ID: 1198645577

View in Genome Browser
Species Human (GRCh38)
Location X:138802388-138802410
Sequence AAGGGTGAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2192
Summary {0: 1, 1: 19, 2: 187, 3: 532, 4: 1453}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198645577_1198645587 23 Left 1198645577 X:138802388-138802410 CCATCCTGCTTCTGCTCACCCTT 0: 1
1: 19
2: 187
3: 532
4: 1453
Right 1198645587 X:138802434-138802456 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225
1198645577_1198645588 24 Left 1198645577 X:138802388-138802410 CCATCCTGCTTCTGCTCACCCTT 0: 1
1: 19
2: 187
3: 532
4: 1453
Right 1198645588 X:138802435-138802457 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1198645577_1198645589 25 Left 1198645577 X:138802388-138802410 CCATCCTGCTTCTGCTCACCCTT 0: 1
1: 19
2: 187
3: 532
4: 1453
Right 1198645589 X:138802436-138802458 AGTCCCAATGAGATGAACTGGGG 0: 2
1: 1
2: 7
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198645577 Original CRISPR AAGGGTGAGCAGAAGCAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr