ID: 1198648474

View in Genome Browser
Species Human (GRCh38)
Location X:138836009-138836031
Sequence TGTAAGCTAGAAGACATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1811
Summary {0: 1, 1: 0, 2: 24, 3: 252, 4: 1534}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198648474_1198648482 14 Left 1198648474 X:138836009-138836031 CCCCCAATGTCTTCTAGCTTACA 0: 1
1: 0
2: 24
3: 252
4: 1534
Right 1198648482 X:138836046-138836068 AGGTCTGCTGTTAGTCTGATGGG 0: 174
1: 1943
2: 5321
3: 3974
4: 2333
1198648474_1198648480 -6 Left 1198648474 X:138836009-138836031 CCCCCAATGTCTTCTAGCTTACA 0: 1
1: 0
2: 24
3: 252
4: 1534
Right 1198648480 X:138836026-138836048 CTTACAGGGTTTCAAGTGAGAGG 0: 1
1: 0
2: 9
3: 58
4: 359
1198648474_1198648483 28 Left 1198648474 X:138836009-138836031 CCCCCAATGTCTTCTAGCTTACA 0: 1
1: 0
2: 24
3: 252
4: 1534
Right 1198648483 X:138836060-138836082 TCTGATGGGCCTCCCTTTTTAGG 0: 1
1: 113
2: 4900
3: 4512
4: 2006
1198648474_1198648481 13 Left 1198648474 X:138836009-138836031 CCCCCAATGTCTTCTAGCTTACA 0: 1
1: 0
2: 24
3: 252
4: 1534
Right 1198648481 X:138836045-138836067 GAGGTCTGCTGTTAGTCTGATGG 0: 165
1: 1841
2: 5266
3: 3438
4: 1931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198648474 Original CRISPR TGTAAGCTAGAAGACATTGG GGG (reversed) Intronic
901966499 1:12872518-12872540 TACAAGCTAGAAGAGAGTGGGGG - Intronic
901981893 1:13042767-13042789 TACAAGCTAGAAGAGAGTGGGGG - Intronic
902000191 1:13186146-13186168 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
902019439 1:13331913-13331935 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
902102000 1:13998042-13998064 TGCAAGTCAGAAGAGATTGGGGG + Intergenic
905963026 1:42061044-42061066 TACAAGCCAGAAGAGATTGGGGG + Intergenic
905987580 1:42300834-42300856 AGTCAGCTGGAAGAGATTGGGGG - Intronic
906586973 1:46986699-46986721 TACAAGCTAGAAGAAAGTGGGGG + Intergenic
906734117 1:48108015-48108037 TGTCAGATAGAAGCCACTGGCGG + Intergenic
906839375 1:49120521-49120543 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
906886497 1:49654139-49654161 TACAAGCCAGAAGAGATTGGGGG + Intronic
906993768 1:50767627-50767649 TATAAGCCAGAAGAGATTGGGGG + Intronic
907027268 1:51132876-51132898 TACAAGCCAGAAGAGATTGGGGG + Intronic
907565833 1:55432384-55432406 TATAAGCCAGAAGACAGTGGGGG + Intergenic
907838099 1:58130784-58130806 TATAAGCCAGAAGAGAGTGGGGG - Intronic
908059132 1:60327685-60327707 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
908099147 1:60772478-60772500 TACAAGCCAGAAGACAGTGGGGG + Intergenic
908178218 1:61577702-61577724 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
908419693 1:63947661-63947683 TGTCAGCTAGAAGACCTTCCTGG + Intronic
908639159 1:66203174-66203196 TACAAGCCAGAAGACAGTGGGGG - Intronic
908818727 1:68060023-68060045 TATAAGCCAGAAGAGATTGGGGG + Intergenic
908910728 1:69070306-69070328 TACAAGCCAGAAGAGATTGGGGG - Intergenic
908930349 1:69310819-69310841 TATAAGCCAGAAGAGATTGGGGG - Intergenic
908978563 1:69927134-69927156 TACAAGCCAGAAGACATTGGGGG - Intronic
909051341 1:70772343-70772365 TATAAGCTAGAAGGGACTGGGGG - Intergenic
909456922 1:75860590-75860612 TACAAGCCAGAAGACAGTGGGGG - Intronic
909678502 1:78264785-78264807 TACAAGCCAGAAGAGATTGGGGG + Intergenic
909682840 1:78311836-78311858 TACAAGCTAGAAGAGAGTGGGGG + Intronic
909689657 1:78393180-78393202 TACAAGCCAGAAGAGATTGGGGG - Intronic
909691446 1:78411489-78411511 TGCAAGCCAGAAGAAATTTGGGG + Intronic
909695436 1:78463723-78463745 TACAAGCAAGAAGAGATTGGGGG - Intronic
909697728 1:78485673-78485695 TACAAGCCAGAAGAGATTGGGGG + Intronic
909715277 1:78700397-78700419 TACAAGCCAGAAGAGATTGGGGG - Intergenic
909733826 1:78931246-78931268 TGCAAGTCAGAAGAGATTGGGGG + Intronic
909782760 1:79567994-79568016 TGTAAGGCAGAAGTCATTGGTGG - Intergenic
909806421 1:79877973-79877995 TACAAGCCAGAAGAAATTGGGGG + Intergenic
909948187 1:81687995-81688017 TACAAGCTAGAAGGGATTGGGGG - Intronic
910082706 1:83360562-83360584 TATAAACCAGAAGACATTGAGGG - Intergenic
910166674 1:84335871-84335893 TGCAAGCCAGAAGATATTGGGGG - Intronic
910319010 1:85922483-85922505 TATAAGCCAGAAGAGAGTGGGGG + Intronic
910319658 1:85928747-85928769 TATAAGCCAGAAGAGAGTGGGGG + Intronic
910454243 1:87378999-87379021 TACAAGCCAGAAGAGATTGGGGG - Intergenic
910514186 1:88039074-88039096 TACAAGCTAGAAGAGATTTGGGG + Intergenic
910563782 1:88620511-88620533 TATAAGCCAGAAGAGATTGGGGG + Intergenic
910699772 1:90061614-90061636 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
910812833 1:91255284-91255306 CATAAGCCAGAAGAGATTGGGGG + Intergenic
910912725 1:92254583-92254605 TAGAAGCCAGAAGACAGTGGGGG + Intronic
910954246 1:92684217-92684239 TACAAGCCAGAAGAGATTGGGGG + Intronic
911242965 1:95484987-95485009 TATAAGCCAGAAGAGAATGGAGG + Intergenic
911310542 1:96287654-96287676 TATAAGTCAGAAGAGATTGGGGG - Intergenic
911670502 1:100602565-100602587 TACAAGCCAGAAGACAGTGGGGG - Intergenic
911673774 1:100636563-100636585 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
911676742 1:100667305-100667327 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
911677969 1:100681253-100681275 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
911689981 1:100821755-100821777 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
911929361 1:103882577-103882599 TGTAAGGCAGAGGAGATTGGAGG + Intergenic
911940945 1:104047019-104047041 TATAAGCCAGAAGAGATTGGGGG - Intergenic
911979720 1:104551837-104551859 TATAAGCTAGAAGAGATTACAGG + Intergenic
912225944 1:107734025-107734047 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
912303777 1:108543675-108543697 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
912591233 1:110823151-110823173 TACAAGCCAGAAGAGATTGGGGG - Intergenic
912594935 1:110865395-110865417 TATAAGCCATAAGACATTGGGGG + Intergenic
912639224 1:111329172-111329194 TGCAAGCCAGAAGAGATTGGAGG - Intergenic
913362965 1:118003152-118003174 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
913398818 1:118404943-118404965 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
913434577 1:118833236-118833258 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
914910081 1:151778141-151778163 TGTAAGCTAGCAGACCTATGTGG - Intronic
914966497 1:152263075-152263097 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
914997195 1:152554329-152554351 TACAAGCCAGAAGAAATTGGGGG + Intronic
915046341 1:153020131-153020153 TACAAGCTGGAAGAGATTGGGGG + Intergenic
915654127 1:157344618-157344640 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
915759618 1:158297268-158297290 TAGAAGCCAGAAGACATTGAGGG + Intergenic
915763403 1:158337884-158337906 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
915876714 1:159618189-159618211 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
915990806 1:160513677-160513699 TACAAGCCAGAAGAGATTGGGGG + Intronic
915995594 1:160559296-160559318 TACAAGCCAGAAGAGATTGGGGG + Intronic
916038224 1:160940181-160940203 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
916140750 1:161694948-161694970 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
916154820 1:161834071-161834093 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
916469280 1:165107563-165107585 TACAAGCCAGAAGAGATTGGGGG - Intergenic
916603258 1:166315211-166315233 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
917060375 1:171031603-171031625 TACAAGCCAGAAGAGATTGGGGG - Intronic
917079247 1:171239173-171239195 TGCAAGCCAGAAGAGATTGGGGG + Intergenic
917111609 1:171554788-171554810 TATAAGCCAGAAGAGAGTGGGGG - Intronic
917173115 1:172200231-172200253 TATAAGCCAGAAGAGATTGGGGG - Intronic
917313125 1:173697480-173697502 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
917316167 1:173727565-173727587 TACAAGCCAGAAGACAGTGGGGG + Intronic
917324075 1:173813490-173813512 TACAAGCCAGAAGACAGTGGGGG + Intronic
917391641 1:174543921-174543943 TACAAGCCAGAAGACAGTGGGGG - Intronic
917401219 1:174652162-174652184 TACAAGCTAGAAGAGAGTGGGGG - Intronic
917406149 1:174710492-174710514 TGCAAGCTAGAAGAGAGTGGGGG + Intronic
917483779 1:175435964-175435986 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
917714648 1:177722038-177722060 TGTCAGCTGGAGGACATTGATGG - Intergenic
917714798 1:177723339-177723361 TACAAGCCAGAAGAGATTGGGGG + Intergenic
917903751 1:179569869-179569891 TATAAGCTAGAAGAGAGTGGGGG - Intronic
917998044 1:180461580-180461602 TGCAAGCCAGAAGAGATTTGAGG + Intronic
918156411 1:181850918-181850940 TACAAGCCAGAAGAGATTGGGGG + Intergenic
918272984 1:182921190-182921212 TGTAAGTCAGAAGAGATTGGGGG + Intronic
918619933 1:186591451-186591473 TACAAGCTAGAAGAGATTGGGGG + Intergenic
918631881 1:186728929-186728951 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
918691933 1:187491802-187491824 AGTAACCTAGAAAACAGTGGTGG + Intergenic
918786554 1:188770671-188770693 TACAAGCCAGAAGAGATTGGGGG + Intergenic
918839424 1:189514685-189514707 TACAAGCCAGAAGAGATTGGGGG + Intergenic
918968048 1:191377112-191377134 TACAAGCCAGAAGACAGTGGGGG - Intergenic
919077495 1:192831034-192831056 TGGAAGGTAGAGCACATTGGAGG + Intergenic
919141255 1:193574507-193574529 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
919387482 1:196940284-196940306 TATAAGCCAGAAGACAGTGGGGG - Intronic
919586436 1:199446475-199446497 TGCAAGCCAGAAGAGATTGGGGG - Intergenic
920428871 1:205901239-205901261 TTCAAGCCAGAAGACAGTGGGGG + Intergenic
920787249 1:209053163-209053185 TACAAGCCAGAAGAGATTGGAGG + Intergenic
921462266 1:215443553-215443575 TATAAGCCAGAAGAGATTGGGGG - Intergenic
921760073 1:218903058-218903080 TACAAGCCAGAAGAGATTGGGGG - Intergenic
921762735 1:218935946-218935968 TACAAGCTAGAAGAGATTGGGGG - Intergenic
921767415 1:218988985-218989007 TACAAGCCAGAAGAGATTGGGGG - Intergenic
921915846 1:220609876-220609898 TACAAGCTAGAAGAAAGTGGGGG - Intronic
921918888 1:220643739-220643761 TGCAAGCCAAAAGAGATTGGGGG + Intronic
922172731 1:223169293-223169315 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
922387846 1:225106208-225106230 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
922389704 1:225128035-225128057 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
922390442 1:225136479-225136501 TGAAAGCCAGAAGAGATTGGGGG - Intronic
922399433 1:225237435-225237457 TATAAGCCAGAAGACATTGGGGG - Intronic
922610850 1:226926360-226926382 TATAAGCCAGAAGAGAGTGGGGG - Intronic
923855486 1:237840695-237840717 TATAAGCCAGAAGAGACTGGGGG + Intergenic
924296221 1:242588765-242588787 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
924331898 1:242947982-242948004 TGTAAGCCAGAAAAGATTGAGGG + Intergenic
924411366 1:243808846-243808868 TGTAAGCCAGAAGAGTGTGGGGG + Intronic
924731542 1:246715999-246716021 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
924920008 1:248619143-248619165 TGAATGTTAGAAGACAATGGAGG + Intergenic
1063842855 10:10091489-10091511 TGTGATTAAGAAGACATTGGGGG - Intergenic
1064157231 10:12913258-12913280 TGAAAACTATAAGACATTGATGG - Intronic
1064223728 10:13463752-13463774 GGTAAGATAAAAGACATTGTAGG + Intronic
1064777646 10:18796622-18796644 TATGAGCCAGAAGAGATTGGGGG + Intergenic
1065049847 10:21780410-21780432 TACAAGCCAGAAGACAGTGGGGG + Intronic
1065107687 10:22407464-22407486 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1065237051 10:23662899-23662921 TGTAAGTGAGAAAACATTGGTGG - Intergenic
1065621796 10:27589127-27589149 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1066001710 10:31110709-31110731 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1066060295 10:31718003-31718025 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1066140288 10:32498709-32498731 TGCAAGCCAGAAGAGATTGGGGG - Intronic
1066146185 10:32560487-32560509 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1066163160 10:32756422-32756444 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1066173078 10:32872865-32872887 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1066274118 10:33852077-33852099 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1066615286 10:37287601-37287623 TAAAAGCCAGAAGACAGTGGGGG - Intronic
1066651078 10:37655758-37655780 TACAAGCTAGAAGGGATTGGGGG - Intergenic
1066706790 10:38188637-38188659 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1066992595 10:42530534-42530556 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1067127448 10:43531788-43531810 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1067335619 10:45360568-45360590 TGTAAGCCAGAAGAGAGTAGGGG + Intergenic
1067923392 10:50482336-50482358 TACAAGCCAGAAGAGATTGGGGG + Intronic
1068053426 10:51981639-51981661 TACAAGCCAGAAGAGATTGGGGG - Intronic
1068186437 10:53592341-53592363 TGAAAGCCAGAAGAGATTGGGGG - Intergenic
1068218491 10:54012610-54012632 TATAAGCCAGAAGAGATTGGGGG + Intronic
1068239820 10:54290210-54290232 TGCAAGCCAGAACAGATTGGGGG + Intronic
1068314343 10:55321671-55321693 TATAAGCAAGAAGAGATTTGGGG + Intronic
1068325634 10:55482643-55482665 TACAAGCTAGAAGAGATTGGGGG - Intronic
1068380970 10:56253796-56253818 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1068435529 10:56985968-56985990 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1068477793 10:57550606-57550628 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1068624902 10:59232960-59232982 TTTAAGCTAGAAGTAATTTGGGG + Intronic
1068825195 10:61429801-61429823 TGTCATCCAGAATACATTGGTGG - Intronic
1068848676 10:61710654-61710676 AGTAAGTTTGAAGGCATTGGAGG + Intronic
1069166887 10:65171326-65171348 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1069340705 10:67404877-67404899 TGCAAGCCAGAAGAGATTGGGGG + Intronic
1069734384 10:70643802-70643824 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1069805779 10:71123818-71123840 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1070632689 10:78098186-78098208 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1070710679 10:78680821-78680843 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1070870757 10:79749797-79749819 TATAAGCCAAAAGAGATTGGGGG + Intergenic
1070980292 10:80640114-80640136 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1071035281 10:81237631-81237653 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1071077035 10:81767479-81767501 TACAAGCCAGAAGACATTGGGGG - Intergenic
1071092765 10:81938404-81938426 TGAAAGCTATAAGACATTGCTGG - Intronic
1071134377 10:82436862-82436884 TATAAGCCAGAAGAGATTGGGGG - Intronic
1071210979 10:83341699-83341721 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1071637680 10:87272009-87272031 TATAAGCCAAAAGAGATTGGGGG + Intergenic
1071657565 10:87465942-87465964 TATAAGCCAAAAGAGATTGGGGG - Intergenic
1071737737 10:88320108-88320130 TACAAGCAAGAAGAGATTGGGGG + Intronic
1071838748 10:89446422-89446444 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1071999762 10:91183887-91183909 TACAAGCCAGAAGAGATTGGGGG - Intronic
1072360654 10:94655786-94655808 TATAAGCCAGAAGATTTTGGGGG - Intergenic
1072364727 10:94697295-94697317 TACAAGCTAGAAGAGAATGGGGG + Intronic
1072383221 10:94897238-94897260 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1072752808 10:97995454-97995476 TATCACCAAGAAGACATTGGAGG - Intronic
1072834667 10:98697823-98697845 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1072854641 10:98934603-98934625 TGCAAGCCAGAAGAAATTGGGGG - Intronic
1073308541 10:102522893-102522915 CTTGAGCTAGAAGACATTGTGGG + Intronic
1073661285 10:105479332-105479354 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1073716805 10:106116412-106116434 TTTAAGCCAGAAGAGATTGGGGG + Intergenic
1073746041 10:106469005-106469027 TAAAAGCCAGAAGACAGTGGGGG + Intergenic
1073816431 10:107212933-107212955 TACAAGCCAGAAGACGTTGGAGG - Intergenic
1074003537 10:109395277-109395299 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1074015741 10:109531852-109531874 TGCAAGCCAGAAGAAAGTGGGGG + Intergenic
1074042020 10:109799856-109799878 TATAAGCCAGAAGAGAATGGGGG - Intergenic
1074402963 10:113157045-113157067 TGTCAGCTAGAAGAGAATTGAGG + Intronic
1074465005 10:113673215-113673237 TGCAAGCCAGAAGATAGTGGGGG + Intergenic
1074984974 10:118650609-118650631 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1075183978 10:120238630-120238652 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1075205806 10:120446864-120446886 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1075249801 10:120856599-120856621 TGTAAGCTTGAAGATAGTGGAGG - Intronic
1076386361 10:130059199-130059221 TGTAATGTAGATGACCTTGGGGG + Intergenic
1076933138 10:133547191-133547213 TACAAGTTAGAAGAGATTGGGGG + Intronic
1077755960 11:5027461-5027483 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1077834773 11:5916148-5916170 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1077855265 11:6117408-6117430 TATAAGCCAGAAGAGACTGGGGG + Intergenic
1078033876 11:7782146-7782168 TATAAGGCAGAAGAAATTGGGGG + Intergenic
1078111601 11:8398276-8398298 TACAAGCCAGAAGACAGTGGGGG + Intronic
1078295000 11:10058824-10058846 TACAAGCCAGAAGAGATTGGGGG + Intronic
1078304979 11:10174826-10174848 TACAAGCCAGAAGACAGTGGGGG + Intronic
1078381633 11:10847544-10847566 TGAAATTTAGAAGACATTGGAGG - Intronic
1078517422 11:12034870-12034892 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1078732703 11:13990898-13990920 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1078754804 11:14199270-14199292 TGTAACTATGAAGACATTGGAGG - Intronic
1078832996 11:14993965-14993987 TAGAAGCTGGAAGACAGTGGGGG + Intronic
1078864743 11:15287001-15287023 TGTAAGCTTGAAGACAAAGGTGG - Intergenic
1078870555 11:15340255-15340277 TACAAGCAAGAAGAGATTGGGGG - Intergenic
1078977880 11:16498132-16498154 TACAAGCCAGAAGACAGTGGGGG + Intronic
1078993451 11:16671964-16671986 TATGAGCCAGAAGAGATTGGGGG + Intronic
1079258593 11:18854520-18854542 TATAAGCTAGGAGAGATTGGGGG + Intergenic
1079276464 11:19041788-19041810 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1079342382 11:19623091-19623113 TATAAGCTAGAAGAGAGTGGGGG - Intronic
1079482023 11:20891177-20891199 TGTAAGCCAGAAGAGATTGGGGG + Intronic
1079510374 11:21203936-21203958 TACAAGCTAGAAGAGAGTGGGGG - Intronic
1079628990 11:22651245-22651267 TACAAGCCAGAAGACAGTGGGGG - Intronic
1079822243 11:25145743-25145765 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1079970909 11:27033640-27033662 TACAAACCAGAAGACATTGGGGG + Intergenic
1080130706 11:28791637-28791659 TACAAGCCAGAAGATATTGGAGG - Intergenic
1080150777 11:29049960-29049982 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1080214892 11:29828875-29828897 TATAAGCCAGAAGACATTGGGGG + Intergenic
1080965431 11:37209429-37209451 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1081043482 11:38241291-38241313 TACAAGCTAAAAGAGATTGGGGG - Intergenic
1081078742 11:38712093-38712115 GGAAAGCTAAAAGACTTTGGCGG - Intergenic
1081169418 11:39848334-39848356 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1081172762 11:39889055-39889077 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1081177656 11:39948240-39948262 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1081252152 11:40849467-40849489 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1081363478 11:42207148-42207170 TATAAGCCAGAAGACAGTGAAGG + Intergenic
1081500032 11:43657728-43657750 TATAAGCCAGAAGAGACTGGGGG - Intronic
1082136752 11:48557900-48557922 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1082182770 11:49140473-49140495 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1082184333 11:49161950-49161972 TGCAAGCCAGAAGAGATTGGAGG - Intronic
1082208989 11:49474268-49474290 TGTAAACTATAAGACATTGAAGG - Intergenic
1082279588 11:50257484-50257506 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1082613673 11:55333606-55333628 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1082714020 11:56590994-56591016 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1082733317 11:56826539-56826561 TATAAGCCAGAAGAAATTGGGGG + Intergenic
1082746335 11:56967328-56967350 TACAAGCCAGAAGAGATTGGTGG - Intergenic
1082970673 11:59017042-59017064 TACAAGCCAGAAGACAGTGGGGG + Intronic
1083935551 11:65868102-65868124 TGTAGGGTAGGAGAAATTGGGGG - Intronic
1084341037 11:68501368-68501390 TGTAAGCTGGAGGGCAGTGGCGG + Intronic
1084925663 11:72509274-72509296 TACAAGCCAGAAGAGATTGGTGG - Intergenic
1085066502 11:73500187-73500209 TTCAAGCCAGAAGAGATTGGGGG + Intronic
1085068964 11:73524109-73524131 TGGAAGCTAGAAGAAAGTGGAGG - Intronic
1085150391 11:74248097-74248119 TGTTAGCTAGATAACAGTGGAGG + Intronic
1085334970 11:75686459-75686481 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1085812911 11:79701781-79701803 TAAAAGCCAGAAGAGATTGGGGG + Intergenic
1086008373 11:82068024-82068046 TGCAAGCCAGAAGATATTGGGGG - Intergenic
1086024918 11:82279139-82279161 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1086481586 11:87246178-87246200 TACAAGCCAGAAGACAGTGGGGG - Intronic
1086514025 11:87590774-87590796 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1086514031 11:87590813-87590835 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1086522512 11:87686590-87686612 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1086581653 11:88406899-88406921 TGTAGCCTAAAATACATTGGGGG - Intergenic
1086640627 11:89150961-89150983 TGAAAACTATAAGACATTGAAGG + Intergenic
1086682016 11:89683429-89683451 TGCAAGCCAGAAGAGATTAGGGG + Intergenic
1086753066 11:90523713-90523735 TGTAAGATGGAAGCTATTGGAGG - Intergenic
1086785045 11:90958292-90958314 TATAAGTCAGAAGAGATTGGGGG + Intergenic
1086800654 11:91170737-91170759 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1087003269 11:93443369-93443391 TGCAAGCCAGAAGAAAGTGGGGG - Intergenic
1087311314 11:96546829-96546851 TATAAACTAGAAGAGAGTGGGGG + Intergenic
1087363116 11:97185702-97185724 GGTAAGCTGGAAGACACTGGTGG + Intergenic
1087653861 11:100900233-100900255 TACAAGCTAGAAGAGAGTGGGGG - Intronic
1087668779 11:101081576-101081598 TGCAAGCTAGGAGAGATTGGGGG + Intronic
1087718707 11:101637762-101637784 TATAAGCCAGAAGAGATTGGGGG + Intronic
1087753958 11:102035755-102035777 TGCAAGCCAGAAGAGACTGGGGG - Intergenic
1087791881 11:102414513-102414535 TCTAAGCCAGAAGAGATTGGGGG + Intronic
1087887966 11:103502313-103502335 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1088026204 11:105186639-105186661 TATAAGCCAGAAGAAATTGGGGG + Intergenic
1088084263 11:105958936-105958958 TACAAGCTAGAATAGATTGGGGG - Intronic
1088155354 11:106796601-106796623 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1088309269 11:108442640-108442662 TACAAGCCAGAAGACAGTGGGGG + Intronic
1088309681 11:108446447-108446469 TACAAGCCAGAAGACAGTGGGGG + Intronic
1088342680 11:108787168-108787190 TACAAGCCAGAAGAGATTGGAGG - Intronic
1088507945 11:110544099-110544121 CATAAGCTAGAAAAGATTGGGGG + Intergenic
1088691175 11:112329930-112329952 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1089285278 11:117403480-117403502 TACAAGCTAGAAGAGAGTGGGGG - Intronic
1089313028 11:117572577-117572599 TGTAAGCTAGAACCCATGGTGGG + Intronic
1089391814 11:118107419-118107441 TGTGAACCAGAAGACATTGCTGG + Intronic
1089886118 11:121825393-121825415 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1090217452 11:124982613-124982635 TAAAAGCTGGAAGAGATTGGGGG - Intronic
1090321361 11:125846291-125846313 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1090574304 11:128084692-128084714 TACAAGCCAGAAGACATTGGGGG - Intergenic
1090690491 11:129175607-129175629 TACAAGCTGGAAGACAGTGGGGG + Intronic
1090720600 11:129468854-129468876 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1091850565 12:3693634-3693656 TACAAGCCAGAAGAGATTGGGGG - Intronic
1091978579 12:4847177-4847199 TAGAAACTAGAAGACAATGGGGG - Intronic
1092031383 12:5289269-5289291 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1092275031 12:7054140-7054162 TACAAGCCAGAAGAGATTGGAGG - Intronic
1092298532 12:7222651-7222673 TTTAAGCCAGAAGACAGAGGAGG - Intergenic
1092325366 12:7526182-7526204 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1092439009 12:8481324-8481346 AATAAGCTAGAAGAGAGTGGGGG - Intergenic
1092441253 12:8506999-8507021 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1092512571 12:9172157-9172179 TGGAAGCCAGAAGAAATTGGGGG + Intronic
1092516972 12:9225025-9225047 TAAAAGCCAGAAGACAGTGGGGG - Intergenic
1092562501 12:9631592-9631614 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1092637550 12:10467910-10467932 TAGAAGCCAGAAGATATTGGGGG - Intergenic
1092639984 12:10495047-10495069 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1092703448 12:11258165-11258187 TGTAAGCCAGAAGAGAGTGGGGG + Intergenic
1093150541 12:15616147-15616169 TCCAAGCTAGGAGAGATTGGAGG - Intergenic
1093265638 12:17000118-17000140 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1093309633 12:17563421-17563443 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1093477460 12:19572081-19572103 TACAAGCCAGAAGAGATTGGGGG - Intronic
1093490897 12:19702595-19702617 TACAAGCCAGAAGAGATTGGTGG + Intronic
1093579532 12:20770758-20770780 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1093597532 12:20980066-20980088 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1093615080 12:21213391-21213413 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1093616833 12:21235871-21235893 TACAAGCTAGAAGAGACTGGGGG - Intronic
1094092991 12:26671364-26671386 TACAAGCCAGAAGACAGTGGGGG + Intronic
1094289811 12:28834423-28834445 TGCAAGCCAGAAGAGATTAGGGG + Intergenic
1094431866 12:30378899-30378921 TACAAGCCAGAAGACATTGGGGG - Intergenic
1094451821 12:30590162-30590184 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1094694792 12:32807854-32807876 TACAAGCCAGAAGAGATTGGGGG - Intronic
1094776200 12:33730925-33730947 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1094788484 12:33880560-33880582 TGCAAGCCAGAAGAGATTGGGGG - Intergenic
1094792657 12:33932235-33932257 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1094802288 12:34050183-34050205 TACAAGCTAGAAGGAATTGGGGG + Intergenic
