602 15:80977924-80977946 CAGAGAACTGAGAATGCAGAGGG + Exonic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130258614 15:82337494-82337516 CAGAGAAGAGAGAAGCCCGAGGG + Intergenic
1130270071 15:82441590-82441612 CAGAGAAGAGAGAAGCCCGAGGG - Intergenic
1130282695 15:82532018-82532040 CAGAGAAAAGGGAAGCCTGACGG - Intergenic
1130374451 15:83315976-83315998 CAGAAAAAATATAAGGTAGCTGG - Intergenic
1130519974 15:84654748-84654770 CAGAGAAGAGAGGAAGCGGCCGG + Intergenic
1130521680 15:84666417-84666439 CACACAAAAAAGAAGGAAGCAGG + Intergenic
1130596309 15:85252466-85252488 CAGAGAAGAGAGAAGCCCGAGGG - Intergenic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1131689373 15:94809973-94809995 GAGGGAAATGAGAAGGGAGCAGG - Intergenic
1131723614 15:95199471-95199493 CAAATAAAAGAGAAAGCATCTGG + Intergenic
1131746478 15:95453953-95453975 CAAATAAAAGGGAAGGCAGAAGG + Intergenic
1131842313 15:96450422-96450444 GGGAGAAAAGAGAAGGCAGTAGG - Intergenic
1131923701 15:97358442-97358464 AAGAGAAAAGAGAAGGCAACAGG - Intergenic
1131967352 15:97858539-97858561 CTGACAAAACAGAAGGCAGGAGG + Intergenic
1132117972 15:99151387-99151409 CTGAGAAAAGAAAAGGCACAGGG + Intronic
1132468789 16:90252-90274 CAAAGAAGAGAGGAGGCAGAGGG - Intronic
1132549737 16:549449-549471 CTGTGAGAAGAGGAGGCAGCCGG - Exonic
1132643091 16:986893-986915 CAGAAAGGAGTGAAGGCAGCAGG - Exonic
1132740270 16:1408570-1408592 AAGAGAGAAGAGATGACAGCAGG + Intronic
1132966755 16:2660345-2660367 GAGATAAGAGAAAAGGCAGCTGG + Intergenic
1132967887 16:2669608-2669630 GAGATAAGAGAAAAGGCAGCTGG + Intergenic
1132981287 16:2739785-2739807 CTGAGACCAGGGAAGGCAGCCGG + Intergenic
1133010266 16:2906629-2906651 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133108214 16:3528005-3528027 GAGATAAAAGAAAAGACAGCCGG - Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133879824 16:9770862-9770884 CAGGGAAAACCGAAGGGAGCGGG - Intronic
1134176116 16:12007815-12007837 AAGAGCAAAGACAAGGCAGCTGG - Intronic
1134382485 16:13740737-13740759 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1134400537 16:13905604-13905626 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1135229230 16:20690091-20690113 CAGAGAAAAGAAAAAGAAGGTGG + Intronic
1135288086 16:21211252-21211274 CAGAGAAAACAGGTTGCAGCTGG - Intronic
1136352642 16:29721158-29721180 GAGATAAGAGAAAAGGCAGCTGG + Intergenic
1136566645 16:31074472-31074494 TAGAGAAAAGAGGGCGCAGCTGG - Exonic
1137039626 16:35598938-35598960 AAGGAGAAAGAGAAGGCAGCAGG - Intergenic
1137385591 16:48039593-48039615 CAAAGAAATGAAGAGGCAGCCGG - Intergenic
1137416507 16:48286791-48286813 AAAAAAAAAGAGAAGTCAGCTGG - Intronic
1137934918 16:52625589-52625611 CAGAGAAAAGAGATAACATCAGG - Intergenic
1138219769 16:55240682-55240704 CTGAGAAAACAGAAGGGACCTGG - Intergenic
1138235185 16:55376435-55376457 GAGAGAAAAGAAAGAGCAGCTGG + Intergenic
1138513829 16:57524942-57524964 AGGAGACAAGAGAAGGGAGCCGG - Intronic
1138939769 16:61776113-61776135 GATAGAAAAGGGAAGGCAGGGGG + Intronic
1139023890 16:62789137-62789159 CTGAGATAAGAAAAGGGAGCAGG + Intergenic
1139525910 16:67516391-67516413 CAGAGACAAGAGGGGGCAGGCGG + Intergenic
1139671836 16:68497491-68497513 CAGAGCAGAAAGGAGGCAGCAGG - Intergenic
1139821475 16:69724758-69724780 AAGTGAGAAGAGAAGGCAGAAGG - Intronic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1140458669 16:75120371-75120393 AAGAGAACAGAGAAGGCACCAGG + Intergenic
1140462802 16:75154626-75154648 GAAAGAAAAGAGAAGGCAGAAGG + Intronic
1140570931 16:76105066-76105088 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1140852540 16:78948568-78948590 CAGAGGGATGAGGAGGCAGCAGG - Intronic
1141439814 16:84022779-84022801 CAGTGAATAGATGAGGCAGCAGG + Exonic
1141633111 16:85299577-85299599 CAGAGAACGGAGTAGGCAGAGGG - Intergenic
1141865369 16:86746520-86746542 CAGAGAAAAGAGAAGAGACACGG + Intergenic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1142364124 16:89640816-89640838 CAAAGAGAAGAAAAGACAGCTGG + Intergenic
1142384367 16:89753355-89753377 GAGATAAGAGAAAAGGCAGCTGG - Intronic
1142389933 16:89792690-89792712 GAGATAAAAGACAAGACAGCTGG + Intronic
1142415319 16:89937953-89937975 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143127583 17:4653834-4653856 CTGAGAAAAGAGTTGGCAACTGG + Intergenic
1143322882 17:6079509-6079531 CCCAGAGAAGAGAAGGCAGAAGG - Intronic
1143464531 17:7127167-7127189 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1143500129 17:7334033-7334055 CAGGGAAGAAAGAGGGCAGCTGG + Intergenic
1143667337 17:8371501-8371523 AAGAGACAAGAGAGGGCACCAGG + Exonic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1144155139 17:12492997-12493019 CAGAGACAAGGGAGGGGAGCTGG + Intergenic
1144166842 17:12620461-12620483 CTGAGAGGAGAGAAGGCAGGGGG - Intergenic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1144437695 17:15256101-15256123 TAGAAAAACGAGAAGGCAGGCGG + Intronic
1144743007 17:17594711-17594733 TAGAGAAAAGAGAGGCCATCAGG - Intergenic
1144813242 17:18015519-18015541 CAGGAACAAGAGAAGGCAGAAGG + Intronic
1144886302 17:18464923-18464945 CAGAGAAGAGATGAGGAAGCAGG - Intergenic
1145145903 17:20479388-20479410 CAGAGAAGAGATGAGGAAGCAGG + Intergenic
1145223398 17:21107517-21107539 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1145223990 17:21112579-21112601 AAGAAAAAAAAGAAGGCAGGAGG - Intergenic
1145732072 17:27198325-27198347 GAGACAAGAGAAAAGGCAGCTGG - Intergenic
1146180263 17:30693726-30693748 CAAGGAAGAGAGAAGACAGCGGG - Intergenic
1146310129 17:31762036-31762058 CAGTGAGAAGTGAAGCCAGCTGG + Intergenic
1146356032 17:32135141-32135163 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1146514961 17:33481977-33481999 TAAAGAAAGGAGAGGGCAGCAGG - Intronic
1146524853 17:33558182-33558204 GAGATAAAAGAAAAGACAGCTGG + Intronic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1147836779 17:43338501-43338523 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1147837979 17:43348719-43348741 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1147935063 17:44006447-44006469 CAGAGAAAAGAGAGGTCCGTGGG + Intronic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148262967 17:46200400-46200422 CAAAGAGAAAAGGAGGCAGCAGG + Intronic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148401195 17:47362965-47362987 GAGATAAAAGAAAAGACAGCTGG - Intronic
1148573560 17:48690771-48690793 CAAACAAAAGAGCAGGGAGCAGG - Intergenic
1148608332 17:48946773-48946795 CAAAGAAAAGAAAACTCAGCTGG + Intergenic
1148919967 17:51022241-51022263 AAGAGAAAAGAGTAGGGAGTAGG + Intronic
1149896353 17:60431577-60431599 CATAGAAAAGACACGACAGCAGG + Intergenic
1150132394 17:62676199-62676221 CAGAGAATAGAAGGGGCAGCTGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1150834467 17:68552029-68552051 AAGAGGAAAGCGAAGTCAGCTGG - Intronic
1151161799 17:72172211-72172233 CAGAGCAAAGAAAAGGAAACTGG - Intergenic
1151185616 17:72361893-72361915 GAGGGAAAAGAGGAGGGAGCTGG - Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151760322 17:76098022-76098044 CACAGACAACAGAAGGAAGCAGG + Intronic
1151922237 17:77165688-77165710 CAGAGAAAAGAAAAGGCCAAAGG - Intronic
1152004236 17:77668206-77668228 CAGAGAACAGTGAACGCACCTGG - Intergenic
1152516825 17:80830164-80830186 CACAGAACAGAGAAGCCAGCGGG - Intronic
1152595366 17:81235281-81235303 AAGAGGAAAGAAAACGCAGCTGG - Intronic
1152693460 17:81732343-81732365 AAGAGAACAGCAAAGGCAGCTGG + Intergenic
1152708066 17:81855647-81855669 CAGAGAGCAGAGACGGGAGCAGG - Intronic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153163040 18:2230282-2230304 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1153273586 18:3347246-3347268 GTGAGAAAAGAAGAGGCAGCTGG + Intergenic
1153335690 18:3922052-3922074 CAGGGAATTGGGAAGGCAGCAGG + Intronic
1153503973 18:5776411-5776433 CAGAAAGAAGAAAAGCCAGCTGG + Intergenic
1153640832 18:7155553-7155575 CAAAGAAAAGAGAGGCCAGAAGG - Intergenic
1153797284 18:8635592-8635614 CAGAGAAATCACCAGGCAGCAGG + Exonic
1153861736 18:9217664-9217686 CAGAGAAAAGAGTAGACCACTGG - Intronic
1154109270 18:11551940-11551962 CGGAAAAAAGAAAAGGCAACAGG - Intergenic
1155197021 18:23485105-23485127 AAGCCAAAAAAGAAGGCAGCAGG + Intronic
1155300600 18:24426183-24426205 TGGAGAACAGAGAAGGCAGGCGG - Intergenic
1155436174 18:25815427-25815449 CAGAGAAGAGGGAAGGCTACTGG + Intergenic
1156045441 18:32872155-32872177 CAGAGAAGAGGGAAGGAAACAGG + Intergenic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156759001 18:40564163-40564185 CAGACAGCAGAGAAGGAAGCTGG - Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1157467375 18:47958887-47958909 CAGAGATAAAAGGAGGCAGAGGG - Intergenic
1157579771 18:48766883-48766905 CAGAGAGAAATGGAGGCAGCGGG - Intronic
1157945314 18:51972859-51972881 CAGAGAAAAGAGTAGGTATAAGG + Intergenic
1158157811 18:54445063-54445085 AAGAGAGGAGAGAAGGCAGGAGG - Intergenic
1158231327 18:55258954-55258976 CACAGAATAGAGAGGGCAGTGGG - Intronic
1158735982 18:60080054-60080076 CTGAGCAAAGAGAACGAAGCTGG + Intergenic
1159177455 18:64856442-64856464 GAAAGAAAAGAGAAGGCAGAAGG + Intergenic
1159367192 18:67483610-67483632 CAAAGAAAAGGGAAGGCAAAAGG - Intergenic
1159402643 18:67957457-67957479 AAGAGGAAAGAGCAGACAGCAGG - Intergenic
1159457079 18:68672750-68672772 CAGAGAAAAGCCAAGTCATCAGG - Intergenic
1159682890 18:71377076-71377098 CAGAGAGAAGAAAAGACAGGTGG - Intergenic
1159833956 18:73313324-73313346 CATAGAAAAGACAAGGAAGATGG - Intergenic
1159938459 18:74387214-74387236 CAGAAGAAAGCCAAGGCAGCTGG - Intergenic
1159976804 18:74723539-74723561 CAAGGAAGAGAGAAGGCAGATGG - Intronic
1160847233 19:1171998-1172020 CAGAGCACAGAAGAGGCAGCAGG - Intronic
1161733210 19:5974922-5974944 CAGAGAAGAGAGATGGCAAATGG + Intronic
1161834022 19:6632812-6632834 AAGAGATAAAAGAAGACAGCTGG + Intergenic
1161894016 19:7066739-7066761 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1161926629 19:7305530-7305552 CAGAGGGCAGAGTAGGCAGCGGG - Intergenic
1162008089 19:7792718-7792740 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1162090114 19:8274045-8274067 CTGAGAAAACAGAAATCAGCAGG + Intronic
1162092348 19:8288908-8288930 CTGAGAAAACAGAAATCAGCAGG + Intronic
1162224236 19:9206266-9206288 CAAAGAGAAGAAAAGACAGCTGG - Intergenic
1162404049 19:10462829-10462851 CAGAGAACAGAGGAGGTAACGGG - Intronic
1162730020 19:12712809-12712831 GAGATAATAGAAAAGGCAGCTGG - Intronic
1162943516 19:14028462-14028484 CAGAGATAAGAGGAGGTTGCTGG + Intronic
1162978337 19:14221814-14221836 CAAGGAAGAGAGAAGACAGCGGG + Intergenic
1163044123 19:14626684-14626706 GACAGGGAAGAGAAGGCAGCTGG + Intronic
1163075604 19:14888461-14888483 CAAAGAGAAGAAAAGACAGCTGG + Intergenic
1163214608 19:15866730-15866752 CAGAGAAAAGGGAACACTGCTGG - Intergenic
1163456226 19:17407324-17407346 GAGATAAAAGAAAAGACAGCTGG + Intronic
1163479317 19:17545436-17545458 GAGATAAAAGAAAAGACAGCTGG + Intronic
1163588679 19:18177955-18177977 CAGAAAAAAAGGCAGGCAGCCGG - Exonic
1163885135 19:19958775-19958797 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1164389023 19:27801914-27801936 AAGATAAAAGAAAAGGCAGCTGG + Intergenic
1164458900 19:28431076-28431098 CAGAGAAAAGCAAAGGCCACAGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164826872 19:31290382-31290404 CAGAGAGAGGAGATGGCAGGGGG + Intronic
1164849526 19:31470076-31470098 AAGATAAAGGAGAAGGCAGGTGG + Intergenic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1164955133 19:32376691-32376713 GAGATAAAAGAAAAGACAGCTGG + Intronic
1164998122 19:32738411-32738433 CAGAGGAAAGAGATGCCAGGAGG - Intronic
1165671163 19:37680614-37680636 GAGATAAAAGAAAAGGCAGCTGG + Intronic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166344195 19:42155182-42155204 CAGAGAAAGATGAAGGCAGCCGG - Intronic
1166446775 19:42865032-42865054 GAGATAAAAGAAAAGACAGCTGG + Intronic
1166449288 19:42884472-42884494 GAGATAAAAGAAAAGACAGCTGG + Intronic
1166549558 19:43656279-43656301 AAAAGAAATGAGAAGGCATCTGG + Intronic
1166850587 19:45758723-45758745 CACAGAAATGAAGAGGCAGCCGG - Intronic
1167116610 19:47492505-47492527 CCGAGAAAAAGGCAGGCAGCTGG - Intronic
1167228609 19:48267160-48267182 CAGAGAAAATAGAAGGGAATTGG + Intronic
1167334519 19:48876305-48876327 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1167370104 19:49075621-49075643 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1167675475 19:50882024-50882046 AAGAGAAAAAACAAGGTAGCTGG + Intergenic
1167919320 19:52769631-52769653 GAGATAAAAGAAAAGACAGCTGG - Intronic
1167970233 19:53184709-53184731 GAGATAAAAGAAAAGGCAGCTGG + Intronic
1167990921 19:53360097-53360119 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1168039371 19:53745889-53745911 GAGAGAGAAGAAAAGGCAGCTGG + Intergenic
1168167559 19:54561840-54561862 CAGAGGAAAGTGAAAGCAGAGGG + Intergenic
1168215048 19:54919222-54919244 GAGACAAGAGAAAAGGCAGCTGG + Intergenic
1168416018 19:56169198-56169220 CAGAAAAAACAAAAGCCAGCTGG + Intergenic
1168443937 19:56395739-56395761 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1168480857 19:56718609-56718631 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1168554117 19:57323785-57323807 CAGAGACATGAGAAGTCCGCAGG - Exonic
1168603457 19:57739099-57739121 GAGATAAGAGAAAAGGCAGCTGG - Intronic
1168701631 19:58443371-58443393 CAGTGAAAAGTGAAGCCGGCTGG - Intergenic
925304093 2:2836757-2836779 GGGATAAAACAGAAGGCAGCTGG + Intergenic
925664736 2:6240640-6240662 CGGAGCACAGAGAAGGCAACGGG + Intergenic
926173641 2:10569889-10569911 AACAGAGAAGAGAAGGCAACAGG + Intergenic
926236409 2:11048421-11048443 CAGAGATTAGAGACGGCACCTGG + Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926897543 2:17710881-17710903 CAGAGAAAAGTGACAGTAGCAGG + Intronic
927073584 2:19554422-19554444 TAAAAAGAAGAGAAGGCAGCAGG + Intergenic
927301288 2:21518777-21518799 CAGAAAAATGAGCAGGCAACTGG - Intergenic
927386556 2:22540887-22540909 CAGAGAAGAGTGAATGCAGCTGG - Intergenic
927522496 2:23707874-23707896 CTGAGAAAAGGGAAGCCAGGAGG + Exonic
927720887 2:25381281-25381303 CAGACAAGAAAGAAGGCAGGAGG - Intronic
927990057 2:27441655-27441677 CTGAGAGAAGAGAAGGCATGGGG - Intronic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928208043 2:29301331-29301353 GAGAGAGAAGACAAGGCAGCAGG - Intronic
928365562 2:30697978-30698000 GAGATAAAAGAAAAGACAGCTGG - Intergenic
928373788 2:30759207-30759229 GAGAGAAGAGGGAAGGCAGGGGG - Intronic
928685623 2:33746060-33746082 CAGAGAACAGGGAAAGCAGAGGG - Intergenic
928721562 2:34127088-34127110 GAGATAAAACAGAAGGCATCAGG - Intergenic
928857012 2:35814285-35814307 CAGAGAAAAGAGAGGAGAGAAGG - Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929561613 2:42959888-42959910 CAGAAAAAAGAAAAGGCTGGGGG - Intergenic
929660472 2:43779393-43779415 AAGGAGAAAGAGAAGGCAGCAGG - Intronic
929697028 2:44126491-44126513 AAGAGAACAGAGTATGCAGCTGG + Intergenic
929913706 2:46115846-46115868 AAGAGAAAACAGAAGGCAAAGGG - Intronic
930094417 2:47556115-47556137 CAGAGAAATGGGAAAGTAGCAGG + Intronic
930102365 2:47613365-47613387 AAGAAAAAAGAGACAGCAGCTGG - Intergenic
930115780 2:47717101-47717123 AAGATAAAAGACAAGACAGCTGG - Intronic
930170867 2:48250221-48250243 CAGAGAAAAGGGAGTGCAGCCGG + Intergenic
930766554 2:55091084-55091106 CAGAGGAAAGACAGGGCAACTGG - Intronic
930769787 2:55119884-55119906 AGGAGAAATGAGAAGCCAGCTGG - Intergenic
930813706 2:55569782-55569804 GAGATAAAAGAAAAGACAGCTGG - Intronic
931231156 2:60375982-60376004 CAGGGAAAAGGGAAAGCAGGAGG + Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932342730 2:70976880-70976902 GAGATAAAAGAAAAGACAGCTGG + Intronic