1095103938 12:38209021-38209043 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1095105519 12:38229172-38229194 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1095151193 12:38798364-38798386 TACAAGCCAGAAGACAGTGGGGG + Intronic
1095259360 12:40081027-40081049 TACAAGCCAGAAGAGATTGGGGG - Intronic
1095259676 12:40083626-40083648 TGTGAGCCAGAAGATATGGGAGG - Intronic
1095306152 12:40641514-40641536 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1095534521 12:43229402-43229424 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1095595499 12:43952959-43952981 TGCAAGCCAGAAGAGACTGGGGG + Intronic
1095626013 12:44316406-44316428 TACAAGCCAGAAGAGATTGGGGG - Intronic
1095836074 12:46639854-46639876 TATAAGCCAGAAGAGATTGAGGG + Intergenic
1095913774 12:47456127-47456149 TACAAGCTAGAAGAGAGTGGAGG - Intergenic
1096891792 12:54778548-54778570 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1096894851 12:54811278-54811300 TATAAGCTAGAAGAGAGTAGGGG - Intergenic
1096942034 12:55357046-55357068 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1097304443 12:58053614-58053636 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1097598350 12:61662636-61662658 TACAAGCCAGAAGAGATTGGAGG - Intergenic
1097749150 12:63332393-63332415 TATAAGCCAGAAGAGATTTGGGG + Intergenic
1097890720 12:64774607-64774629 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1098015367 12:66099058-66099080 TATAAGCCAGAAGATAGTGGGGG - Intergenic
1098054267 12:66487294-66487316 TACAAGCCAGAAGAGATTGGGGG + Intronic
1098062754 12:66580072-66580094 TACAAGCCAGAAGACAGTGGGGG + Intronic
1098145336 12:67491476-67491498 TCCAAGCCAGAAGAGATTGGGGG + Intergenic
1098294790 12:68992841-68992863 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1098641330 12:72841097-72841119 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1098667803 12:73185971-73185993 TGCAAGCCAGAACAGATTGGGGG - Intergenic
1098687631 12:73444590-73444612 TATAAGTCAGAATACATTGGAGG + Intergenic
1098698975 12:73598376-73598398 TGTAAGAAATAAGAGATTGGGGG + Intergenic
1098723000 12:73925944-73925966 TGCAAGCTAGAAGAGAGTGGGGG + Intergenic
1099008495 12:77263323-77263345 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1099025643 12:77461075-77461097 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1099031028 12:77525579-77525601 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1099041156 12:77655772-77655794 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1099086814 12:78256481-78256503 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1099253535 12:80288224-80288246 TATAAGCCAGAAGACAGTGGGGG - Intronic
1099428110 12:82549510-82549532 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1099431095 12:82586963-82586985 TACAAGCTAGAAGAAAGTGGGGG + Intergenic
1099635377 12:85205425-85205447 TACAAGCCAGAAGACAATGGGGG - Intronic
1099667567 12:85652044-85652066 TGCAAGCCAGAAGAGATTGAGGG - Intergenic
1099684121 12:85864523-85864545 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1099697714 12:86042905-86042927 TATAAGCCAGAAAATATTGGGGG - Intronic
1099744782 12:86688671-86688693 TGCAAGCTAGAAGAGAGTGGGGG - Intronic
1099759129 12:86895044-86895066 TGTAAGCCAGAAGAGACTGGGGG + Intergenic
1100087975 12:90935240-90935262 TACAAGCTAGAAGAGATTCGGGG - Intronic
1100135412 12:91546884-91546906 TATAAGTCAGAAGAGATTGGGGG + Intergenic
1100564002 12:95776976-95776998 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1100996086 12:100302582-100302604 TACAAGCCAGAAGACAGTGGGGG - Intronic
1101077705 12:101147715-101147737 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1101175076 12:102141812-102141834 TACAAGCCAGAAGACAGTGGGGG - Intronic
1101361994 12:104035984-104036006 TACAAGCTAGAAGAGAGTGGGGG + Intronic
1101524697 12:105518190-105518212 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1101601052 12:106210800-106210822 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1102323632 12:111959163-111959185 TACAAGCTAGAAGAGAGTGGAGG + Intronic
1102345371 12:112157531-112157553 TACAAGCCAGAAGACAGTGGAGG - Intergenic
1102793989 12:115672792-115672814 GGAAAGCTAGAAGCCATCGGAGG + Intergenic
1103149479 12:118624410-118624432 TGTAAGGTAACATACATTGGGGG + Intergenic
1103254108 12:119525462-119525484 TGTAAGCCAGAAGAGACTGGGGG + Intronic
1104156148 12:126134891-126134913 TAAAAGCTAGAAGAGATTGGGGG - Intergenic
1104256199 12:127141624-127141646 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1104403356 12:128496159-128496181 TACAAGCCAGAAGAGATTGGGGG - Intronic
1104504332 12:129317468-129317490 TATAAGCTAGAAGGGATTGGGGG - Intronic
1104556282 12:129802353-129802375 TACAAGCCAGAAGACAGTGGGGG + Intronic
1105396525 13:20041882-20041904 TATAAGCCAGAAGAGATTGGGGG - Intronic
1105504096 13:20995345-20995367 GGTAAGCTGGAAGAGACTGGAGG - Intronic
1106363779 13:29058112-29058134 TATAAGCCAGAAGAGACTGGGGG - Intronic
1106425685 13:29626583-29626605 TAGAAGCCAGAAGAGATTGGAGG + Intergenic
1106617421 13:31342236-31342258 TTCAAGCTAGAAGAGAGTGGGGG + Intergenic
1106651046 13:31690163-31690185 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1107154803 13:37154284-37154306 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1107175852 13:37396819-37396841 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1107245444 13:38288504-38288526 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1107325628 13:39239349-39239371 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1107718848 13:43227264-43227286 TGAAAGGTAGTAGACAGTGGAGG - Intronic
1107764108 13:43715237-43715259 TACAAGCCAGAAGACAGTGGGGG - Intronic
1107973570 13:45668391-45668413 TACAAGCCAGAAGACAATGGGGG - Intergenic
1108048620 13:46407389-46407411 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1108144860 13:47465406-47465428 TTCAAGCCAGAAGAGATTGGGGG + Intergenic
1108160599 13:47634139-47634161 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1108561908 13:51652731-51652753 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1108940753 13:55949457-55949479 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1109018310 13:57049751-57049773 TATAGGCCAGAAGAGATTGGGGG + Intergenic
1109090170 13:58032325-58032347 TGTAATCTAGAAAACCTTGGTGG + Intergenic
1109137865 13:58676949-58676971 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1109541152 13:63780734-63780756 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1109754438 13:66739156-66739178 TACAAGCTAGAAGAGAGTGGGGG + Intronic
1109964053 13:69668548-69668570 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1110402532 13:75110304-75110326 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1110652681 13:77960352-77960374 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1110747787 13:79076132-79076154 TGAAAGCTATAAAACATTAGTGG + Intergenic
1110790299 13:79580508-79580530 TATAAGTCAGAAGATATTGGGGG - Intergenic
1110825950 13:79972447-79972469 TACAAGCCAGAAGAGATTGGAGG - Intergenic
1111045363 13:82806881-82806903 TATAAGCCAGAAGAGAGTGGAGG + Intergenic
1111101769 13:83597629-83597651 TATAAGCTAGAAAATATTGAGGG - Intergenic
1111206025 13:85012380-85012402 TAGAAGCTAGAAGAATTTGGAGG + Intergenic
1111235119 13:85399832-85399854 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1111348553 13:86995732-86995754 TTCAAGCCAGAAGAGATTGGGGG + Intergenic
1111456144 13:88486832-88486854 TTTGAGTTAGAAGAAATTGGAGG - Intergenic
1111544833 13:89718918-89718940 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1111932799 13:94528455-94528477 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1113005852 13:105701258-105701280 TGGATGTTAGAAGACAATGGAGG - Intergenic
1113227089 13:108170585-108170607 TATAAGCCAAAAGAAATTGGGGG + Intergenic
1113348612 13:109506606-109506628 TGCAAGCTAGAAGAGAGTGGGGG - Intergenic
1113488271 13:110671379-110671401 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1113738497 13:112694762-112694784 TCTAAGATAGAAAACATTGAAGG + Intronic
1114034337 14:18608333-18608355 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1114079142 14:19187511-19187533 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1114124305 14:19706676-19706698 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1114132329 14:19805890-19805912 TATAAGCCAGAAAAAATTGGGGG + Intronic
1114146849 14:19987213-19987235 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1114573043 14:23688647-23688669 TACAAGCCAGAAGACAGTGGAGG - Intergenic
1114691406 14:24586015-24586037 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1114747815 14:25168879-25168901 TGCAAGCTAGAAGAGAGTGGGGG + Intergenic
1114749331 14:25185215-25185237 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1114817856 14:25980983-25981005 TATAAGCCAGAAGAGATTGTGGG + Intergenic
1114950842 14:27751669-27751691 TGAAAGCAAGTAGACAGTGGGGG + Intergenic
1114951708 14:27762238-27762260 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1114958372 14:27850748-27850770 TATAAGCCAGAAGAAATTGGTGG + Intergenic
1115339272 14:32274516-32274538 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1115357366 14:32462395-32462417 TGTGAGCCAGAAGAGAGTGGGGG + Intronic
1115868107 14:37771130-37771152 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1115868712 14:37776921-37776943 TAGAAGCCAGAAGAGATTGGGGG - Intronic
1115911493 14:38261095-38261117 TATAAGCAAGAAGAGATTGGGGG + Intergenic
1116002318 14:39257910-39257932 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1116113019 14:40610998-40611020 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1116119776 14:40707427-40707449 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1116162730 14:41290173-41290195 TACAAGCCAGAAGAGATTGGAGG + Intergenic
1116312134 14:43340970-43340992 TGCAAGCCAGAAGAGTTTGGGGG - Intergenic
1116344523 14:43774366-43774388 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1116428824 14:44821928-44821950 TGCCAGCCAGAAGAGATTGGGGG + Intergenic
1116472622 14:45303933-45303955 TACAAGCCAGAAGACATTGAGGG - Intergenic
1116708982 14:48340544-48340566 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1116765347 14:49063581-49063603 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1116771268 14:49130097-49130119 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1117104470 14:52383966-52383988 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1117121269 14:52570160-52570182 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1117172593 14:53115542-53115564 TACAAGCCAGAAGACAGTGGGGG + Intronic
1117829439 14:59735052-59735074 TATAAGCTAGAAGAGACTGGGGG + Intronic
1117837603 14:59823597-59823619 TGTAAGCCGGAAGAGATGGGGGG - Intronic
1117900462 14:60527578-60527600 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1117936432 14:60912648-60912670 TACAAGCCAGAAGACAGTGGGGG - Intronic
1117945318 14:61013711-61013733 CACAAGCCAGAAGACATTGGGGG - Intronic
1118066983 14:62203432-62203454 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1118104130 14:62638357-62638379 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1118446771 14:65859187-65859209 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1118465853 14:66030779-66030801 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1118515900 14:66528790-66528812 TACAAGCCAGAAGACAGTGGGGG - Intronic
1118530874 14:66703459-66703481 TACAAGCCAGAAGAGATTGGGGG + Intronic
1118558433 14:67051775-67051797 TACAAGCCAGAAGAGATTGGGGG + Intronic
1118646448 14:67845745-67845767 TGCAAGCTGGAAGAGATTGGAGG - Intronic
1118700963 14:68433074-68433096 TACAAGCTAGAAGAGAGTGGGGG - Intronic
1118938336 14:70309369-70309391 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1119088446 14:71758654-71758676 TGCAAGCCAGAAGTCAATGGTGG - Intergenic
1119154834 14:72400202-72400224 TCTAAGCCAGAAGAGAGTGGGGG + Intronic
1120058650 14:79955369-79955391 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1120161485 14:81150076-81150098 AGTAAGCTGGATGAAATTGGAGG - Intergenic
1120279229 14:82418548-82418570 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1120283264 14:82465287-82465309 TACAAGCAAGAAGAGATTGGAGG + Intergenic
1120292389 14:82591529-82591551 TGTGAACTAACAGACATTGGAGG + Intergenic
1120475463 14:84981330-84981352 TGTCACCTAGAAGAGATTGAAGG - Intergenic
1120586140 14:86314027-86314049 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1120619736 14:86749311-86749333 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1120723651 14:87914908-87914930 TACAAGCTGGAAGAGATTGGGGG - Intronic
1121142601 14:91556449-91556471 TATAAGCCAGAAGAAATTGGGGG + Intergenic
1121213837 14:92231758-92231780 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1121403144 14:93700109-93700131 TATAAGCAAAAAGACAATGGAGG - Intronic
1121899176 14:97676379-97676401 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1122443176 14:101748528-101748550 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1123116179 14:105895092-105895114 TCTAAGATAGAAGACATTCCCGG - Intergenic
1123454064 15:20400842-20400864 TATAAACTAGAAGAGATAGGGGG + Intergenic
1123501586 15:20888874-20888896 TGAAAGCTCCATGACATTGGTGG + Intergenic
1123506645 15:20947729-20947751 TCCAAGCCAGAAGAGATTGGGGG - Intergenic
1123558839 15:21462573-21462595 TGAAAGCTCCATGACATTGGTGG + Intergenic
1123563870 15:21521474-21521496 TCCAAGCCAGAAGAGATTGGGGG - Intergenic
1123595068 15:21899854-21899876 TGAAAGCTCCATGACATTGGTGG + Intergenic
1123600124 15:21958758-21958780 TCCAAGCCAGAAGAGATTGGGGG - Intergenic
1124569825 15:30852932-30852954 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1125001188 15:34771737-34771759 TGGAAGTTAGAAGACAGTGGAGG - Intergenic
1125077771 15:35639449-35639471 AGAAAGCTAGAAGAGATTGGGGG + Intergenic
1125216460 15:37281489-37281511 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1125219709 15:37318911-37318933 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1125220030 15:37321759-37321781 TACAAGCCAGAAGACAGTGGAGG + Intergenic
1125257232 15:37778906-37778928 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1126211603 15:46106330-46106352 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1126213744 15:46130933-46130955 TGCATGCTAGAAGAGATTGGGGG - Intergenic
1126287429 15:47029030-47029052 TCCAAGCCAGAAGAAATTGGGGG + Intergenic
1126473324 15:49039888-49039910 TCTGAGCTAGTAGACATTCGGGG + Intronic
1126500864 15:49342851-49342873 TATAAGCCAGGAGAGATTGGGGG - Intronic
1126505969 15:49405077-49405099 TACAAGCCAGAAGAGATTGGGGG - Intronic
1126519904 15:49581292-49581314 TACAAGCCAGAAGAGATTGGGGG + Intronic
1126552804 15:49952019-49952041 TACAAGCCAGAAGAGATTGGGGG - Intronic
1126720267 15:51570608-51570630 TATAAGCCAGAAGACAGTGGGGG + Intronic
1126854619 15:52825785-52825807 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1126927068 15:53601174-53601196 TGCATGCCAGAAGAGATTGGGGG + Intronic
1127138170 15:55945825-55945847 TACAAGCCAGAAGACAGTGGGGG + Intronic
1127373920 15:58364717-58364739 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1127491591 15:59470034-59470056 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1127527233 15:59805149-59805171 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1127687502 15:61363435-61363457 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1127707551 15:61562214-61562236 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1127732609 15:61814483-61814505 TGGAAGCAAGAAGACTTGGGAGG + Intergenic
1128850728 15:70953455-70953477 TATAAGCCAGAAGAGATTTGGGG - Intronic
1128856885 15:71025362-71025384 TACAAGCCAGAAGAGATTGGAGG + Intronic
1128857312 15:71030342-71030364 TGAAAGCCAGAAGAGAGTGGTGG - Intronic
1129574290 15:76724252-76724274 TATAAGCCAGAAGAGAATGGGGG - Intronic
1130174859 15:81557997-81558019 TGCAAGCCAAAAGAGATTGGGGG - Intergenic
1130185686 15:81679038-81679060 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1130734094 15:86529773-86529795 TGCAAGCCAGAAGAGACTGGGGG + Intronic
1130779367 15:87018429-87018451 TACAAGCCAGAAGATATTGGGGG + Intronic
1131589985 15:93738725-93738747 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1131627050 15:94132533-94132555 TACAAGCTAGAAGAGATTAGGGG - Intergenic
1131711096 15:95057657-95057679 TGCAAGCCAGAAGGGATTGGGGG - Intergenic
1131942571 15:97583773-97583795 TGAAAGCCAGAAGACAGTAGGGG - Intergenic
1132417061 15:101628127-101628149 TACAAGCTAGAAGAGAGTGGGGG + Intronic
1202967187 15_KI270727v1_random:189732-189754 TGAAAGCTCCATGACATTGGTGG + Intergenic
1202972230 15_KI270727v1_random:248569-248591 TCCAAGCCAGAAGAGATTGGGGG - Intergenic
1134096458 16:11422049-11422071 TGCAAACTCGAAGACTTTGGGGG - Intronic
1134312732 16:13091125-13091147 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1134898138 16:17908215-17908237 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1135301598 16:21333338-21333360 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1136643322 16:31587371-31587393 TGCAAGCCATAAGAGATTGGGGG - Intergenic
1136645513 16:31610432-31610454 TATAAGACAGAAGAGATTGGGGG + Intergenic
1136659671 16:31746441-31746463 TGTAAGTCAGAAGAGACTGGGGG - Intronic
1137890786 16:52160123-52160145 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1138258545 16:55594508-55594530 TATAAGCCAAAAGACATTGTGGG + Intergenic
1138260549 16:55617244-55617266 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1138324894 16:56156314-56156336 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1138887115 16:61092580-61092602 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1138972865 16:62167894-62167916 TACAAGCTAGAAGAGATGGGGGG - Intergenic
1138996742 16:62463654-62463676 TATAAGCCAGGAGAGATTGGGGG + Intergenic
1139025908 16:62817353-62817375 TGTAAGCTAAATGAGATTGATGG - Intergenic
1140018047 16:71207242-71207264 TATAAGCCAGAAGAGATTGGGGG + Intronic
1140147591 16:72326198-72326220 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1140148070 16:72331834-72331856 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1140182513 16:72734903-72734925 TGTAAGCTAGAAGAGAGCGGGGG - Intergenic
1140547560 16:75826288-75826310 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1140669890 16:77268057-77268079 TTCAAGCCAGAAGAGATTGGGGG - Intronic
1140695316 16:77526775-77526797 TGCAAGCCAGAAGACAGTGGGGG + Intergenic
1140865528 16:79057730-79057752 GGCAAGGTAGAAGACATAGGTGG + Intronic
1141879212 16:86846714-86846736 TGGAAGCCAGCAGACATGGGGGG + Intergenic
1141899801 16:86983768-86983790 TGGAGGCTGGAAGAGATTGGAGG + Intergenic
1142538527 17:638742-638764 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1142917205 17:3151702-3151724 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1142920249 17:3178210-3178232 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1143256831 17:5563958-5563980 TGCAAGGCAGAAGAGATTGGGGG + Intronic
1143356009 17:6329129-6329151 TGTGAGATAGCAGACTTTGGTGG - Intergenic
1144137596 17:12313304-12313326 TACAAGCGAGAAGAGATTGGGGG - Intergenic
1145738507 17:27251013-27251035 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1146024476 17:29307782-29307804 TTCAAGATAGAAGACATTGTTGG - Intergenic
1146521919 17:33532039-33532061 TGGAAGCAAGAAGAAAGTGGAGG - Intronic
1149153942 17:53603807-53603829 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1149229519 17:54517483-54517505 TATAAGCCAAAAGAGATTGGGGG - Intergenic
1149377757 17:56063052-56063074 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1150196311 17:63303421-63303443 TACAAGCCAGAAGACAGTGGGGG - Intronic
1150527941 17:65943535-65943557 TACAAGCCAGAAGAGATTGGCGG - Intronic
1150940394 17:69686979-69687001 TATAAGCCAGAAGAAATTGAGGG - Intergenic
1150970990 17:70028291-70028313 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1152574907 17:81135713-81135735 CGTGAGCTAGAAGACAGTGAGGG + Intronic
1153119265 18:1701462-1701484 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1153125595 18:1786326-1786348 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1153313228 18:3698512-3698534 TACAAGCCAGAAGACAGTGGAGG - Intronic
1153384421 18:4476475-4476497 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1153420011 18:4894384-4894406 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1153461955 18:5345273-5345295 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1153582138 18:6584014-6584036 TACAAGCCAGAAGAGATTGGGGG + Intronic
1154101351 18:11477762-11477784 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1154182739 18:12150617-12150639 TGCAAGCCAGAAGAGATTGGGGG + Intergenic
1154186006 18:12183442-12183464 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1154463972 18:14624769-14624791 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1154517426 18:15188152-15188174 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1155117310 18:22782565-22782587 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1155476715 18:26242910-26242932 TACAAGCCAGAAGACAGTGGGGG - Intronic
1155763090 18:29590328-29590350 TGTAAGACAGAAGAAAGTGGGGG + Intergenic
1156084782 18:33384528-33384550 TAAAAGCCAGAAGAGATTGGGGG + Intronic
1156709531 18:39926065-39926087 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1156739188 18:40303363-40303385 TGCAAGCTAGAAGAGTTTGGAGG - Intergenic
1156778650 18:40823465-40823487 TGCAAGCCAGAAGACATTGGGGG + Intergenic
1156896660 18:42254600-42254622 TATAAGCCAGAAGAGATTGAGGG - Intergenic
1157016490 18:43720894-43720916 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1157036922 18:43985843-43985865 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1157061939 18:44301667-44301689 TACAAGCTAGAAGAGAGTGGAGG + Intergenic
1157073371 18:44436476-44436498 TGCAAGCAAGAAGAGATTGGAGG - Intergenic
1157311541 18:46556913-46556935 GGTGAGCTGGATGACATTGGAGG - Intronic
1158526368 18:58218336-58218358 TGTAAGCAATAAGCCATTGTTGG - Intronic
1158822349 18:61175728-61175750 TAGAAGCCAGAAGAGATTGGGGG + Intergenic
1159155804 18:64579950-64579972 TATAAGGCAGAAGAGATTGGGGG + Intergenic
1159364615 18:67449944-67449966 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1159569437 18:70095618-70095640 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1159570212 18:70103814-70103836 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1159661047 18:71096455-71096477 TATAAGCCAGAAGAAAGTGGGGG - Intergenic
1160972096 19:1774083-1774105 TCTAAGAAAGAAGACTTTGGAGG - Intronic
1161190120 19:2949969-2949991 AGCGAGCTAGAAGACATTGATGG - Intergenic
1162245821 19:9399464-9399486 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1163265066 19:16215509-16215531 TACAAGCCAGAAGAGATTGGAGG - Intronic
1163914432 19:20227818-20227840 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1163940900 19:20492259-20492281 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1163972249 19:20809495-20809517 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1164067718 19:21734873-21734895 TACAAGCCAGAAGACATTGGGGG + Intronic
1164110287 19:22150186-22150208 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1164152197 19:22564680-22564702 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1164482223 19:28620800-28620822 TGGAAGCTAGAAGACAGTGTTGG - Intergenic
1164496798 19:28772853-28772875 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1164542912 19:29134399-29134421 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1165003582 19:32786253-32786275 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1165563443 19:36702251-36702273 TACAAGCCAGAAGACAGTGGGGG - Intronic
1165973228 19:39651002-39651024 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1166240449 19:41488173-41488195 TAGAAGCCAGAAGACAGTGGGGG + Intergenic
1166588364 19:43971081-43971103 TACAAGCCAGAAGATATTGGGGG + Intronic
1166899300 19:46046080-46046102 TACAAGCCAGAAGAGATTGGGGG + Intronic
1167950245 19:53020705-53020727 TACAAGCTAGAAGAGATTGAGGG + Intergenic
1168530654 19:57126084-57126106 TACAAGCCAGAAGACAGTGGGGG - Intronic
925442133 2:3897776-3897798 TACAAGCCAGAAGAGATTGGGGG - Intergenic
928356014 2:30615230-30615252 GGTGAGATAGAAGACATAGGTGG + Intronic
928609144 2:32975202-32975224 TCTAAGCCAGAAGAGACTGGGGG - Intronic
928706638 2:33956610-33956632 TGGAAGCTAGAAGACAACAGAGG - Intergenic
928795527 2:35014248-35014270 TACAAGCCAGAAGACAGTGGGGG + Intergenic
928952936 2:36830791-36830813 TGCAAACCAGAAGACAGTGGAGG - Intergenic
929333333 2:40711253-40711275 TACAAGCTAGAAGACAGTGTGGG - Intergenic
929382255 2:41366823-41366845 TACAAGCCAGAAGAGATTGGAGG + Intergenic
929401234 2:41583794-41583816 TACAAGCCAGAAGAGATTGGGGG + Intergenic
929638154 2:43547198-43547220 TATAAGCCAGAAGAGAGTGGGGG - Intronic
930223154 2:48766211-48766233 TACAAGCCAGAAGACAGTGGGGG - Intronic
930290041 2:49482140-49482162 TACAAGCCAGAAGACAGTGGGGG + Intergenic
930476923 2:51893133-51893155 TATAAACTAGAAGAGAGTGGGGG + Intergenic
930839405 2:55828363-55828385 TATAAGCCAGAAGAGATTGTGGG + Intergenic
930908741 2:56605155-56605177 TACAAGCAAGAAGACAGTGGGGG - Intergenic
931004291 2:57829774-57829796 TACAAGCCAGAAGACAGTGGGGG + Intergenic
931211904 2:60205650-60205672 TATAAGCCAGAAGAGATTGGGGG - Intergenic
931556178 2:63508250-63508272 TACAAGCCAGAAGAGATTGGGGG + Intronic
931560632 2:63556833-63556855 TACAAGCCAGAAGAGATTGGGGG + Intronic
931857126 2:66314562-66314584 TACAAGCCAGAAGAGATTGGGGG + Intergenic
931887291 2:66631412-66631434 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
931907408 2:66857591-66857613 TACAAGCTGGAAGACAGTGGGGG - Intergenic
931921360 2:67019640-67019662 TGCAAGCCAGAAGAAATTGGGGG + Intergenic
932051382 2:68402059-68402081 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
932052009 2:68407013-68407035 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
932371912 2:71197340-71197362 TATAAGCCAGAAGAGACTGGGGG - Intronic
932379830 2:71271752-71271774 TACAAGCCAGAAGAGATTGGGGG + Intergenic
932512101 2:72303144-72303166 TATAAGCCAGAAGAGATTGGAGG - Intronic
932540308 2:72644603-72644625 TATAAGCCAGAAGAGAGTGGGGG + Intronic
932542113 2:72665515-72665537 TATAAGCCAAAAGAGATTGGAGG + Intronic