932349842 2:71022917-71022939 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
932813330 2:74842629-74842651 CAGAGGACAGAGAAGTCAGAAGG + Intronic
933209553 2:79551273-79551295 AAGGGGAAAGAGAAGGCAACAGG + Intronic
933216824 2:79640199-79640221 CAGAGAAAAGAAAAGTCACTAGG + Intronic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
933861750 2:86476457-86476479 CAGAGAAAAGAAAGAGCAACAGG - Intronic
934543258 2:95193698-95193720 GAGATAAGAGAAAAGGCAGCTGG - Intergenic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
935523345 2:104136964-104136986 CAGGAAAGAGAGAAGACAGCAGG + Intergenic
935729272 2:106051661-106051683 CAGAGAGAAGAGAAAGCAGGTGG + Intergenic
935881915 2:107573642-107573664 GAGATAAGAGAAAAGGCAGCTGG - Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936144476 2:109970608-109970630 CAAAGAGAAGAAAAGACAGCTGG - Intergenic
936200211 2:110400861-110400883 CAAAGAGAAGAAAAGACAGCTGG + Intergenic
936388299 2:112050033-112050055 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
936488312 2:112946495-112946517 AAGAGAAAATTGAAGCCAGCAGG + Intergenic
936633060 2:114225582-114225604 AAGACAAAAGAGAGGGCAGATGG + Intergenic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
938067002 2:128286802-128286824 CAGAAAACAGAGCAGGCTGCTGG + Intronic
938555452 2:132419202-132419224 CAGAGTAAAGTCAAGTCAGCTGG - Intronic
938725723 2:134107495-134107517 CACAGACAAGAGTAGGCAGATGG - Intergenic
938991976 2:136639024-136639046 AAGAGAAAATGGAAGGCAACAGG - Intergenic
939021646 2:136964674-136964696 AAGAGAAATGAGATGACAGCTGG - Intronic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939339252 2:140872230-140872252 AAGAAAACAGAGAAGGCACCAGG + Intronic
939345665 2:140963934-140963956 CAGATAAGAGAAAAGGCAGCTGG + Intronic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
940132280 2:150395988-150396010 CAGAAAAAAGCAAAGACAGCTGG - Intergenic
940357175 2:152755777-152755799 GAGATAAAAGAAAAGACAGCTGG - Intronic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
940441185 2:153718627-153718649 CAGTGACATGAGGAGGCAGCAGG + Intergenic
940658706 2:156520112-156520134 GAGAGAAAAGAAGAGGCAGCTGG - Intronic
940761238 2:157741736-157741758 AAGAGAACAGAGAAGACAGTGGG + Intronic
940869417 2:158847695-158847717 GAGAGAGAAAAGATGGCAGCTGG + Intronic
940872094 2:158868692-158868714 GAGAGAGAAGAGATGGCAGCTGG + Intergenic
940988199 2:160070939-160070961 AAGAAAATAGAGAAGGTAGCAGG - Intergenic
941168031 2:162104346-162104368 CAGGGGAAAGAGAGGGCACCAGG + Intergenic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
941667373 2:168255863-168255885 CAGAGAAAAGAGAGAGCAGAAGG + Intergenic
941928273 2:170916859-170916881 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
941994789 2:171592121-171592143 CAGAGTAAAGTCAAGGCAGTGGG - Intergenic
942115745 2:172727273-172727295 CAGAGGAAAGAGCAGACAGAGGG + Intergenic
942171026 2:173289719-173289741 AAAAGAAAAGAGACTGCAGCTGG - Intergenic
942345311 2:174996738-174996760 GAGAGAGGAGAGAGGGCAGCTGG - Intronic
942450655 2:176106481-176106503 CAGAGAGAAGGGAAGAGAGCCGG + Intronic
942981696 2:182091718-182091740 CAGAGAAAAGAAAAACAAGCAGG - Intronic
943008351 2:182414613-182414635 GAAAGAAAAGAGAGGGCAGTGGG + Intronic
943033155 2:182709874-182709896 CAAACAAAAGAGAAGGCAGTAGG - Intergenic
943325551 2:186493391-186493413 AAGAGAAAAGAGCAGGTAGAAGG - Intronic
943470683 2:188291503-188291525 CAGAGATAAGAAAAGGCAAATGG + Intergenic
943544679 2:189259949-189259971 CATAGAAAAGAGAAAGAAGAGGG + Intergenic
943618335 2:190119224-190119246 GAAAGAAAAGAGAAGGCAGAAGG + Intronic
943722709 2:191221602-191221624 GAGAGAAAAGTGAAGGGATCAGG + Intergenic
943803636 2:192093628-192093650 CAGACAAAAGAGACGGCACCAGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944209991 2:197197229-197197251 AAGGGAAAGGATAAGGCAGCAGG + Intronic
944231559 2:197399046-197399068 GAGAGAAAAAAGGAGGCAGCTGG + Intronic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944477841 2:200125509-200125531 GAAAGAAAAGAGAAGACAGAAGG + Intergenic
944499153 2:200340528-200340550 CAGAGAACAAAGATGGCAGCTGG - Intronic
944686477 2:202122254-202122276 CAGACAAGAGAAAAGGCAGAGGG + Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945064842 2:205939956-205939978 GAAAGAACAGAGAAGGCAGAAGG + Intergenic
945515349 2:210757438-210757460 CAATGAAAAGAGCTGGCAGCTGG + Intergenic
945554546 2:211262689-211262711 CAGAGAAAAGAGAGGAGAGAGGG - Intergenic
945779536 2:214152612-214152634 GAGATAAAAGAAAAGACAGCTGG + Intronic
945984418 2:216342359-216342381 CTGGAACAAGAGAAGGCAGCTGG + Intronic
946049290 2:216848548-216848570 CAGAAAAAAGAATAGTCAGCAGG - Intergenic
946153150 2:217789673-217789695 CAGAGAGGAGGGAAGGCAGAGGG + Intergenic
946906215 2:224418968-224418990 GAGAGAAAAGTGGAGGCAGTGGG - Intergenic
946916957 2:224532980-224533002 CAGAGAAAAGAGAAAGCATCAGG - Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947262203 2:228235970-228235992 CAGAGAAAAGAAAAGTTATCTGG - Intergenic
947397974 2:229705419-229705441 AAGAGAAAAGAAAAGGCACGGGG - Intronic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947523624 2:230865837-230865859 TGGAGAAAAGAGAGGGGAGCAGG - Intronic
947542335 2:230987577-230987599 CACAGAAAAGGGAAAGAAGCCGG - Intergenic
947718298 2:232352619-232352641 CCGGGACAAGTGAAGGCAGCGGG + Intergenic
947805151 2:232961416-232961438 CAGCTAAAAGAGCAGGCAGCAGG - Intronic
947877436 2:233477102-233477124 AAAAGAAAAAAAAAGGCAGCTGG + Exonic
948218169 2:236247565-236247587 TAGATAAATGTGAAGGCAGCAGG - Intronic
948627864 2:239280170-239280192 CAAAGAAAAAAAAAGGCATCTGG + Intronic
948770841 2:240250638-240250660 CTGAGGACAGAGAAGGCACCTGG + Intergenic
949019286 2:241732153-241732175 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1169295462 20:4393711-4393733 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1169677377 20:8169190-8169212 CAAAGTAAAGAGATGGCAGTAGG - Intronic
1169820732 20:9707101-9707123 AACAGAAAAGAAAAGACAGCAGG - Intronic
1169963619 20:11190941-11190963 CAGAGAAAAGAGAGAGCAGAAGG + Intergenic
1170119438 20:12895615-12895637 GACAGGGAAGAGAAGGCAGCTGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170498250 20:16947934-16947956 AAGAGAAAAGGAAAGTCAGCTGG - Intergenic
1170692743 20:18629834-18629856 CAGAAATAAGAGAAAGCAGGGGG + Intronic
1170757852 20:19220433-19220455 CAGAGGACAGAGAAAGGAGCAGG + Intronic
1170778637 20:19403617-19403639 CAGACATAGCAGAAGGCAGCAGG + Intronic
1170857553 20:20071116-20071138 CAGTTAAAAGTGAAGGGAGCTGG + Intronic
1171283233 20:23918632-23918654 GAGCCAAAAGAGAAGGCAGCAGG - Intergenic
1171511598 20:25689983-25690005 CATTAAAAACAGAAGGCAGCTGG + Intronic
1172171636 20:32938880-32938902 AAAAGAGAAGAGAAAGCAGCTGG - Intronic
1172306891 20:33887071-33887093 CAGAGAACAGGGAAGGCAGTGGG + Intergenic
1172358974 20:34299092-34299114 GAGACAAGAGAAAAGGCAGCTGG - Intronic
1172393609 20:34583460-34583482 CAGGCAGAAGAGAAGACAGCAGG + Intronic
1172537786 20:35687629-35687651 GAGATAAAAGAAAAGACAGCTGG - Intronic
1172772761 20:37391252-37391274 CAGATGAAAGAGGAGGCTGCAGG - Intronic
1173145779 20:40522930-40522952 CAGAGAAAAGGACAGGGAGCTGG + Intergenic
1173467686 20:43296195-43296217 GAAAGAGAAGAGATGGCAGCAGG - Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174109216 20:48186421-48186443 CAGTGAGAAGAGAGGCCAGCAGG - Intergenic
1174583573 20:51590660-51590682 CAGACAAAGGAGAAGGCAAAGGG - Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175533808 20:59693286-59693308 CAAAGAGAAGAGAAGGGAGATGG - Intronic
1175755313 20:61525876-61525898 CAGAGAAAAGCGGAGCCACCGGG + Intronic
1175962741 20:62645399-62645421 CAGGGGCCAGAGAAGGCAGCAGG - Intronic