932642427 2:73462271-73462293 TATAAGCCAGAAGAGAGTGGGGG + Intronic
932644139 2:73484400-73484422 TATAAGCCAGAAGAGAGTGGGGG - Intronic
932938767 2:76138032-76138054 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
932990446 2:76780088-76780110 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
933145026 2:78841513-78841535 AGTAAGGTAAAAGCCATTGGAGG + Intergenic
933166448 2:79082079-79082101 TGTGAGCCAGAAGACAGTGGGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933477099 2:82804679-82804701 TATAATCCAGAAGAGATTGGGGG + Intergenic
933602341 2:84346375-84346397 TACAAGCCAGAAGAAATTGGGGG - Intergenic
933644740 2:84801543-84801565 TAGAAGCCAGAAGAGATTGGGGG + Intronic
934099939 2:88643052-88643074 TACAAGCCAGAAGAGATTGGAGG + Intergenic
934485650 2:94707455-94707477 TACAAGCCAGAAGAGATTGGGGG - Intergenic
934486509 2:94718001-94718023 TGAAAGCAAGAAGAGAGTGGGGG - Intergenic
934531776 2:95094549-95094571 TATAAGCCAGAAGAGAGTGGGGG + Intronic
934877442 2:97937846-97937868 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
934923434 2:98364937-98364959 TACAAGCCAGAAGAGATTGGAGG - Intronic
934997619 2:98979618-98979640 TACAAGCCAGAAGACAGTGGGGG + Intergenic
935440936 2:103094716-103094738 TGCAAGCTGGAAAACACTGGTGG + Intergenic
935452125 2:103221976-103221998 TGTCAGCCAGAAGACAGAGGTGG - Intergenic
935711271 2:105901433-105901455 TACAAGCTAGAAGAGATTGGGGG - Intergenic
935822800 2:106910989-106911011 TACAAGCCAGAAGACAGTGGGGG + Intergenic
935922755 2:108033187-108033209 AGCAATCAAGAAGACATTGGAGG + Intergenic
935929777 2:108111964-108111986 TATAAGCCAGAAGAGATTGGTGG - Intergenic
936674014 2:114693404-114693426 TATAAGCCAGAAGAGATTGGGGG - Intronic
936727201 2:115333750-115333772 TATAAGCCAGAAGAGAGTGGGGG - Intronic
936775162 2:115964336-115964358 TACAAGCCAGAAGACAGTGGGGG - Intergenic
936795783 2:116202897-116202919 TGCAAGCCAGAGGAGATTGGGGG - Intergenic
936848893 2:116872529-116872551 TACAAGCCAGAAGAGATTGGGGG - Intergenic
936859784 2:117002933-117002955 TATAAGCCAGAAGAGATTGGGGG + Intergenic
936905084 2:117527037-117527059 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
936932639 2:117805461-117805483 TGAAAGCCAGAAGAGAGTGGGGG + Intergenic
936995698 2:118411399-118411421 TACAAGCCAGAAGACAGTGGGGG + Intergenic
937075065 2:119097515-119097537 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
937186604 2:120049990-120050012 TACAAGCCAGAAGACAGTGGGGG - Intronic
937780155 2:125827334-125827356 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
937893767 2:126961949-126961971 TACAAGCCAGAAGAGATTGGGGG - Intergenic
937899684 2:127009683-127009705 TGAAAACTACAAGACATTGCTGG - Intergenic
937931695 2:127210181-127210203 TATACGCCAGAAGAGATTGGGGG + Intronic
938136634 2:128764437-128764459 TACAAGCCAGAAGAGATTGGGGG - Intergenic
938848269 2:135233608-135233630 TACAAGCCAGAAGACAGTGGGGG + Intronic
938990331 2:136621777-136621799 TATAAGCCAGAAGAGATTGGAGG - Intergenic
939033464 2:137103202-137103224 TACAAGCTAGAAGAGAGTGGGGG + Intronic
939180579 2:138797756-138797778 TGTAAGTCAGAAGAGAGTGGGGG + Intergenic
939365135 2:141220729-141220751 TACAAGCTGGAAGAGATTGGGGG + Intronic
939391325 2:141572246-141572268 TACAAGCCAGAAGAGATTGGGGG + Intronic
939653009 2:144787088-144787110 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
939860452 2:147414247-147414269 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
939939496 2:148332619-148332641 TGGAGGCTAAAAGACAATGGAGG - Intronic
940127564 2:150344012-150344034 TGGAAGCTAGGAGACAGTGATGG - Intergenic
940253252 2:151703186-151703208 TACAAGCCAGAAGACAGTGGGGG - Intronic
940302850 2:152193794-152193816 TGCAAGCCAGAAGATAGTGGGGG + Intergenic
940456764 2:153911734-153911756 TACAAGCAAGAAGAGATTGGGGG - Intronic
940615184 2:156040483-156040505 TATAAGCCAGAAGAGATTGAGGG - Intergenic
940629037 2:156214082-156214104 TGTAAGCCAGAAGAGATTGAGGG - Intergenic
940680145 2:156775700-156775722 TATAAGCCAGAAGACAGTGGGGG - Intergenic
940701890 2:157055219-157055241 TGAAAGCTACATGACAATGGTGG - Intergenic
940708087 2:157128481-157128503 TATAAGCCAGAAGAGATTGGAGG + Intergenic
940819148 2:158332333-158332355 TCCAAGCCAGAAGACAGTGGGGG - Intronic
941527691 2:166627052-166627074 TATATGCCAGAAGACACTGGGGG - Intergenic
942410344 2:175703183-175703205 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
942640037 2:178051171-178051193 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
942669062 2:178353908-178353930 TATAAGCCAGAAGACAGTGAAGG + Intronic
942908348 2:181209931-181209953 TATAAGCCAGAAGAGATTGGGGG + Intergenic
943092151 2:183388531-183388553 TACAAGCTAGAAGAGATTGGGGG - Intergenic
943286737 2:186010582-186010604 GATAAGCCAGAAGAGATTGGAGG + Intergenic
943817222 2:192272757-192272779 TACAAGCCAGAAGACAGTGGGGG - Intergenic
944330184 2:198456606-198456628 TGTGAGCAAGAAGACATTCCTGG - Intronic
944471293 2:200055856-200055878 TATAAGCTAGAAGAGATTGGGGG + Intergenic
945909612 2:215633933-215633955 TACAAGCCAGAAGAGATTGGGGG - Intergenic
946077809 2:217089859-217089881 TGTAAGCAAGGAGAGATTAGAGG + Intergenic
946766344 2:223044543-223044565 GGTAGGCTGGAAGTCATTGGTGG + Intergenic
946786042 2:223245879-223245901 TATAAGCTAGAAGAGATCGGGGG - Intergenic
946993828 2:225367761-225367783 TGAAAGATGGAAGACATTTGAGG - Intergenic
947263332 2:228250040-228250062 TATAAGCCAGAAGAGATTGAGGG - Intergenic
947719024 2:232356918-232356940 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
947887096 2:233582166-233582188 TACAAGCCAGAAGACAGTGGGGG - Intergenic
948343276 2:237272677-237272699 TATAAGCCAGAAGAGATTGGTGG + Intergenic
948970666 2:241423278-241423300 TACAAGCCAGAAGAGATTGGGGG + Intronic
1169671170 20:8104578-8104600 TACAAGCCAGGAGACATTGGGGG - Intergenic
1169695577 20:8383847-8383869 TATAAGCCAGAAGAGATTGGGGG - Intronic
1169944800 20:10977392-10977414 TTTAAGCAAGAAGAAATTGATGG + Intergenic
1169980790 20:11381354-11381376 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1170167688 20:13379401-13379423 TATAAGCCAGAAGAGAATGGGGG - Intergenic
1170250180 20:14272309-14272331 TACAAGCCAGAAGACAGTGGAGG + Intronic
1170514884 20:17119112-17119134 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1170707609 20:18759561-18759583 TACAAGCTAGAAGAGAGTGGGGG - Intronic
1170727139 20:18940178-18940200 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1170730178 20:18967249-18967271 TATAAGCCAGAAGACAGTGGGGG + Intergenic
1171068630 20:22044785-22044807 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1171107448 20:22448376-22448398 TGGAAGCAAGAAGACTTAGGGGG + Intergenic
1171287150 20:23950086-23950108 TATAAGCCAGGAGAGATTGGGGG - Intergenic
1171410593 20:24944596-24944618 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1171454788 20:25262292-25262314 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1171776159 20:29370383-29370405 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1172800763 20:37574562-37574584 TTCAAGCCAGCAGACATTGGTGG - Intergenic
1173149575 20:40554572-40554594 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1173294609 20:41745785-41745807 TATAAGCCAGAAGACATTAGGGG - Intergenic
1173750960 20:45476497-45476519 TGCAAACCAGAAGACAGTGGGGG - Intronic
1173776917 20:45716148-45716170 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1174991960 20:55521394-55521416 TATGAGCCAGAAGAGATTGGAGG - Intergenic
1175026085 20:55904571-55904593 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1175824455 20:61929436-61929458 ATTAAGTTAAAAGACATTGGAGG - Intronic
1176295638 21:5070629-5070651 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1176810559 21:13533603-13533625 TATAAGCCAGAAGAGACTGGGGG - Intergenic
1176928623 21:14780714-14780736 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1176942169 21:14938172-14938194 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1176987418 21:15454176-15454198 TGCAAGCCAGAAAAGATTGGGGG - Intergenic
1177270268 21:18839388-18839410 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1177280281 21:18973148-18973170 TGCAAGCCAGAAAAGATTGGGGG + Intergenic
1177388309 21:20434775-20434797 TACAAGCTGGAAGAGATTGGGGG + Intergenic
1177463696 21:21446158-21446180 TACAAGCCAGAAGAGATTGGGGG - Intronic
1177511173 21:22090343-22090365 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1177671508 21:24236459-24236481 AGTAAGCGAGAAGACATTATTGG - Intergenic
1177901974 21:26927655-26927677 AGTAAGATGGAAGCCATTGGAGG + Intronic
1178436674 21:32566035-32566057 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1178987940 21:37324716-37324738 TGAAAGCCAGAAGGAATTGGAGG - Intergenic
1179861411 21:44191495-44191517 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1180375167 22:12085304-12085326 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1180419837 22:12803136-12803158 TGCAAGCAAGAAGAGAGTGGGGG + Intergenic
1180458458 22:15535380-15535402 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1180501997 22:15938295-15938317 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1181342120 22:22189642-22189664 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1182195118 22:28507723-28507745 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1182734701 22:32524068-32524090 TGGAAGCTAGCAGAGGTTGGTGG + Intronic
1182950413 22:34369959-34369981 TGCAAGCCAAAAGAGATTGGGGG - Intergenic
1182989107 22:34749948-34749970 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1182993452 22:34790505-34790527 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1183041889 22:35186406-35186428 TATAAGCCAGAAGAGATTGAGGG + Intergenic
949165821 3:939565-939587 TGTAAGCCAGAAGAGATTGCGGG + Intergenic
949222516 3:1652902-1652924 TACAAGCCAGAAGACAGTGGGGG - Intergenic
949423330 3:3889927-3889949 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
949450198 3:4176353-4176375 TACAAGCTAGAAGAGAGTGGGGG + Intronic
949466104 3:4345349-4345371 TACAAGCCAGAAGACAGTGGGGG + Intronic
949687126 3:6588578-6588600 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
950299709 3:11866307-11866329 TACAAGCCAGAAGACAGTGGGGG - Intergenic
950561789 3:13734725-13734747 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
951469948 3:23045320-23045342 TACAAGCCAGAAGAGATTGGGGG + Intergenic
951628918 3:24697792-24697814 TACAAGCCAGAAGACAGTGGGGG - Intergenic
951684660 3:25330329-25330351 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
952073891 3:29672101-29672123 TATAAGCCAGAAGAGAGTGGGGG + Intronic
952485008 3:33800852-33800874 TTTAAGCTAACAGACATGGGAGG + Intronic
952513836 3:34084038-34084060 TGCAAGCCAGAAGAAAGTGGGGG - Intergenic
952548418 3:34448698-34448720 TACAAGCCAGAAGAGATTGGGGG - Intergenic
952572469 3:34733324-34733346 TACAAGCTAGAAGAGATTGGGGG + Intergenic
952588156 3:34918458-34918480 TAGAAGCTAGAAGACTTTTGAGG + Intergenic
952629978 3:35454574-35454596 AACAAGCTAGAAGAGATTGGAGG + Intergenic
952632073 3:35481693-35481715 TACAAGCCAGAAGACAGTGGAGG - Intergenic
952694778 3:36251775-36251797 TGCAAGCCAGAAGAAATTGAAGG + Intergenic
953053115 3:39363678-39363700 TATATGCCAGAAGACATTGGAGG + Intergenic
953816368 3:46161604-46161626 TGTAAGCCAGAAGAGATTGGAGG - Intergenic
954426810 3:50447685-50447707 TGTATGCTCAAAGACACTGGAGG - Intronic
954497318 3:50977470-50977492 TACAAGCCAGAAGACAGTGGGGG - Intronic
954502129 3:51028249-51028271 TATAAGCCAGAAGAGATTGGGGG - Intronic
954510322 3:51119291-51119313 TATAAGCCAGAAGAGAGTGGGGG - Intronic
954529062 3:51302745-51302767 TATAAGCCAGAAGAGATTGGGGG - Intronic
954828118 3:53392948-53392970 TATAAGCCAGAAGAGAGTGGTGG + Intergenic
954950731 3:54470246-54470268 TATAAGCCAGAAGAGAGTGGGGG + Intronic
955119106 3:56037867-56037889 TACAAGCCAGAAGAGATTGGGGG + Intronic
955168598 3:56540545-56540567 TGGAAGCTAGACTACAGTGGAGG - Intergenic
955172444 3:56580736-56580758 TACAAGCCAGAAGACAGTGGGGG - Intronic
955269119 3:57478739-57478761 TATAAGCCAGAAGAGAGTGGGGG + Intronic
955457611 3:59141147-59141169 AGGAAGCTAGAAGGCACTGGAGG + Intergenic
955865124 3:63373896-63373918 TCTAATCCAGAAGAGATTGGGGG + Intronic
955937470 3:64115015-64115037 TGTAAGCCAGAAAAGAATGGGGG + Intronic
956157714 3:66316441-66316463 TACAAGCCAGAAGACATTAGGGG - Intronic
956260712 3:67337434-67337456 TACAAGCCAGAAGAGATTGGGGG + Intergenic
956317053 3:67949582-67949604 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
956371996 3:68572737-68572759 TGCAAGCCAGAAGAGTTTGGGGG + Intergenic
956862301 3:73337182-73337204 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
957008882 3:74983008-74983030 TACAAGCCAGAAGACAGTGGGGG - Intergenic
957256417 3:77843702-77843724 TACAAGCCAGAAGAGATTGGGGG - Intergenic
957387684 3:79518542-79518564 AGTAAGTTAGAAGACCTAGGAGG + Intronic
957394918 3:79624012-79624034 TACAAGCCAGAAGAAATTGGGGG + Intronic
957475026 3:80711243-80711265 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
957557906 3:81783748-81783770 GGTAAGCTTGAAGATACTGGTGG - Intergenic
957667180 3:83247962-83247984 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
957747493 3:84364598-84364620 TACAAGCCAGAAGACAGTGGGGG - Intergenic
957811431 3:85227962-85227984 TATAAGCCAGAAGAGAATGGGGG - Intronic
957907997 3:86582474-86582496 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
957972500 3:87400918-87400940 TACAAGCCAGAAGACATTGAGGG + Intergenic
958075301 3:88668745-88668767 TGAAAGCCAGAAGACCTTGATGG + Intergenic
958076928 3:88692125-88692147 TATAAGCCAGAAGAGATTGAGGG + Intergenic
958148329 3:89656746-89656768 TACAAGCCAGAAGAGATTGGTGG - Intergenic
958204530 3:90372632-90372654 TACAAGCCAGAAGAGATTGGGGG + Intergenic
958205541 3:90386757-90386779 TACAAGCCAGAAGACAGTGGGGG - Intergenic
958523728 3:95225500-95225522 TATAAGCCAGAAGAGATTGGAGG - Intergenic
958594501 3:96203513-96203535 TGTAAGCCAGAAGAGATTGGGGG + Intergenic
958615768 3:96492214-96492236 TATAAGCCAGAAGAGATTGGAGG - Intergenic
958703009 3:97617097-97617119 TATAAGCCACAAGACATTGGGGG + Intronic
958704994 3:97643106-97643128 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
958769004 3:98403810-98403832 TACAAGCTAGAAGAGATTGGAGG + Intergenic
958838559 3:99174181-99174203 TATAAGCCAGAAGAGATTGGGGG + Intergenic
958861653 3:99451837-99451859 TACAAGCCAGAAGAAATTGGGGG + Intergenic
958978059 3:100689701-100689723 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
958995002 3:100893997-100894019 TGGAAGGTAGAATAGATTGGGGG + Intronic
959045467 3:101468523-101468545 TATAAGCCAGAAGAGAGTGGGGG + Intronic
959047343 3:101488976-101488998 TGCAAACCAGAAGAGATTGGGGG + Intronic
959091623 3:101909775-101909797 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
959205653 3:103303512-103303534 TACAAGCCAGAAGAGATTGGGGG - Intergenic
959452898 3:106524690-106524712 TACAAGCCAGAAGAAATTGGGGG + Intergenic
959724394 3:109527516-109527538 TACAAGCCAGAAGACAGTGGGGG - Intergenic
960233656 3:115256494-115256516 TACAAGCCAGAAGAGATTGGGGG + Intergenic
960339470 3:116456994-116457016 TACAAGCCAGAAGACACTGGGGG + Intronic
960342298 3:116488179-116488201 TACAAGCCAGAAGACACTGGGGG + Intronic
960413918 3:117360549-117360571 TATAAGCCAGAAGAGACTGGGGG + Intergenic
960612407 3:119567497-119567519 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
960685780 3:120292009-120292031 TATAAGCCAGAAGAAATTAGGGG + Intergenic
960753008 3:120977871-120977893 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
960754794 3:120999935-120999957 TGTAAGCTAGAAAAGACTGGGGG - Intronic
960758593 3:121048173-121048195 TACAAGCCAGAAGAAATTGGGGG - Intronic
960763043 3:121095113-121095135 TACAAGCCAGAAGACACTGGGGG - Intronic
960847776 3:122020860-122020882 TGTAAGCCAGAGGGCCTTGGGGG + Intronic
960940908 3:122933394-122933416 TGGAACCTAGAAGACAATGGAGG - Intronic
961984668 3:131120305-131120327 TACAAGCTAGAAGAGAGTGGGGG - Intronic
961988306 3:131160244-131160266 TACAAGCCAGAAGAGATTGGGGG + Intronic
962001532 3:131303676-131303698 TACAAGCCAGAAGACATAGGGGG - Intronic
962073179 3:132053173-132053195 TACAAGCCAGAAGACAGTGGGGG - Intronic
962077615 3:132100483-132100505 TACAAGCCAGAAGACAGTGGGGG + Intronic
962078938 3:132116559-132116581 TATAAGCCAGAAGAGACTGGGGG - Intronic
962291622 3:134141681-134141703 TATAAGCCAGAAGACAGTGGGGG + Intronic
962657136 3:137558607-137558629 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
962666871 3:137662378-137662400 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
962675350 3:137752512-137752534 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
962998916 3:140657755-140657777 TACAAGCCAGAAGAGATTGGGGG + Intergenic
963026621 3:140925578-140925600 TGTTAATTAGGAGACATTGGTGG + Intergenic
963387768 3:144618945-144618967 TACAAGCCAGAAGACAGTGGGGG - Intergenic
963532193 3:146484605-146484627 TATAAGCCAGAAGAGAGTGGTGG + Intronic
963616198 3:147541495-147541517 TATAAGCCAGAAGAGATTGTGGG - Intergenic
963756194 3:149237033-149237055 TACAAGCCAGAAGAGATTGGGGG + Intergenic
964100444 3:152982012-152982034 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
964142914 3:153423649-153423671 TATAAGCCAGAAGAGATTGGGGG + Intergenic
964183536 3:153915056-153915078 TACAAGCCAGAAGAGATTGGAGG + Intergenic
964486306 3:157188216-157188238 TATAAGCCAGAAGAGATTGGGGG + Intergenic
964536393 3:157726373-157726395 TACAAGCCAGAAGACAGTGGGGG + Intergenic
964652208 3:159024911-159024933 TGTAAGCCAGGAGAAAATGGAGG - Intronic
964668688 3:159201981-159202003 TGGAAGACAGAAGACATGGGTGG + Intronic
964831404 3:160887539-160887561 TACAAGCCAGAAGAGATTGGGGG + Intronic
965182040 3:165416236-165416258 TACAAGCCAGAAGAGATTGGGGG + Intergenic
965376998 3:167937141-167937163 AGTAAGGTAGAAGTGATTGGAGG + Intergenic
965646049 3:170882889-170882911 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
965810830 3:172590318-172590340 TACAAGCCAGAAGAGATTGGGGG - Intergenic
965855906 3:173087849-173087871 TACAAGCCAGAAGAGATTGGAGG - Intronic
966152527 3:176879617-176879639 TATAAGCCATAAGAAATTGGGGG + Intergenic
966250316 3:177858767-177858789 TACAAGCCAGAAGAGATTGGGGG - Intergenic
966341348 3:178928231-178928253 TACAAGCCAGAAGAGATTGGGGG + Intergenic
966490150 3:180518286-180518308 TGTAAGCCAGAAGAAATTGGGGG + Intergenic
966533108 3:181002828-181002850 TACAAGCCAGAAGACAGTGGGGG - Intergenic
966652788 3:182320250-182320272 TATAAGCCAGAAGAGATTAGGGG - Intergenic
967502888 3:190220948-190220970 TATAAGCTAGAAGAGATTGAGGG - Intergenic
967784457 3:193475603-193475625 TGTAAGACAGAAGACATTCCAGG - Intronic
968390192 4:186309-186331 TACAAGCCAGAAGAGATTGGGGG - Intergenic
968436967 4:598253-598275 TACAAGCCAGAAGAGATTGGGGG - Intergenic
968696481 4:2032234-2032256 TACAAGCCAGAAGAGATTGGGGG - Intronic
969201159 4:5607425-5607447 TGCAGCCTGGAAGACATTGGAGG - Intronic
969747258 4:9082343-9082365 TACAAGCCAGAAGAGATTGGGGG + Intergenic
969783720 4:9434660-9434682 TATAAGCCAGAAGAGATTGTGGG - Intergenic
969837270 4:9852209-9852231 TATAAGCCAGAAGATACTGGGGG + Intronic
969952432 4:10852436-10852458 TGCAAGCCAGAAGAATTTGGGGG - Intergenic
970207692 4:13671812-13671834 TATAAGCCAGAAGAAATTGGGGG + Intergenic
970299211 4:14664626-14664648 TACAAGCCAGAAGACAGTGGGGG - Intergenic
970311721 4:14789083-14789105 TATAAGCCTGAAGAGATTGGGGG + Intergenic
970412291 4:15820010-15820032 TACAAGCCAGAAGAGATTGGGGG + Intronic
970494491 4:16611030-16611052 TACAAGCCAGAAGAGATTGGAGG + Intronic
970666306 4:18341571-18341593 TACAAGCCAGAAGAGATTGGGGG - Intergenic
970678991 4:18485597-18485619 TAGAAGCCAGAAGAGATTGGGGG + Intergenic
970985577 4:22152965-22152987 TGAAAACTAGAAAACATTGATGG + Intergenic
971074371 4:23130654-23130676 TGGAAGCCACTAGACATTGGTGG + Intergenic
971107624 4:23543849-23543871 TATAAGCCAAAAGAGATTGGGGG + Intergenic
971182163 4:24338855-24338877 TGTAAACAATGAGACATTGGAGG - Intergenic
971590085 4:28456341-28456363 TATAAGCCAGAAGAGATTGGGGG - Intergenic
971673424 4:29594003-29594025 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
971918955 4:32911333-32911355 TACAAGCCAGAAGAGATTGGGGG + Intergenic
971958608 4:33455641-33455663 TATAAGCCAGGAGAGATTGGGGG + Intergenic
972041261 4:34603147-34603169 TATAAGCCAGAAGAGACTGGAGG - Intergenic
972057113 4:34816690-34816712 TACAAGCCAGAAGAGATTGGGGG + Intergenic
972109794 4:35543008-35543030 TACAAGCCAGAAGAGATTGGTGG + Intergenic
972689018 4:41378573-41378595 TTTTGGCAAGAAGACATTGGTGG + Intronic
972854936 4:43094675-43094697 TACAAGCCAGAAGACAGTGGGGG + Intergenic
972917183 4:43895823-43895845 TACAAGCCAGAAGACAGTGGGGG - Intergenic
972927953 4:44035597-44035619 TGTATGTTAGGAGACATTTGTGG - Intergenic
972962938 4:44475531-44475553 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
972989998 4:44813246-44813268 TACAAGCCAGAAGAGATTGGGGG - Intergenic
973011489 4:45080713-45080735 TACAAGCCAGAAGAGATTGGGGG - Intergenic
973124715 4:46568920-46568942 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
973313122 4:48730549-48730571 TACAAGCCAGAAGACAGTGGGGG + Intronic
973575005 4:52278007-52278029 TGCAAGCCAGAAGAGACTGGGGG + Intergenic
973617493 4:52693283-52693305 TACAAGCCAGAAGAGATTGGGGG + Intergenic
973673823 4:53243294-53243316 TAAAAGCTAGAAGAGATTGGAGG + Intronic
973721184 4:53725350-53725372 TACAAGCCAGAAGAGATTGGGGG + Intronic
973732406 4:53835161-53835183 TACAAGCCAGAAGAGATTGGGGG + Intronic
973935657 4:55843545-55843567 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
974196601 4:58583937-58583959 TGCAAGCCAGAAGAGAGTGGAGG - Intergenic
974234459 4:59162709-59162731 TATGAGCCAGAAGAGATTGGGGG + Intergenic
974240191 4:59236795-59236817 TACAAGCTAGAAGAGATTGGGGG - Intergenic
974261562 4:59531401-59531423 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
974350316 4:60736078-60736100 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
974371301 4:61019821-61019843 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
974426186 4:61745524-61745546 TACAAGCCAGAAGACAGTGGGGG + Intronic
974427404 4:61759006-61759028 TACAAGCCAGAAGACAGTGGGGG - Intronic
974494059 4:62603955-62603977 TATAAGCCAGAAGACAGTGGGGG + Intergenic
974581767 4:63813126-63813148 TATAAGCCAGAAGAGATTGGGGG - Intergenic
974591350 4:63952404-63952426 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
974914247 4:68160291-68160313 TACAAGCCAGAAGAGATTGGGGG - Intergenic
974937176 4:68421998-68422020 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
975022403 4:69504919-69504941 TATAAGTCAGAAGAGATTGGGGG + Intronic
975059219 4:69977009-69977031 TACAAGCCAGAAGAGATTGGGGG - Intergenic
975062271 4:70017975-70017997 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
975106005 4:70570057-70570079 TACAAGCCAGAAGAGATTGGGGG - Intergenic
975194416 4:71506910-71506932 TATGAGCCAGAAGAGATTGGGGG + Intronic
975212808 4:71721076-71721098 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
975345759 4:73291420-73291442 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
975352575 4:73361921-73361943 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
975466149 4:74712291-74712313 TATAAGCCAGAAAACAGTGGGGG - Intergenic
975899012 4:79128114-79128136 TATAAGCCAGAAGAGATTGTAGG - Intergenic
975977706 4:80117391-80117413 TACAAGCTAGAAGAGATTGGAGG + Intronic
976006997 4:80441370-80441392 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
976024786 4:80674348-80674370 TATAAGCCAGAAGAGAGTGGGGG - Intronic
976135905 4:81936096-81936118 TACAAGCTAGAAGAGAGTGGGGG - Intronic
976263255 4:83165863-83165885 TACAAGCCAGAAGACAGTGGAGG + Intergenic
976289213 4:83399701-83399723 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
976375086 4:84337392-84337414 TATAAGCCAGAAGAGATTGGAGG - Intergenic
976438490 4:85045464-85045486 TGCAAGCTAGAAGAGAGTGGGGG + Intergenic
976492836 4:85692153-85692175 TACAAGCCAGAAGAGATTGGGGG - Intronic
976538004 4:86241162-86241184 TACAAGCCAGAAGATATTGGGGG - Intronic
976640565 4:87333540-87333562 TACAAGCCAGAAGATATTGGGGG - Intergenic
976807226 4:89062098-89062120 TACAAGCTAGAAGAGATTGGGGG - Intronic
976948297 4:90797798-90797820 TATGAGCCAAAAGACATTGGCGG - Intronic
976956034 4:90901607-90901629 TATCAGCTAGAAGAGATTGGGGG - Intronic
977364719 4:96053276-96053298 TTTAAGCTTCATGACATTGGGGG + Intergenic
977414878 4:96720653-96720675 TATAAGCCAGAAGAGATTGGGGG - Intergenic
977440229 4:97056738-97056760 TACAAGCCAGAAGAGATTGGGGG - Intergenic
977455892 4:97259135-97259157 TATAAGCCAGAAGAGAGTGGGGG - Intronic
977506077 4:97905271-97905293 TACAAGCCAGAAGACAGTGGGGG + Intronic
977508830 4:97936704-97936726 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
977524137 4:98124503-98124525 TACAAGCTAGAAGAGATTGGGGG - Intronic
977632783 4:99262124-99262146 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
977696698 4:99973364-99973386 TACAAGCCAGAAGAAATTGGGGG + Intergenic
977729487 4:100333557-100333579 TACAAGCCAGAAGAGATTGGGGG + Intergenic
977744486 4:100529556-100529578 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
977815499 4:101409994-101410016 TACAAGCCAGAAGACAGTGGGGG - Intergenic
977997524 4:103513350-103513372 TACAAGCCAGAAGAGATTGGGGG - Intergenic
978336425 4:107673862-107673884 TATAAGCCAGAAGAGAGTGGGGG + Intronic
978464713 4:108995783-108995805 TATAAGCCAGAAGAGAGTGGGGG + Intronic
978596367 4:110381263-110381285 TGCAAGCCAGAAGAGACTGGGGG + Intronic
978657032 4:111076353-111076375 TATAAGCTGGAAGAGATTGGGGG + Intergenic
978677682 4:111338616-111338638 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
978680941 4:111379721-111379743 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
978689169 4:111485508-111485530 TACAAGCCAGAAGACATTAGAGG + Intergenic
978710047 4:111769318-111769340 TACAAGCCAGAAGAAATTGGGGG - Intergenic
978994527 4:115133114-115133136 TATAAGCCAGAAGATATTGAAGG + Intergenic
979012511 4:115389061-115389083 TACAAGCCAGAAGACAGTGGGGG + Intergenic
979012943 4:115394697-115394719 TGCAAACCAGAAAACATTGGGGG - Intergenic
979201034 4:117978343-117978365 TACAAGCCAGAAGAGATTGGGGG + Intergenic
979299960 4:119075441-119075463 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
979337785 4:119483294-119483316 TGCAAGCCAGACGAGATTGGGGG + Intergenic
979576307 4:122295428-122295450 TACAAGCCAGAAAACATTGGGGG + Intronic