1176007497 20:62874434-62874456 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1176263589 20:64196770-64196792 CAGAGAATAGAGAGGGTTGCAGG - Intronic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176293513 21:5058793-5058815 CAGGGAAGAGGGAAGGCAGGAGG - Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176968228 21:15235825-15235847 CAGGCAAGAGAGAAGACAGCAGG - Intergenic
1176983805 21:15412802-15412824 CAGAGAAAGGAGAAAGCTCCAGG + Intergenic
1176995369 21:15549296-15549318 CAAAGAGAAGAGAAGTAAGCTGG + Intergenic
1178040980 21:28640754-28640776 CACATAAACCAGAAGGCAGCTGG - Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178310534 21:31526268-31526290 CAGGGAAGATGGAAGGCAGCGGG + Intronic
1178785451 21:35649260-35649282 CCAGGAAAAGAGAAGGCAGGAGG - Intronic
1178996904 21:37410745-37410767 CACAGAAAATAGAAGACAGTTGG + Intronic
1179167950 21:38949257-38949279 AAGAAAAAAGGGAAGGCAGAAGG - Intergenic
1179253644 21:39696719-39696741 CAGAGAAACAAGAAGGGAGGAGG - Intergenic
1179863747 21:44204855-44204877 CAGGGAAGAGGGAAGGCAGGAGG + Intergenic
1179916090 21:44479180-44479202 GAGATAAGAGAAAAGGCAGCTGG + Intergenic
1180097841 21:45568211-45568233 CAGAAGCAAGAGGAGGCAGCTGG + Intergenic
1180186778 21:46144258-46144280 CAAAGAGAAGAAAAGACAGCTGG - Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181417409 22:22770677-22770699 CAGAGAAAAGGGCAGGGAGGTGG - Intronic
1181537489 22:23554132-23554154 CACCGAAAGGCGAAGGCAGCGGG - Intergenic
1181729831 22:24837086-24837108 GAGACAAGAGAAAAGGCAGCTGG + Intronic
1181752313 22:24997340-24997362 CAGGAAAAAGAGAAGGCGACTGG + Intronic
1181837896 22:25626028-25626050 GAGATAAAAGAAAAGACAGCTGG - Intronic
1181976226 22:26732290-26732312 CAGGGAAAAGGGGAAGCAGCTGG - Intergenic
1182246868 22:28965064-28965086 CTGTCAAAAGAGAAGGGAGCAGG + Intronic
1182261824 22:29078427-29078449 CAGAGGAAAGCCCAGGCAGCAGG + Intronic
1182427933 22:30284655-30284677 CCCAGAAAAAAGCAGGCAGCGGG + Intergenic
1182915869 22:34029938-34029960 CACAGAAAAAAGAAGGTAGATGG - Intergenic
1183345031 22:37302890-37302912 CAGAGAACAGAGTGGGCAGGGGG + Intronic
1183469939 22:37999799-37999821 CAGAGGTAAGAGAAGGTAACAGG + Intronic
1183918202 22:41140821-41140843 TAGTGAAAAGAGAACACAGCTGG - Intronic
1183933886 22:41250825-41250847 CAGGGAGAAGAGCAGCCAGCTGG + Intronic
1184351578 22:43947579-43947601 GAGATAAAAGAAAAGACAGCTGG + Intronic
1184362664 22:44027496-44027518 CAGAGACAGCTGAAGGCAGCGGG + Intronic
1184533295 22:45070529-45070551 CAGAGAAAGGAGACAGCAGAGGG + Intergenic
1184799087 22:46749170-46749192 CAGAGAAAGCAGCAGGCAGTCGG - Intergenic
1184968290 22:47997075-47997097 GAGACAAAAGAGAAGGCACAGGG + Intergenic
1184987885 22:48147762-48147784 CAGAAAAAAGAGAATGGAGCTGG - Intergenic
1185336703 22:50274119-50274141 GAGATAAGAGAAAAGGCAGCTGG - Intergenic
949243424 3:1897001-1897023 CAGAGGAAACAGAAGGCATAAGG - Intergenic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949499631 3:4667345-4667367 GAGAGAAAAGAGACGTCAGTAGG - Intronic
949545553 3:5069189-5069211 CATAGAGAAGAGAAGTCACCAGG - Intergenic
949584534 3:5424965-5424987 CAAAACAAAGAGGAGGCAGCTGG - Intergenic
949759726 3:7456630-7456652 CAGATCTAAGAGGAGGCAGCAGG - Intronic
949882949 3:8675872-8675894 CAGAGAGAAAAGATGGCAGCTGG + Intronic
949883311 3:8677595-8677617 GAGAGAGAAAAGATGGCAGCTGG + Intronic
949883937 3:8680091-8680113 GAGAGAGAAAAGATGGCAGCTGG + Intronic
949884448 3:8682277-8682299 GAGAGAGAAAAGATGGCAGCTGG + Intronic
949925653 3:9038929-9038951 CAGAGAAATGAGGATGTAGCTGG - Intronic
949953366 3:9247859-9247881 CAGAGAAAGGAGGAGCCTGCTGG + Intronic
949953643 3:9249783-9249805 CTCACAAAAGGGAAGGCAGCAGG + Intronic
949996427 3:9620833-9620855 CAGAGAAAAAAGGAGACAGAAGG - Intergenic
950200831 3:11042517-11042539 CAGAGAGAAGAGTAAGCAGCTGG - Intergenic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
950401361 3:12771507-12771529 GAGACAAAAGAAAAGACAGCTGG - Intergenic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
951233750 3:20210874-20210896 CAAGGAAAAGTGAAGGAAGCAGG - Intergenic
951541168 3:23783409-23783431 CAAGTAAATGAGAAGGCAGCTGG + Intergenic
951701295 3:25499414-25499436 CAGAAGAGAGAAAAGGCAGCAGG + Intronic
952445142 3:33373815-33373837 CAGAGAAAACAAAAGACAGCTGG - Intronic
952887818 3:38022302-38022324 CTGAGACAAGAGGAGGCAGAAGG + Intronic
953085581 3:39663409-39663431 AAAAAAAAAAAGAAGGCAGCAGG + Intergenic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
953770678 3:45776863-45776885 GTGAGAAAAGAGAAGGCTCCAGG + Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
953852002 3:46471623-46471645 CGGAGAAAGGAGCAGGGAGCGGG + Intronic
954365951 3:50146280-50146302 AAAAGAAAAGACAAGGCAGAGGG + Intergenic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955249822 3:57269008-57269030 AATAGAAAAGAGGAGACAGCTGG + Exonic
956164815 3:66388672-66388694 CACAGAGAACAGAAGGCAGTAGG + Intronic
956447444 3:69339463-69339485 CACAGAACTGAGAAGGCAACAGG + Intronic
956504255 3:69920781-69920803 GAGATAAAAGAAAAGACAGCTGG - Intronic
957044498 3:75363400-75363422 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
957076290 3:75605584-75605606 GAGAGAGAAAAGATGGCAGCCGG - Intergenic
957155429 3:76538296-76538318 CGTAGAAAAGAGAAGGGAGAGGG - Intronic
957274102 3:78068163-78068185 GAAAGAAAAGAGAAGGCAGAAGG + Intergenic
957329807 3:78747200-78747222 CTGAGAAAAATGTAGGCAGCAGG - Intronic
957969843 3:87368672-87368694 CAGAGTAAAGAGGAGGCACTAGG + Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
961203790 3:125064978-125065000 TAGAGAATAGAGAAGCCAGAAGG - Intergenic
961275013 3:125719595-125719617 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
961277929 3:125742226-125742248 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
961515257 3:127428238-127428260 GAAAGAAAAAAGAAGGCATCAGG - Intergenic
961876493 3:130027436-130027458 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
962122786 3:132580794-132580816 AAGAGAAAAGAAAGGGTAGCTGG - Intronic
962347562 3:134629562-134629584 CAGAGAGGATTGAAGGCAGCTGG - Intronic
962405240 3:135094666-135094688 CAGAGAAGAGGGAAAGCAGGAGG - Intronic
962812634 3:138972497-138972519 CAGAGACAGGAGAAGCCAGCTGG + Intergenic
962929617 3:140024312-140024334 CAGATACAAGAAAAGGCAGAAGG - Intronic
962940001 3:140117109-140117131 CTGAGGAATGAGAAAGCAGCAGG - Intronic
963007500 3:140739630-140739652 CAGAGAAAAAGCCAGGCAGCAGG - Intergenic
963008436 3:140748235-140748257 CAGAGCAAAGAGGAAACAGCAGG - Intergenic
963832072 3:150018891-150018913 AAGGGAAAAGATAAAGCAGCAGG + Intronic
963899813 3:150723463-150723485 AAAAGAAAAGAAAAGGAAGCAGG - Intergenic
964101464 3:152992803-152992825 GAGATAAAAGAAAAGACAGCTGG - Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
965099387 3:164277391-164277413 GAAAGAAAAGAAAAGGCAGAAGG + Intergenic
965174033 3:165307583-165307605 CTGAGCAAAAAGAAGACAGCTGG + Intergenic
965431636 3:168596267-168596289 CAGAAAATAGAAATGGCAGCAGG - Intergenic
965439731 3:168698501-168698523 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
965644039 3:170860975-170860997 GAGATAAAAGAAAAGACAGCTGG - Intergenic
966879036 3:184339259-184339281 CAGAGAAAAGAAGAGGCTGTCGG + Intronic
967161423 3:186742005-186742027 CAGACACAAGAGAAGACAGAAGG + Exonic
967365978 3:188686959-188686981 GAGAGAAAAGCTAAGGCACCTGG + Intronic
967457355 3:189703518-189703540 AAAAGAAAAGAAAAGGCAGGTGG + Intronic
967664886 3:192159079-192159101 TAGAGAAATGAGGAGGGAGCTGG - Intronic
967900731 3:194449088-194449110 CACAGAACAGAAAAGACAGCTGG + Intronic
968108620 3:196022834-196022856 GAGATAAAAGAAAAGACAGCTGG - Intergenic
968350975 3:198051569-198051591 GAGATAAAAGAAAAGACAGCTGG - Intergenic
968397848 4:260013-260035 AAGAGATAAAAGAAGGCAGCTGG - Intergenic