979628424 4:122872690-122872712 TATAAGCCAGAAGAGATTGGGGG + Intronic
979735237 4:124074397-124074419 TACAAGCCAGAAGAGATTGGGGG + Intergenic
979757783 4:124363051-124363073 TACAAGCCAGAAGAGATTGGGGG + Intergenic
979849445 4:125558003-125558025 TGGAAGCTAAAAGAATTTGGAGG - Intergenic
979967289 4:127090003-127090025 TACAAGCTAGAAGAGATTAGGGG + Intergenic
980021931 4:127721297-127721319 TATAAGCTGGAAGAGGTTGGGGG - Exonic
980088216 4:128414528-128414550 TACAAGCCAGAAGAGATTGGGGG - Intergenic
980160928 4:129161640-129161662 TGGAAACTAGAAGACCATGGAGG - Intergenic
980322116 4:131292206-131292228 TACAAGCCAGAAGAGATTGGGGG - Intergenic
980333441 4:131439381-131439403 TATAAGCTAGAAGAGATTGGGGG - Intergenic
980512687 4:133813898-133813920 TACAAGCCAGAAGAGATTGGGGG + Intergenic
980576220 4:134686509-134686531 TGTAAGTCAGAAGAAACTGGGGG - Intergenic
980583759 4:134787247-134787269 TGTAAGCCAGAAGAGATTGAGGG - Intergenic
980584220 4:134791066-134791088 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
980612874 4:135182056-135182078 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
980633737 4:135472278-135472300 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
980744473 4:136997843-136997865 TACAAGCCAGAAGAGATTGGGGG - Intergenic
980816200 4:137949796-137949818 TATAAGCCAAAAGATATTGGGGG - Intergenic
981063075 4:140448031-140448053 TGCAAGCCAGAAGAGATTGGAGG - Intronic
981076100 4:140593994-140594016 TACAAGCCAGAAGAGATTGGGGG - Intergenic
981187210 4:141817517-141817539 TGTAAGCCAGAAGAGACTGGAGG + Intergenic
981346813 4:143685313-143685335 TACAAGCTAGAAGGGATTGGGGG + Intronic
981453904 4:144931906-144931928 TATAAGCCAGAAGAGATTGGGGG - Intergenic
981512072 4:145568253-145568275 TACAAGCCAGAAGAGATTGGGGG + Intergenic
981631688 4:146826435-146826457 TGCAAGCTAGAAGAGATTGGGGG - Intronic
981850203 4:149220218-149220240 TACAAGCCAGAAGAGATTGGGGG + Intergenic
982579661 4:157161657-157161679 TACAAGCTAGAAGAGAGTGGGGG - Intronic
982619092 4:157680295-157680317 TGTAAGATATAAAAGATTGGTGG - Intergenic
982646341 4:158028203-158028225 TACAAGCCAGAAGAGATTGGGGG + Intergenic
982670233 4:158312368-158312390 TACAAGCCAGAAGAGATTGGGGG - Intergenic
982733778 4:158983476-158983498 TGCAAGCCAGAAGAGACTGGGGG + Intronic
983169407 4:164519361-164519383 CATAAGCCAGAAGAGATTGGGGG - Intergenic
983420024 4:167505577-167505599 TGTAAGCCAGAAGAGATTGGGGG - Intergenic
983439871 4:167768216-167768238 TGAAAGCTAGAGGACAATGCAGG - Intergenic
983487760 4:168352033-168352055 TACAAGCTAGAAGATATTGGGGG - Intergenic
983594480 4:169450494-169450516 TACAAGCCAGAAGACAGTGGGGG + Intronic
983598870 4:169500575-169500597 TACAAACCAGAAGACATTGGTGG + Intronic
983727123 4:170942080-170942102 TACAAGCCAGAAGAGATTGGGGG + Intergenic
984110273 4:175604350-175604372 TGCAAGCCAGAAGAGAGTGGAGG - Intergenic
984430161 4:179638331-179638353 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
984625914 4:182008049-182008071 TACAAGCCAGAAGAGATTGGGGG - Intergenic
984628376 4:182034709-182034731 TACAAGCTGGAAGATATTGGGGG - Intergenic
985204669 4:187522298-187522320 TACAAGCCAGAAGACAGTGGGGG + Intergenic
985317585 4:188674309-188674331 TGTAAGCCAGAAGAGAGTGGGGG + Intergenic
985367644 4:189249222-189249244 TGCAAGCCAGAAGAGATTGGGGG + Intergenic
1202756761 4_GL000008v2_random:70751-70773 TACAAGCCAGAAGACAGTGGGGG + Intergenic
986358725 5:6953929-6953951 TGCAAGCCAGAAGAGAGTGGAGG + Intergenic
986530614 5:8732656-8732678 TACAAGCCAGAAGACAGTGGGGG + Intergenic
986576362 5:9217316-9217338 TACAAGCCAGAAGAGATTGGGGG - Intronic
986654905 5:10001357-10001379 TGCAAGCCAGAAGAGACTGGGGG + Intergenic
986754399 5:10822276-10822298 TACAAGCCAGAAGAAATTGGAGG - Intergenic
986846086 5:11755267-11755289 TACAAGCCAGAAGAGATTGGGGG - Intronic
986920339 5:12672590-12672612 TACAAGCCAGAAGACAGTGGTGG - Intergenic
987260604 5:16198215-16198237 TGCAAGCCAGAAGAGATTGGGGG + Intergenic
987454067 5:18121174-18121196 TATAAGCTGGAGGAGATTGGGGG + Intergenic
987479248 5:18432166-18432188 TGAAAGCCAGAAGAGAGTGGGGG + Intergenic
987549679 5:19362521-19362543 AGTAAGATAGTAGACACTGGAGG + Intergenic
987653431 5:20774763-20774785 TGTAAGAAATAAGCCATTGGTGG - Intergenic
987988389 5:25179779-25179801 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
988043427 5:25916832-25916854 TACAAGCTAGAAGAGATTGGGGG + Intergenic
988052128 5:26044027-26044049 TATAAGCCAGAAGATATTGCGGG + Intergenic
988090054 5:26526857-26526879 TGTGACCTAGAAGGCATGGGGGG + Intergenic
988128665 5:27075132-27075154 TACAAGCCAGAAGAGATTGGGGG + Intronic
988138990 5:27210989-27211011 TACAAGCCAGAAGACAGTGGGGG + Intergenic
988269259 5:28992837-28992859 TGCAAGCCAGAAGAAAGTGGGGG + Intergenic
988742143 5:34086715-34086737 TGTAAGAAATAAGCCATTGGTGG + Intronic
988794944 5:34645003-34645025 TACAAGCCAGAAGACAGTGGGGG - Intergenic
988843522 5:35106041-35106063 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
988859232 5:35260286-35260308 TACAAGCCAGAAGACAGTGGGGG - Intergenic
988871756 5:35397894-35397916 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
988936199 5:36085065-36085087 TACAAGCCAGAAGAGATTGGGGG + Intergenic
988967129 5:36430795-36430817 TACAAGCCAGAAGAGATTGGGGG - Intergenic
989009039 5:36849106-36849128 TACAAGCCAGAAGACAGTGGGGG + Intergenic
989276601 5:39597466-39597488 TACAAGCCAGAAGAGATTGGGGG - Intergenic
989302364 5:39909091-39909113 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
989370493 5:40701847-40701869 TACAAGCCAGAAGAGATTGGGGG + Intergenic
989493125 5:42079960-42079982 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
989532794 5:42526899-42526921 TATAAGCCAGAAGAGATTGGGGG + Intronic
989614571 5:43327192-43327214 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
989682426 5:44045404-44045426 TTTAAGCCAGAAGAAATTGGAGG - Intergenic
989804276 5:45584856-45584878 TATAAGCCAGAAGAGAGTGGGGG - Intronic
990016208 5:51065201-51065223 TGAAAGCCAGAAGAGAGTGGGGG + Intergenic
990133140 5:52612333-52612355 TACAAGCCAGAAGACAGTGGGGG - Intergenic
990135821 5:52643148-52643170 TACAAGCCAGAAGACAGTGGGGG + Intergenic
990668834 5:58104469-58104491 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
990750626 5:59011969-59011991 TATAAGCCAGAAGAGAGTGGGGG + Intronic
990792614 5:59497990-59498012 TACAAGCCAGAAGAGATTGGGGG + Intronic
990835783 5:60018155-60018177 TACAAGCTAGAAGAGATTGGGGG + Intronic
990940540 5:61199145-61199167 TACAAGCCAGAAGAGATTGGGGG - Intergenic
990945081 5:61240669-61240691 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
991026473 5:62035986-62036008 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
991089108 5:62677127-62677149 TACAAGCCAGAAGACAGTGGGGG - Intergenic
991199832 5:63979210-63979232 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
991226893 5:64284181-64284203 TACAAGCTAGAAGAGATTGGGGG - Intronic
991233595 5:64366288-64366310 TACAAGCCAGAAGAGATTGGGGG - Intronic
991346673 5:65675661-65675683 TATAAGCCAGAAGAGATTGGGGG + Intronic
991529769 5:67602651-67602673 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
991576024 5:68104042-68104064 TACAAGCTAGAAGAGACTGGGGG + Intergenic
992055095 5:72981270-72981292 TACAAGCCAGAAGACAGTGGGGG - Intronic
992235884 5:74708105-74708127 TACAAGCCAGAAGACAGTGGGGG + Intronic
992335875 5:75769153-75769175 TAAAAGCTAGAAGAGATTGGGGG - Intergenic
992336310 5:75773876-75773898 TACAAGCCAGAAGACAGTGGGGG - Intergenic
992338321 5:75796954-75796976 TACAAGCCAGAAGACAGTGGGGG - Intergenic
992347981 5:75900390-75900412 TACAAGCCAGAAGACAGTGGGGG - Intergenic
992514422 5:77476488-77476510 TACAAGCCAGAAGACAGTGGGGG + Intronic
992631336 5:78683753-78683775 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
992659353 5:78943604-78943626 TACAAGCCAGAAGACAGTGGGGG - Intronic
992675261 5:79100218-79100240 TACAAGCCAGAAGAGATTGGGGG - Intronic
992908904 5:81375156-81375178 TGCAAGCCAGAAGAGAGTGGCGG + Intronic
993008650 5:82455867-82455889 TACAAGCCAGAAGACAGTGGGGG - Intergenic
993046327 5:82871204-82871226 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
993089667 5:83409580-83409602 TACAAGCCAGAAGAGATTGGGGG + Intergenic
993244457 5:85433259-85433281 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
993322021 5:86482719-86482741 TTTAAGTTAGAAGAGATTGCTGG + Intergenic
993365348 5:87028778-87028800 TACAAGCCAGAAGAGATTGGGGG - Intergenic
993375709 5:87147790-87147812 TACAAGCCAGAAGAGATTGGGGG - Intergenic
993444298 5:87992263-87992285 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
993446049 5:88013796-88013818 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
993587138 5:89745539-89745561 TGCAAGCCAGAAGAGATTGGGGG - Intergenic
993644684 5:90447702-90447724 TGGATGCTAGAAGACAATGGAGG - Intergenic
993742427 5:91557186-91557208 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
993933243 5:93968872-93968894 TGTAAGCAAGAAGACAGAGGAGG + Intronic
993986484 5:94603240-94603262 TGCAAGCCAGAAGATACTGGGGG + Intronic
994021530 5:95031451-95031473 TACAAGCCAGAAGAGATTGGAGG + Intronic
994136281 5:96290883-96290905 TGTAATCTATAGGACCTTGGGGG + Intergenic
994298983 5:98123200-98123222 TACAAGCCAGAAGAGATTGGGGG + Intergenic
994346626 5:98695441-98695463 TACAAGCTAGAAGAGATTGGGGG - Intergenic
994351360 5:98750069-98750091 TGTAATCTAGAAAAGATTTGAGG + Intergenic
994586366 5:101714582-101714604 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
994603756 5:101941454-101941476 TATCAGCCAGAAGACATTGAGGG - Intergenic
994973655 5:106775306-106775328 TACAAGCCAGAAGACAGTGGGGG - Intergenic
995003203 5:107159595-107159617 TACAAGCCAGAAGAGATTGGGGG + Intergenic
995086015 5:108110013-108110035 TGTAACCTAGAAGAGAATGAAGG - Intronic
995188157 5:109292393-109292415 TATAAGCCAGAAGAGATTGGGGG + Intergenic
995218859 5:109625933-109625955 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
995263965 5:110137367-110137389 TGTAAGCCAGAAGAGAGTGGGGG - Intergenic
995265023 5:110149760-110149782 TGGAAGCCAGAAGACAGTGGAGG - Intergenic
995329547 5:110932134-110932156 TAGAAGCCAGAAGAGATTGGGGG - Intergenic
995475224 5:112540771-112540793 TGTAAGCCAGAAGAGAGTGAGGG + Intergenic
995488174 5:112660140-112660162 TACAAGCCAGAAGAAATTGGGGG + Intergenic
995578854 5:113573294-113573316 TACAAGCCAGAAGAGATTGGGGG - Intronic
995585882 5:113647651-113647673 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
995642799 5:114277163-114277185 TACAAGCCAGAAGAGATTGGGGG - Intergenic
995666355 5:114546312-114546334 TACAAGCCAGAAGAGATTGGGGG + Intergenic
995790452 5:115881520-115881542 TGTAAGCCAGAAAACAGTGGAGG - Intronic
995967678 5:117928824-117928846 TGTGAACTAGAAGATTTTGGAGG - Intergenic
996046108 5:118875026-118875048 TACAAGCCAGAAGAAATTGGAGG + Intronic
996181959 5:120430721-120430743 TACAAGCCAGAAGACATTGGAGG - Intergenic
996242703 5:121222767-121222789 TACAAGCCAGAAGACAATGGTGG + Intergenic
996280536 5:121725006-121725028 TGCAAGCCAGAAGAGAATGGGGG - Intergenic
996287531 5:121812357-121812379 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
996469046 5:123838009-123838031 CATAAGCCAGAAGAGATTGGGGG + Intergenic
996668436 5:126087778-126087800 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
996778435 5:127158427-127158449 TATAAGCCAGAAGAGATTGGGGG - Intergenic
997020392 5:129994038-129994060 TATAAGCCAGAAGACAGTGGGGG - Intronic
997065911 5:130558305-130558327 TGCAAGCCAGAAGAGATTTGGGG + Intergenic
997075763 5:130674703-130674725 AGGAAGCTGGAAGACATTTGGGG + Intergenic
997136880 5:131336297-131336319 TATAAGCCAGAAGAGAGTGGGGG - Intronic
997137916 5:131345814-131345836 TATAAGCCAGAAGAGAGTGGGGG + Intronic
997252496 5:132399898-132399920 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
997496846 5:134335648-134335670 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
997744944 5:136290956-136290978 TGCAAGCCAGAAGAGAATGGGGG + Intronic
997861505 5:137422124-137422146 TATAAGCCAGAAGAGAGTGGGGG - Intronic
997939085 5:138140298-138140320 TAGTAGCTAGAAGACATTTGTGG - Intronic
998020637 5:138767006-138767028 TGAAATTCAGAAGACATTGGAGG - Intronic
998644794 5:144049906-144049928 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
998645190 5:144054241-144054263 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
998691425 5:144593073-144593095 TGCAAGCCAGAAGAGACTGGGGG - Intergenic
998754069 5:145357064-145357086 TGTAAGCCAGAAGATATTGGGGG - Intergenic
999020158 5:148156076-148156098 TGTAAGACAGAAGAGATTGTGGG + Intergenic
999034353 5:148330832-148330854 TATAAGCCAGAAGAGAGTGGGGG - Intronic
999507091 5:152208980-152209002 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
999555994 5:152742619-152742641 TACAAGCCAGAAGAGATTGGGGG + Intergenic
999602769 5:153284729-153284751 TGCAAGCTAGAAGTGAGTGGGGG + Intergenic
999621093 5:153474643-153474665 TACAAGCCAGAAGAGATTGGGGG - Intergenic
999834543 5:155354714-155354736 TGCAAGCCAGAAGAGATTGGGGG + Intergenic
999938812 5:156517661-156517683 TACAAGCTAGAAGAGATTGTGGG + Intronic
999958980 5:156734205-156734227 TATGAGCCAGAAGAGATTGGGGG - Intronic