968704772 4:2072757-2072779 CAGTGAACAGGGACGGCAGCCGG - Intronic
968988762 4:3894641-3894663 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
969019739 4:4131883-4131905 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969379863 4:6787711-6787733 CAGAAAAAAGAGAGGCCAGTTGG - Intronic
969538803 4:7773059-7773081 CAAACAACAGAGAAGGCACCTGG + Intronic
969566521 4:7982004-7982026 CAGAGAGGGGAGAAGGCACCAGG - Intronic
969680326 4:8639747-8639769 CAGAGAAAACAGAGGCCAGGAGG - Intergenic
969729376 4:8944880-8944902 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
969734117 4:8975529-8975551 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
969793698 4:9509587-9509609 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
969826606 4:9762954-9762976 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
972138142 4:35918881-35918903 CAGAGAAGTGAGAAAGGAGCTGG + Intergenic
972164567 4:36266664-36266686 GAGAGAAAAGGGGAGGTAGCTGG - Intergenic
972321184 4:37975027-37975049 AAGATAAAAGAAAAGACAGCTGG + Intronic
972506298 4:39723349-39723371 AAAAAAAAAGAGAAGACAGCAGG - Intronic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
973319126 4:48792338-48792360 AAGAGGAAAGAGGAGGCAGGAGG + Intergenic
973884859 4:55310281-55310303 CAGTGAAAAGAGAAAAAAGCAGG + Intergenic
974240020 4:59235304-59235326 GAGATAAAAGAAAAGACAGCTGG + Intergenic
974243149 4:59278668-59278690 CTGAGTAAAAAGAAGACAGCTGG + Intergenic
974314098 4:60255311-60255333 CTGAGAAAATAGAAGGTAGTTGG - Intergenic
974493453 4:62596030-62596052 GAGATAAAAGAAAAGACAGCTGG - Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
974933746 4:68389432-68389454 GAAAGAAAAGAGAAGGCAGAAGG + Intergenic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
975377754 4:73665541-73665563 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
975387405 4:73773651-73773673 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
976426081 4:84904965-84904987 GAGATAAAAGAAAAGACAGCTGG - Intronic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
977082873 4:92555508-92555530 GTGAGAAAAATGAAGGCAGCTGG + Intronic
977662473 4:99606794-99606816 CAGAGAAAAAAGAGGACACCAGG + Exonic
977736042 4:100417222-100417244 CATAGAAAAGAGTGGACAGCAGG - Intronic
977742656 4:100505243-100505265 GAGATAAAAGAAAAGACAGCTGG - Intronic
978308056 4:107353905-107353927 GAGATAAAAGAAAAGACAGCTGG + Intergenic
978367217 4:107995045-107995067 CAGATAAGAGAGAAGGGAGAGGG - Intronic
978384780 4:108168267-108168289 CCGAGAAAAGAGAGGGGATCTGG + Exonic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978980630 4:114940853-114940875 GAGAGAAGAGAAAAAGCAGCTGG - Intronic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
979147792 4:117267209-117267231 AAGAGAAGGGACAAGGCAGCAGG + Intergenic
979677357 4:123424533-123424555 AAAAGAAAAGAGAAGGCAAGTGG - Intergenic
979900196 4:126206220-126206242 CAAAGAAAAGAGAATAAAGCTGG - Intergenic
980829006 4:138106958-138106980 CAGTGAGAAAAGAGGGCAGCTGG + Intergenic
980844074 4:138302944-138302966 CTAAGAAAAGAAAAAGCAGCAGG - Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982386991 4:154817786-154817808 CAGAGAAAACAGAACGCAAATGG - Intronic
982429405 4:155305558-155305580 GAAAGAAAAGAGAAGGCAGAAGG + Intergenic
982469243 4:155767221-155767243 AAGAAAAAAGAAAAAGCAGCAGG - Intronic
983120691 4:163881063-163881085 TAGAGAAAAGACATGGGAGCTGG + Intronic
984272750 4:177567661-177567683 CAGAGAAGAGAGATGGCTGGAGG + Intergenic
984540796 4:181034682-181034704 CAGAGACAAGGTAAGGAAGCAGG - Intergenic
984670974 4:182486972-182486994 AAGAGAAAAGAGAAAACAGGGGG - Intronic
984727167 4:183032656-183032678 TAGAAAAAAGAGAAGGCATCAGG + Intergenic
984789324 4:183600448-183600470 CAGAGAAAAGGGAATGGAGATGG + Intergenic
985091154 4:186363794-186363816 GAGATAAAAGAAAAGACAGCTGG - Intergenic
985291298 4:188390941-188390963 GAGATAAAAGAAAAGACAGCTGG + Intergenic
985420257 4:189778190-189778212 CAGAGAGAAGAGATGTCATCTGG - Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
985754373 5:1704436-1704458 AAGAGAACGGAGAAGGCAGTGGG - Intergenic
986061736 5:4198167-4198189 CAGGGAAAATAGAAGGCATCTGG + Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986226024 5:5813471-5813493 GAGAGCAAAGAGTAGGCACCTGG + Intergenic
986242650 5:5975078-5975100 CAGAGAAGAGAGAATGCAAGAGG - Intergenic
986245019 5:5999208-5999230 CAGAAGAAAGAGTAGGCAACAGG + Intergenic
986272519 5:6246263-6246285 AAAAGAAAAGAAAAGGGAGCTGG + Intergenic
986667066 5:10113509-10113531 AAGAGCAAACAGAAGGCATCTGG - Intergenic
987490768 5:18578047-18578069 GAGAGAAAAGAGAAGGTAGTAGG + Intergenic
987608802 5:20175343-20175365 CAGGAAAAATAGGAGGCAGCAGG - Intronic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988523308 5:31965175-31965197 GAAAGAAAAGAGAAAGCAGAAGG + Intronic
988548717 5:32181130-32181152 CAGAGAAAAAAAAAGGAAACTGG + Intergenic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
989170799 5:38469060-38469082 GAAAGAACAGGGAAGGCAGCTGG + Intergenic
989606432 5:43248519-43248541 AATAGAAAAGAGGAGGGAGCTGG + Intronic
990123343 5:52483602-52483624 AAGAGAAAAGAGTGGGCAGTAGG + Intergenic
990384497 5:55246393-55246415 CAGAGGAAGGAGAAGCCAACAGG + Intergenic
990609572 5:57443963-57443985 CAGAGATAAGAGCAGGCTGAGGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
990879423 5:60522767-60522789 TATAGAAGAGAGCAGGCAGCAGG - Intergenic
991004174 5:61811658-61811680 CACAGAGACGAGAAGGCAGCAGG + Intergenic
991145324 5:63296264-63296286 CAGAGATTAGAGAGGGCAGTGGG - Intergenic
991353802 5:65747411-65747433 ATGAGAATAGAGAAGGTAGCTGG + Intronic
991544703 5:67768693-67768715 CAGAGAAACAAGTAGGCAGATGG + Intergenic
992499420 5:77327347-77327369 GAGAGAAAAGAGACAGCAGCAGG + Intronic
992632727 5:78697612-78697634 GAGAAAAAATGGAAGGCAGCAGG - Intronic
992998266 5:82354021-82354043 CAGAGTAAAGAAAATGCAGAAGG - Intronic
993046697 5:82874364-82874386 CAAAGAATACAGAAGGCAGGTGG + Intergenic
993196772 5:84758463-84758485 CAGGTAAAAGAGAAGTGAGCAGG - Intergenic
993328236 5:86567687-86567709 CAGAGAGAAAAGATGGCAGTTGG - Intergenic
993677959 5:90840156-90840178 GAGAGTAGAGAGAAGGCAGAGGG - Intronic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994516217 5:100775545-100775567 GAGATAAAAGAAAAGACAGCTGG - Intergenic
994886581 5:105570691-105570713 CAAACAAAAGAGAAGCCAGTTGG - Intergenic
995256796 5:110056176-110056198 CAGAGAAGGGAGAGAGCAGCTGG + Intergenic
995399212 5:111721443-111721465 CAGGGAAAAGAGAAAACAGGAGG + Intronic
996075817 5:119192432-119192454 CAGAGAAATGGGATAGCAGCTGG - Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996576719 5:124983871-124983893 GAGAGAAGAGAAGAGGCAGCTGG + Intergenic
996596628 5:125210472-125210494 CTGAGACAAGTTAAGGCAGCTGG + Intergenic
996647228 5:125830653-125830675 CAGAGAAGCCAGAAGTCAGCAGG + Intergenic
998008927 5:138677686-138677708 TACAGAAGAGAGAAGCCAGCAGG + Intronic
998046431 5:138990726-138990748 CGAAGAAAAGAAAAGCCAGCTGG - Intronic
998064877 5:139149958-139149980 GAGAGATAAGAGAAGGGAGAAGG + Intronic
998379373 5:141713117-141713139 CAGGGAAAAGAGAAGGCCTCTGG - Intergenic
998382020 5:141732379-141732401 CAGAGAAGAGAGAGGGGAGAAGG - Intergenic
998504480 5:142660882-142660904 CACAGAATAAAGAAGACAGCTGG - Intronic
998631182 5:143900686-143900708 CTGAGAACAGAGAAGGGAACTGG + Intergenic
998706201 5:144764316-144764338 CAGACAAGAGAGAAGGTAGATGG - Intergenic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
999949434 5:156633052-156633074 CAGAGAAAAAAGAAGTCACATGG - Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000030184 5:157394742-157394764 CAGGGAAGAGAGAAGGGAGGAGG + Intronic
1000161589 5:158602798-158602820 AAAAGAAAAAAGAAGGCAACAGG - Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000831876 5:166111982-166112004 AAGATAAAGGAGAAGGCAGAAGG - Intergenic
1001702051 5:173713818-173713840 CAGACATGAGTGAAGGCAGCAGG - Intergenic
1001742866 5:174068242-174068264 AAGAGAGAAAAGAAGGGAGCAGG + Intronic
1001777206 5:174337716-174337738 CAGACAGAAGAGAAGGGAACAGG - Intergenic
1001806504 5:174591313-174591335 CGGAGAGGAGAGAAGGCAGGTGG - Intergenic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1002495326 5:179607704-179607726 CAGAGAAAGGGGAATCCAGCGGG - Intronic
1002581221 5:180210419-180210441 CAGAGTGAGGTGAAGGCAGCTGG - Intergenic
1002776594 6:333185-333207 CAGAGACAGGAGGAGGCAACTGG + Intronic
1002845760 6:942933-942955 CAGTGCAAAAAGAATGCAGCAGG + Intergenic
1004013380 6:11710671-11710693 CAGAACTGAGAGAAGGCAGCCGG + Intergenic
1004151005 6:13120070-13120092 CACAGAGAAGAGGAGGCACCAGG - Intronic
1004196827 6:13512779-13512801 CAAAAAAAAGTGAAGCCAGCTGG + Intergenic
1004285760 6:14318980-14319002 CAGGGAAAAGTTAAGGAAGCTGG - Intergenic
1004576962 6:16905850-16905872 CACAGAAGAGGGAAGGAAGCTGG - Intergenic
1004618096 6:17309572-17309594 CAGAGAGAAGAGAAGAGAACTGG - Intergenic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1005106433 6:22229114-22229136 AAGAGAAAAGAGAAGACAGAAGG + Intergenic
1005159391 6:22841511-22841533 CTGAGAAAAAAGAATACAGCTGG + Intergenic
1005444479 6:25907509-25907531 CAGATAAAAGAAGAGGGAGCAGG + Intergenic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005631597 6:27713276-27713298 CAGAGAAAAGTGAAGACGGGTGG + Intergenic
1005709798 6:28491948-28491970 CAGATAAAAGAAAAGACAGCTGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006054536 6:31373752-31373774 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1006652065 6:35559802-35559824 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1006793224 6:36716969-36716991 GAGAGAAGAGAGAGGGCAGATGG + Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1007355685 6:41314132-41314154 CAGAGAATAGTGAAGGCAACTGG + Intergenic
1008216571 6:48797411-48797433 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1008561886 6:52732103-52732125 GAAAGAAAAGAGAAGGCAGAAGG - Intergenic
1008605964 6:53139957-53139979 AAGCGAAAAGAGAAGACAGACGG - Intronic
1010437033 6:75843716-75843738 AAAATAAAAGAGAAGGGAGCAGG - Intronic
1010816251 6:80361131-80361153 CAGAGAGAAAAGAATGAAGCTGG - Intergenic
1010831994 6:80542268-80542290 CAGATAAAAGAGGAAGCTGCAGG + Intergenic
1010993862 6:82511091-82511113 TGCAGCAAAGAGAAGGCAGCAGG + Intergenic
1011328265 6:86174729-86174751 GAGGTAAAAGAAAAGGCAGCTGG + Intergenic
1011979223 6:93351323-93351345 CAGAGAGAAGGGAAGCAAGCAGG - Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012523646 6:100151016-100151038 CAGAGAAAGGAGCAGCTAGCAGG + Intergenic
1013069535 6:106716111-106716133 CAGAGAAAAGGTAGGGCACCGGG + Intergenic
1013281165 6:108638384-108638406 CAGAGAAAAGAGAACACATTGGG + Intronic
1013470337 6:110458358-110458380 GAGACAAAAGAAAAGACAGCTGG - Intronic
1013604881 6:111738581-111738603 AAGAGGGAAGAGCAGGCAGCTGG - Intronic
1013706375 6:112839741-112839763 CATAGAAAAGATAAAGCTGCTGG - Intergenic
1013956727 6:115850899-115850921 CAGAGAAGAGAGAAGAGAGTAGG + Intergenic
1013976321 6:116082891-116082913 AAGAGAAAATAGGAGGCAGAAGG + Intergenic
1014321697 6:119937613-119937635 CAGAGAAAAGGGAATGCTGGTGG - Intergenic
1014333177 6:120096506-120096528 CAGAGAACATACAAGGTAGCAGG + Intergenic
1014605395 6:123467543-123467565 AAAAGAAAGGAGAAGCCAGCTGG + Intronic
1014682388 6:124447863-124447885 CAGAGAAAGGTGAAGACAGAGGG - Intronic
1014817249 6:125949753-125949775 CAGAAAAAGGAGAAGCCAACAGG - Intergenic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015127768 6:129773332-129773354 GAGAGAAAAGGGAAAGAAGCTGG + Intergenic
1015174392 6:130290904-130290926 CAGAGGAAAGGGAAAACAGCAGG - Intronic
1015276570 6:131388544-131388566 CAGAGAAAACAGAAGTCCTCGGG + Intergenic
1015675252 6:135738941-135738963 CAGAGAAAAAAAAAAGCAGGAGG + Intergenic
1016474456 6:144411181-144411203 CAGTGAAAAGGGAACGCTGCTGG - Intronic
1016583897 6:145662157-145662179 GAGAGAGAAGAGAAGGAAGTGGG - Intronic
1016681438 6:146833650-146833672 GAGATAATAGAGAAGGCAGAAGG + Intergenic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017772429 6:157653498-157653520 GAGAGAAAAGAAAACACAGCAGG - Intronic
1018016708 6:159719227-159719249 AAGAGATAAGAGAAGTCGGCTGG + Intronic
1018391659 6:163345894-163345916 CGTAGAAAGGAGAAGACAGCAGG + Intergenic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1018787390 6:167118889-167118911 CACAGAGTAGAGAAGGGAGCCGG - Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018925193 6:168201041-168201063 AAGTGGAAAGAGAAGGCAGTAGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019794436 7:3039351-3039373 AAGAAAAATTAGAAGGCAGCTGG - Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020311609 7:6872754-6872776 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1020814466 7:12888401-12888423 AAAAGAAAAGAAAAGGTAGCTGG - Intergenic
1020851937 7:13364416-13364438 GAAAGAAAAGAGAAGGCAAAAGG - Intergenic
1021321480 7:19218146-19218168 CAAAGAAAAAAGAAGAAAGCTGG + Intergenic
1021370534 7:19839541-19839563 CAGAGAAAAGGAAATGCAGTGGG - Intergenic
1021783351 7:24128763-24128785 CAGAGAGGAGAGCCGGCAGCTGG + Intergenic
1021867476 7:24972341-24972363 AAGAGAAAAGAGAATGTGGCTGG - Intronic
1022052107 7:26686353-26686375 AAGAGAAAGGAGGAGGCAGTGGG + Intronic
1022485908 7:30777476-30777498 CAGAGGAAAGAGGAGGCCGTAGG - Intronic
1023021731 7:36017407-36017429 GAGACAAGAGAAAAGGCAGCTGG + Intergenic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023074366 7:36468224-36468246 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1023473452 7:40550959-40550981 AAGAGAAAAGAGAAGAAAACAGG - Intronic
1023575190 7:41619755-41619777 GAGAGAAAAGAGAAGAAACCAGG - Intergenic
1023612293 7:41983260-41983282 CAGAGAAAAGAAAAGGCAGTAGG + Intronic
1023635505 7:42205505-42205527 CAAAGAACAGAGAGGGCAGCTGG + Intronic
1024189467 7:46991093-46991115 CAGATAAATGAGATGGCTGCTGG + Intergenic
1024291021 7:47804057-47804079 AAGAGAAAAGAAATGACAGCTGG + Intronic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1026255631 7:68708860-68708882 CAGAGAAAAAATAAGCAAGCAGG - Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026731724 7:72917761-72917783 GAGATAAAAGAAAAGACAGCTGG + Intronic
1026796548 7:73369491-73369513 CAGAGAAAATAAAAGCCACCAGG + Intergenic
1027189066 7:75987543-75987565 CAAAGAAAAGAAAAGGCAGCAGG + Exonic
1027301500 7:76841492-76841514 CAGTCAAAACAGAAGGCATCAGG + Intergenic
1027588467 7:80087880-80087902 CTAGGAAAAGAGGAGGCAGCAGG + Intergenic
1027820116 7:83032177-83032199 GAGTGAAAAGAGAAGCCAGATGG - Intronic
1027907946 7:84210508-84210530 GAGAGAAAAGAGAAATCAGCAGG + Intronic
1027948644 7:84783582-84783604 CAAAGAAAAGAGAAAGGAGGTGG + Intergenic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1028465489 7:91146850-91146872 CAAAGAAAAAAGGAGGCAGATGG - Intronic
1028470118 7:91196826-91196848 GTGAGAAGAGAGAAGGCTGCTGG + Intronic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1028622010 7:92835909-92835931 CACAGAAAAGTGCACGCAGCCGG - Intronic
1028848494 7:95510129-95510151 AAAAAAAATGAGAAGGCAGCTGG + Intronic
1029078280 7:97952856-97952878 GAGAGAGAAAAGATGGCAGCCGG - Intergenic
1029212011 7:98916843-98916865 CAGGGAGAAGAGAAGCCATCAGG - Intronic
1029346015 7:99979455-99979477 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1030606693 7:111645357-111645379 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1030820003 7:114083952-114083974 GAGAGAAAAGGGAAGTCAGTGGG + Intergenic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031053528 7:116969777-116969799 TAGAAAAAAGGGAAAGCAGCTGG + Intronic
1031131417 7:117837413-117837435 GAGAGAGCAGAGAAGGTAGCAGG - Intronic
1031490144 7:122377375-122377397 AAGAGTACAGAGAAGGCAGATGG - Intronic
1031750524 7:125566774-125566796 CAGAGAAAAGTGAAGACATGAGG + Intergenic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032015664 7:128379037-128379059 CAGAGCGAAGGGAAGGCAGAGGG + Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1032705534 7:134418475-134418497 TAGAGACAATAAAAGGCAGCAGG - Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033347964 7:140540214-140540236 GTGGGAGAAGAGAAGGCAGCAGG - Intronic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1033574099 7:142663241-142663263 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1033770311 7:144543825-144543847 GAGAGGAAAGGGAAGGGAGCAGG - Intronic
1033785736 7:144727621-144727643 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034143635 7:148848585-148848607 CAGATGACAGAGAAGGCAGATGG + Intronic
1034303372 7:150034326-150034348 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1034303936 7:150036405-150036427 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1034304460 7:150038331-150038353 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1034305000 7:150040307-150040329 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1034305144 7:150041055-150041077 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1034305632 7:150042831-150042853 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1034606412 7:152320035-152320057 GAGATAAAAGAAAAGACAGCTGG - Intronic
1034801213 7:154057819-154057841 GAGAGAGAAAAGATGGCAGCTGG + Intronic
1034801746 7:154059753-154059775 GAGAGAGAAAAGATGGCAGCTGG + Intronic
1034802166 7:154061359-154061381 GAGAGAGAAAAGATGGCAGCTGG + Intronic
1034828472 7:154288254-154288276 CAGGGATGAGAGGAGGCAGCAGG + Intronic
1034831030 7:154307523-154307545 CAGAGATAAGATAAGCCAGATGG + Intronic
1035967473 8:4209574-4209596 CAGGGAAAAGGAAAGGCAGGTGG - Intronic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1036790806 8:11718028-11718050 CAGAGAAAAGGGAACACAGAGGG - Intronic
1036816717 8:11907970-11907992 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1036833441 8:12039499-12039521 AAGAGAGAAAAGATGGCAGCTGG - Intergenic
1036855287 8:12286064-12286086 AAGAGAGAAAAGATGGCAGCTGG - Intergenic
1036903604 8:12689916-12689938 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1037264377 8:17041846-17041868 CAGAGAATATAGAAGCCATCAGG - Intronic
1037827365 8:22167426-22167448 CAGAGAAAAGTGATCACAGCAGG + Intronic
1038188408 8:25296487-25296509 GAGAGAAAGGAGTAGTCAGCTGG - Intronic
1038552324 8:28480923-28480945 GAGAGCAAAGAAAAGGAAGCAGG + Intronic
1038610537 8:29056708-29056730 CTGAGATAAGAAAGGGCAGCCGG - Intronic
1039118473 8:34118909-34118931 CAGAGAAACCTGAAGGCAGGTGG - Intergenic
1039241855 8:35565990-35566012 CAAAGAAAAAACAAAGCAGCAGG + Intronic
1039925765 8:41930805-41930827 GAGAGAAAAGAGAATGGAGTTGG + Exonic
1041787277 8:61648985-61649007 CAAGGAAAAGAGAGGTCAGCTGG + Intronic
1041803589 8:61825619-61825641 CAGAGAAAGGACAAGGCATGGGG - Intergenic
1041971001 8:63742634-63742656 CTCAGAAGAGAGGAGGCAGCTGG + Intergenic
1042442907 8:68848566-68848588 AGAAGAAAAGAGAAGGCAGAAGG - Intergenic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1042789703 8:72590346-72590368 AAAAGAAAAAAAAAGGCAGCAGG - Intronic
1042932317 8:74025709-74025731 AAAAGAAAAGAAAAGACAGCTGG + Intronic
1043417254 8:80063944-80063966 GAGAAAAAAGAGAAGCCAGAAGG + Intronic
1045030508 8:98130659-98130681 TAGAGAAAAGAGTAGGAACCAGG + Intronic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045112174 8:98946629-98946651 CAGAGAAAAGGGAAAGAAGATGG + Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045383552 8:101649533-101649555 CAGAGGAGAGAGAACACAGCAGG - Intronic
1045769298 8:105716034-105716056 CAGAGAAAAGAGATGCTGGCAGG + Intronic
1046067548 8:109214301-109214323 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1046660764 8:116946234-116946256 CAACCAAGAGAGAAGGCAGCTGG - Intergenic
1047329615 8:123874870-123874892 CAGAGAAATGAGATGGTAGCTGG - Intronic
1047693699 8:127382546-127382568 CAGAGGGAAGAAAAGGCAGTAGG + Intergenic
1047818561 8:128492854-128492876 CAGAGAAATGAAAAAGCAGAAGG - Intergenic
1047944242 8:129858993-129859015 AAGATAAAAGAAAAGACAGCTGG + Intronic
1048251952 8:132873868-132873890 CAGAAGAAAGAGTAGGCAGAAGG + Intronic
1048957463 8:139548822-139548844 CAGAGAGAAAAGATGGCAGTTGG - Intergenic
1049204476 8:141357324-141357346 CAGCGCAAAGACACGGCAGCAGG + Exonic
1049292493 8:141812001-141812023 AAGAGAAAGGAGATGGCAGGAGG + Intergenic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1049335939 8:142085330-142085352 AAGAGAAAAGAGAAGAGAGAGGG + Intergenic
1049516182 8:143058219-143058241 GAGATAAAAGAAAAGACAGCTGG + Intronic
1049521211 8:143092329-143092351 CAGAGAAAGGTGAAGACACCAGG + Intergenic
1049666289 8:143844721-143844743 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1049735301 8:144202027-144202049 AAAAAAAAAGAGAAAGCAGCAGG + Intronic
1049810684 8:144567958-144567980 GAGATAAAAGAAAAGACAGCTGG - Intronic
1049857257 8:144870443-144870465 AAGAGAAAAGAAAAGACACCTGG - Intergenic
1049881415 8:145066694-145066716 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1050020432 9:1278972-1278994 CAGAGAAAAGAGAAAGCTTTGGG - Intergenic
1050083328 9:1938528-1938550 GAGTGAAAAGAGAAGACAGGAGG + Intergenic
1050092738 9:2031796-2031818 TAGAAAAAAGTGAAGGCATCTGG - Intronic
1050227366 9:3475298-3475320 GAGATAAAAGAAAAGACAGCTGG + Intronic
1050984711 9:12067620-12067642 CACAGAAAAGAGAAAGAAGATGG + Intergenic
1051034655 9:12729135-12729157 TTGAAGAAAGAGAAGGCAGCTGG + Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051531316 9:18107072-18107094 CAGATATAAGAAAAGACAGCAGG - Intergenic
1052269531 9:26613448-26613470 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1052428239 9:28332583-28332605 CAGAAAAAAAAAAAGGCAGGGGG + Intronic
1052616025 9:30843072-30843094 CAGAGAACTGAGAAGACATCTGG - Intergenic
1052719422 9:32155426-32155448 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1052987117 9:34495843-34495865 CAGAGAATAGAGAGCGTAGCTGG + Intronic
1053288615 9:36865531-36865553 AAGAGAGGAGGGAAGGCAGCGGG + Intronic
1053736922 9:41107981-41108003 CAGAGAGAAAAGATGGCAGCTGG + Intergenic
1053900931 9:42794875-42794897 CAGGGAGAAGAGTGGGCAGCAGG + Intergenic
1054691450 9:68323416-68323438 CAGAGAGAAAAGATGGCAGCTGG - Intergenic
1054766178 9:69044463-69044485 CTCAGAAAAGAGAAGGCAGAAGG - Intronic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1054892117 9:70261993-70262015 GAGAAGAAAGAGAAGGTAGCTGG + Intronic
1054991171 9:71328460-71328482 AAGATAAAAGAGAAGTCGGCCGG - Intronic
1055414455 9:76065259-76065281 CAGTGAAAAGAGAACACTGCTGG - Intronic
1055476310 9:76666737-76666759 GAGATAAAAGAAAAGACAGCTGG - Intronic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055983909 9:82036247-82036269 CAGAAAAAACAGATGGCAGTGGG + Intergenic
1056095186 9:83245508-83245530 AAGAGAAAAGAGATGTTAGCTGG + Exonic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056286427 9:85091971-85091993 CAGAGAAAATGGGAGGCAGGGGG + Intergenic
1056865742 9:90226151-90226173 GAGAGAGAAAAGATGGCAGCTGG + Intergenic
1056917273 9:90756751-90756773 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1056951439 9:91043504-91043526 CAGAGAGAAGGGTAGGCAGGAGG - Intergenic
1057554531 9:96077039-96077061 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1057606393 9:96500821-96500843 CTGGGAAAAGAGAAGGCCCCAGG + Exonic
1057698038 9:97341271-97341293 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1057710705 9:97440551-97440573 CACAGAGAAGAGAAGGCTCCAGG - Intronic
1057755600 9:97832398-97832420 CTCAGAAAAGAGAAGGCATATGG - Intergenic
1057943236 9:99303174-99303196 AATAGAAAAAAAAAGGCAGCTGG + Intergenic
1058159166 9:101549114-101549136 GAGATAAAAGAAAAGGCAGCTGG + Intronic
1058575863 9:106400413-106400435 TAGAGATAGGAGAAGGTAGCAGG + Intergenic
1058793260 9:108472082-108472104 AGGAGAAAGGAGAAGTCAGCAGG - Intergenic
1058823551 9:108754670-108754692 AAGAGAGGAGAGAAGGCAGTAGG + Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1058960310 9:109986926-109986948 CTGAGAAAAGAGATAGCATCAGG - Intronic
1059192728 9:112342193-112342215 CTGAGAAACTAGAAGGCTGCTGG - Intergenic
1059653071 9:116333565-116333587 CAGATAAAAGCCAAGGGAGCAGG + Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1059990412 9:119859994-119860016 CAGAGAAAAGAAGAGGCATAGGG + Intergenic
1060005347 9:119994624-119994646 GGAAGAAAAGAGAAGGCAGTTGG + Intergenic
1060231590 9:121829346-121829368 CAAATAAAAGAGAAGACATCCGG + Intronic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060690712 9:125656833-125656855 CAGAGACACAAGAAGGCAGGGGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060747076 9:126144636-126144658 CACAAAAAAAAGAAGGCTGCAGG + Intergenic
1061039139 9:128129548-128129570 AAGAGACGAGAAAAGGCAGCTGG + Intergenic
1061041065 9:128140722-128140744 GAGAGAGAAAAGATGGCAGCTGG - Intergenic
1061048835 9:128182251-128182273 GAGATAAGAGAAAAGGCAGCTGG - Intronic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061535444 9:131245497-131245519 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1061785593 9:133026056-133026078 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1061811292 9:133163934-133163956 GACAGAAAAGAGAAGCCAGACGG + Exonic
1061835816 9:133328913-133328935 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1062024460 9:134333881-134333903 GAGAGGGAAGAGCAGGCAGCGGG - Intronic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062142283 9:134966206-134966228 CACAGTAAAGAGAAGCCTGCAGG - Intergenic
1062183867 9:135205918-135205940 GAGATAAAAGAAAAGACAGCTGG + Intergenic
1062477165 9:136734064-136734086 CAGATAAAAGAAAAGACAGCTGG + Intergenic
1062556898 9:137117122-137117144 CAAAGTATAGAGAAGGCAGTGGG - Intergenic
1062557269 9:137119456-137119478 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1062588417 9:137261768-137261790 CAAAGAAATGAAAAGACAGCTGG + Intronic
1062639424 9:137510665-137510687 GAGATAAGAGAAAAGGCAGCTGG - Intronic
1062645550 9:137546401-137546423 AAGATAAAAGAAAAGACAGCTGG - Intronic
1062648036 9:137559883-137559905 GAGATAAAAGAAAAGACAGCTGG - Intronic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185619747 X:1446385-1446407 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1185655867 X:1685111-1685133 AAGAAAGAAGAGAAGGCAGACGG - Intergenic
1185655956 X:1685818-1685840 AAGAAAGAAGAGAAGGCAGACGG + Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186055168 X:5642327-5642349 GAAAGAAAAGAGAAAGCAGAAGG - Intergenic
1186164491 X:6811968-6811990 AAGAGAAAATAGAAGGTACCAGG + Intergenic
1186220789 X:7347118-7347140 TAGATAAAACAGAAGGCACCTGG - Intronic
1186416485 X:9387423-9387445 CTGAGAGAAGAGAAGGGAACGGG + Intergenic
1186441713 X:9592653-9592675 GAGAAAAAAGAGAAGTCACCAGG - Intronic
1186661438 X:11671476-11671498 GAGAGAAAGGAGAAGGCAAATGG + Intergenic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1186864149 X:13702247-13702269 ATGAGAAAAGAGGAGGGAGCAGG - Intronic
1186993007 X:15089204-15089226 CAGAGGAACGATCAGGCAGCAGG + Intergenic
1187017896 X:15348643-15348665 CAGGGAAAAGGGATGGCAGAAGG - Intronic
1187121145 X:16407604-16407626 CTTAAAAAAAAGAAGGCAGCAGG + Intergenic
1187281106 X:17859394-17859416 CAGAGAGAAAAGCAGCCAGCAGG - Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1188190368 X:27165047-27165069 CAGGAAAAATAAAAGGCAGCAGG + Intergenic
1188212463 X:27441979-27442001 CAGAGAAAAGAAAAGACAGCTGG + Intergenic
1188282317 X:28285373-28285395 AAGAGAACAGAGAAGACACCAGG - Intergenic
1188811556 X:34657879-34657901 CAGAGAACAGAAGCGGCAGCAGG - Intergenic
1188948502 X:36338285-36338307 CAGAGAAATGGGATGACAGCTGG - Intronic
1189106255 X:38238740-38238762 GGGAGGAAAGAGAAGACAGCAGG + Intronic
1189722540 X:43934763-43934785 AAAAGAAAAGAGAAGGCTGCAGG - Intergenic
1190126187 X:47707728-47707750 GAGAGATAAAAGAAGGCAGCTGG + Intergenic
1190223533 X:48528642-48528664 CAGATACAAGAGAAGCCAGGAGG + Exonic
1190711254 X:53072289-53072311 CAGAGATAAGAGAGGGTAGCTGG - Intronic
1190713697 X:53087290-53087312 CTGAGAAAAGAGATGCCATCAGG - Intronic
1191692995 X:63960010-63960032 GGGAGAAAAGAGAAAGCAGCAGG + Intergenic
1191730771 X:64332959-64332981 AAGAAAAAAGAGAAGCCAACAGG - Intronic
1192197449 X:69038089-69038111 CAGAGAGAAGAGAGGTAAGCTGG - Intergenic
1192450276 X:71240491-71240513 CACAGGGCAGAGAAGGCAGCTGG + Exonic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193467015 X:81861817-81861839 TAGAGAAAAGAGAATGCTGATGG + Intergenic
1193582675 X:83285171-83285193 CAGAGGAATGATCAGGCAGCAGG - Intergenic
1193976576 X:88127587-88127609 GAGAGAAAAGAAAAGGCATGTGG + Intergenic
1194260875 X:91694065-91694087 CAGAGAGATGAGAAAGCAGCAGG - Intergenic
1194463283 X:94199215-94199237 CTCAGGAAAGAGAATGCAGCAGG - Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195581160 X:106504120-106504142 TAGAAAACAGAGAAGGCACCAGG + Intergenic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1196123711 X:112077849-112077871 AATAGAAAAGATAAGGCAGGTGG - Intronic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196805133 X:119576775-119576797 CAAAGAAAAGAAATGACAGCAGG + Intronic
1197077881 X:122375165-122375187 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1197147781 X:123188168-123188190 CAGAGAAAGCAACAGGCAGCTGG - Intronic
1197242776 X:124137327-124137349 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1197892880 X:131283310-131283332 AAGAGAAAACAGAAGACAACAGG - Intronic
1198287594 X:135207217-135207239 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1198344650 X:135747660-135747682 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1198501333 X:137251122-137251144 CAAAGAAAATAGTAAGCAGCTGG + Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1198998605 X:142606276-142606298 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1199066227 X:143421885-143421907 AAGAGAAAAGAGTGGGCAGGAGG - Intergenic
1199462368 X:148098754-148098776 CAGAGAACAGAGCAAGAAGCAGG + Intergenic
1199600256 X:149537434-149537456 GAGAGGAGTGAGAAGGCAGCAGG + Intergenic
1199650328 X:149942506-149942528 GAGAGGAGTGAGAAGGCAGCAGG - Intergenic
1199680836 X:150223577-150223599 GAGAGAAAAGAGAAGGAACATGG + Intergenic
1199803316 X:151272560-151272582 CAGAGAAAATAGATGCCACCAGG + Intergenic
1199989739 X:152979729-152979751 CAGAGAAAAAGCAAGGAAGCAGG - Intergenic
1200277489 X:154748391-154748413 GAGAGCAAAGGGAAGGTAGCGGG + Intronic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1200325297 X:155231595-155231617 AAGAGCAAATAGAAAGCAGCAGG + Intronic
1200579527 Y:4932867-4932889 CAGAGAGATGAGAAAGCAGCAGG - Intergenic
1201343854 Y:12961193-12961215 GAGATAAAAGAGAAGACAGCTGG + Intergenic
1201423590 Y:13825564-13825586 AAGATAAAAGAAAAGACAGCTGG - Intergenic
1201543835 Y:15138700-15138722 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1201707642 Y:16954558-16954580 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1201708205 Y:16959836-16959858 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1201748439 Y:17405789-17405811 GAGATAAAAGAAAAGACAGCTGG - Intergenic
1201955535 Y:19618415-19618437 CAGTGAAACCAGATGGCAGCTGG + Intergenic
1201974309 Y:19831909-19831931 GAGATAAAAGAGAAGACAGCTGG + Intergenic
1202075055 Y:21029032-21029054 CAGTGAGATGTGAAGGCAGCTGG - Intergenic