1000144709 5:158443125-158443147 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1000557454 5:162743840-162743862 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1000648109 5:163782439-163782461 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1000657697 5:163901152-163901174 TGCAAGCAAGAAGAGAGTGGAGG + Intergenic
1000738256 5:164932759-164932781 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1001750582 5:174127631-174127653 TGAAAGCAAGAAGACATTGGAGG + Intronic
1001886456 5:175294920-175294942 TATAAGCCAGAAGAGATTAGGGG + Intergenic
1002011244 5:176283339-176283361 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1002673403 5:180889096-180889118 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1002673735 5:180891515-180891537 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1202773304 5_GL000208v1_random:34208-34230 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1202775006 5_GL000208v1_random:61773-61795 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1202775565 5_GL000208v1_random:66958-66980 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1002996305 6:2288345-2288367 TATAAGCCAGAAGAGAGTGGAGG + Intergenic
1003165703 6:3676533-3676555 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1003437448 6:6104991-6105013 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1003686905 6:8313657-8313679 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1003726787 6:8774818-8774840 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1004028185 6:11839013-11839035 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1005100767 6:22170692-22170714 TCCAAGCTAGAAGAGAGTGGGGG - Intergenic
1005120834 6:22388288-22388310 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1005170808 6:22982123-22982145 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1005177197 6:23060167-23060189 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1005415654 6:25597920-25597942 CGGAAGCTAGAAGATAATGGAGG - Intronic
1005800058 6:29411594-29411616 TGAAAGCCAGAAGAGATTGCAGG + Intronic
1005953160 6:30646227-30646249 TGTAAGGTAGAAGGAATTGTGGG - Intronic
1006048751 6:31322843-31322865 TATAAGCCAGAAGAGATTGAGGG + Intronic
1007068769 6:39019396-39019418 TGAAAGCAAGAAGATGTTGGTGG + Intronic
1007314663 6:40977559-40977581 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1007954972 6:45909601-45909623 TGCAAGCCAGAAGAGATTGAGGG - Intronic
1008088735 6:47271329-47271351 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1008208313 6:48689244-48689266 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1008298664 6:49807314-49807336 TGTAAGCCAGAAGAGATTGGGGG + Intergenic
1008363405 6:50648375-50648397 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1008463066 6:51798450-51798472 TGTAAGCCAAAAGAGATTGGGGG - Intronic
1008530341 6:52451460-52451482 TATAAGCCAGAAGAGATTGGGGG - Intronic
1008688254 6:53947619-53947641 TACAAGCCAGAAGAGATTGGAGG + Intronic
1008731206 6:54484735-54484757 TGTAAGCTAGCAGACCTATGCGG - Intergenic
1008782547 6:55125439-55125461 TACAAGCCAGAAGACAGTGGAGG - Intronic
1009034521 6:58099977-58099999 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1009210003 6:60850475-60850497 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1009279128 6:61724131-61724153 TATAAGCCAGGAGAGATTGGGGG + Intronic
1009312499 6:62171743-62171765 TGTAAGCCAGAAGAGATTGAGGG + Intronic
1009325234 6:62340583-62340605 TGCAAGCCAGAAGAAACTGGGGG + Intergenic
1009355825 6:62742124-62742146 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1009468961 6:64008790-64008812 TAAAAGCAAGAAGAGATTGGGGG - Intronic
1009589275 6:65644730-65644752 TGCAAGCCAGAAGAGATTGGGGG + Intronic
1009593552 6:65706772-65706794 TATATGCTAGCAGACAATGGGGG + Intronic
1009643807 6:66371722-66371744 TGCAAGCCAGAAGAGATTGGAGG - Intergenic
1009800091 6:68526459-68526481 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1009889072 6:69658083-69658105 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1010105458 6:72162714-72162736 TACAAGCCAGAAGACAGTGGGGG - Intronic
1010295596 6:74193017-74193039 TACAAGCCAGAAGAAATTGGGGG - Intergenic
1010459095 6:76093254-76093276 TACAAGCCAGAAGAGATTGGAGG + Intergenic
1010495536 6:76530729-76530751 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1010521908 6:76848805-76848827 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1010530377 6:76960653-76960675 TAAAAGCCAGAAGACAGTGGGGG + Intergenic
1010589664 6:77698594-77698616 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1010668121 6:78654147-78654169 TGTAAGCCAGAAGAGAGTGGGGG - Intergenic
1010681107 6:78800257-78800279 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1010944362 6:81957359-81957381 TACAAGCCAGAAGACACTGGGGG - Intergenic
1011086683 6:83548285-83548307 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1011214328 6:84988773-84988795 TGTAAGCCAGAAGAGATTGGGGG + Intergenic
1011228392 6:85132992-85133014 TGAAAACTAGAACACATGGGAGG + Intergenic
1011298757 6:85852206-85852228 TGCAAGCCAGAACACAGTGGGGG - Intergenic
1011361004 6:86525168-86525190 TACAAGCCAGAAGATATTGGAGG - Intergenic
1011373828 6:86669538-86669560 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1011584605 6:88910806-88910828 TATAAGCCAGAAGAGACTGGAGG + Intronic
1011760884 6:90563883-90563905 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1011943454 6:92871007-92871029 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1011953508 6:92996970-92996992 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1012075212 6:94674036-94674058 TACAAGCCAGAAGACATTGGGGG + Intergenic
1012085966 6:94825961-94825983 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1012087863 6:94852808-94852830 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1012089368 6:94872609-94872631 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1012134497 6:95539287-95539309 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1012209113 6:96498597-96498619 TATAAGCCAGAAGAGAGTGGAGG - Intergenic
1012459896 6:99448841-99448863 TACAAGCCAGAAGAGATTGGGGG + Intronic
1012554905 6:100499395-100499417 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1012561301 6:100584906-100584928 TACAAGCTAGAAGAGAGTGGGGG - Intronic
1012616369 6:101283797-101283819 TGTCAGCTAGAGAACACTGGTGG - Intergenic
1012878221 6:104754601-104754623 TGCAAGCCAGAAGAGACTGGTGG + Intronic
1013038189 6:106406702-106406724 TATAAGCCAGAGGACAGTGGAGG + Intergenic
1013154990 6:107484758-107484780 TGTAAGCTTCAAGAAATTTGGGG + Intergenic
1013393563 6:109712081-109712103 TAAAAGCCAGAAGAGATTGGGGG - Intronic
1013453187 6:110304975-110304997 TACAAGCTAGAAGACAGTGGGGG + Intronic
1013461719 6:110380396-110380418 TATGAGCCAGAAGAGATTGGGGG + Intergenic
1013484022 6:110578011-110578033 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1013638582 6:112051899-112051921 TATAAGCCAGAAGAGAGTGGTGG - Intergenic
1013672789 6:112423180-112423202 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1013988528 6:116225753-116225775 TTTTAGCTAGAAGACAGTGTAGG + Intronic
1013991902 6:116263921-116263943 TACAAGCCAGAAGACATTGAGGG - Intronic
1013999133 6:116344449-116344471 TACAAGCCAGAAGACAGTGGGGG + Intronic
1014223348 6:118821447-118821469 TACAAGCCAGAAGACAGTGGGGG - Intronic
1014367356 6:120561530-120561552 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1014413738 6:121157829-121157851 TTAAAGCCAGAAGAGATTGGAGG - Intronic
1014464324 6:121737353-121737375 TACAAGCCAGAAGAAATTGGGGG - Intergenic
1014849913 6:126328405-126328427 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1015358385 6:132306677-132306699 TACAAGCCAGAAGAGATTGGGGG + Intronic
1015396906 6:132745004-132745026 TGTATGGTGGAAGACATTGTGGG + Intronic
1015697890 6:136002015-136002037 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1015802263 6:137071949-137071971 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1015883087 6:137889712-137889734 TATAAGCCAGAAGACAGTAGGGG - Intergenic
1016075142 6:139787195-139787217 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1016107933 6:140185893-140185915 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1016168041 6:140972636-140972658 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1016453456 6:144208024-144208046 TGTAAGCCAGAAGAGGTTGGGGG - Intergenic
1017197226 6:151715163-151715185 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1017233024 6:152092979-152093001 TGTAAGAACGAAGACCTTGGTGG + Intronic
1017631959 6:156404760-156404782 TGTATGGTAGAACACAGTGGAGG + Intergenic
1017660102 6:156665316-156665338 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1017994330 6:159519400-159519422 TAAAAGCCAGAAGACATTAGGGG - Intergenic
1018124877 6:160672164-160672186 TGCAAGCCAGAAGAGATTGTGGG + Intergenic
1018449029 6:163888628-163888650 TGCAAGCCAGAAGACAGTGGAGG + Intergenic
1018578444 6:165284640-165284662 TACAAGCCAGAAGAGATTGGGGG + Intronic
1018760140 6:166886632-166886654 TACAAGCCAGAAGACAGTGGGGG + Intronic
1019031420 6:169016983-169017005 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1019113341 6:169736640-169736662 TATAAGCCAGAAGAGATTGAGGG - Intergenic
1019753107 7:2745334-2745356 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1020330181 7:7010130-7010152 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1020539145 7:9438194-9438216 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1020543460 7:9492371-9492393 TGCAAGTTGGAAGAGATTGGGGG - Intergenic
1020621985 7:10529424-10529446 TATAAGCCAGAAGAGACTGGGGG + Intergenic
1020636160 7:10697683-10697705 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1020693632 7:11389939-11389961 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1020702455 7:11500135-11500157 TATAAGCCAGAAGAGATTGGGGG + Intronic
1020716233 7:11677082-11677104 TACAAGCTAGAAGAGAGTGGAGG + Intronic
1020773978 7:12430658-12430680 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1020810157 7:12841329-12841351 TATAAGCCAGAAGAGAGTGGTGG + Intergenic
1021069438 7:16218106-16218128 TACAAGCCAGAAGACAGTGGGGG + Intronic
1021155090 7:17200141-17200163 TAAAAGGTAGAAGACATTGGAGG + Intergenic
1021201901 7:17736500-17736522 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1021211214 7:17855214-17855236 TTGAAGCTAGCAGACATTGGAGG + Intronic
1021302442 7:18989380-18989402 TACAAGCCAGAAGACAGTGGGGG - Intronic
1021347477 7:19546571-19546593 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1021372740 7:19870139-19870161 AGGAAGCGAGAAGAAATTGGAGG - Intergenic
1021484144 7:21148324-21148346 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1021502114 7:21343606-21343628 TCTAAGCCAGAAGACAGTGGCGG - Intergenic
1021776697 7:24061220-24061242 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1021870380 7:25000573-25000595 TATAAGCCAGAAGACAGTGAGGG - Intergenic
1022058640 7:26768782-26768804 TGTAAGCCAGAAGAGAGTGGGGG - Intronic
1022187448 7:27983765-27983787 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1022432740 7:30342548-30342570 TACAAGCCAGAAGACAGTGGGGG - Intronic
1022754497 7:33271027-33271049 TACAAGCCAGAAGAGATTGGAGG + Intronic
1022877962 7:34554364-34554386 CATAAGCCAGAAGAGATTGGAGG + Intergenic
1022901593 7:34815731-34815753 TACAAGCCAGAAGACAGTGGGGG + Intronic
1022961629 7:35431776-35431798 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1023196021 7:37640624-37640646 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1023497479 7:40814039-40814061 TATAAGCCAGGAGAGATTGGGGG - Intronic
1023886180 7:44358664-44358686 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1023897427 7:44445521-44445543 TGTGAGGCAGATGACATTGGAGG - Intronic
1023898699 7:44456797-44456819 TGTAAGCTAGAAGAAAATGGAGG + Intronic
1024380164 7:48686743-48686765 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1024590169 7:50874178-50874200 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1024624868 7:51198332-51198354 TGCAAGCCAAAAGAGATTGGGGG - Intronic
1024697610 7:51872259-51872281 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1025153991 7:56586471-56586493 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1026114710 7:67486521-67486543 TCTCAGCTAGAAGAAATGGGAGG - Intergenic
1027577155 7:79945415-79945437 TTTAAGCCAGAAGAGAGTGGGGG - Intergenic
1027627307 7:80562505-80562527 TACAAGCCAGAAGAGATTGGGGG - Intronic
1027684122 7:81260272-81260294 TGCAAGCTAGAAGAAAGTGGAGG - Intergenic
1027733955 7:81908771-81908793 TGCAAGCCAGAAGAGATTGGGGG + Intergenic
1027778016 7:82491068-82491090 TGCAAGCCAGAAGAGAATGGGGG - Intergenic
1027998968 7:85466849-85466871 CCTAATATAGAAGACATTGGTGG - Intergenic
1028013426 7:85678143-85678165 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1028027839 7:85868250-85868272 TATAAGCCAGAAGATATTGACGG + Intergenic
1028041134 7:86056492-86056514 TATAAGCAGGAAGAGATTGGAGG - Intergenic
1028065385 7:86377169-86377191 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1028081901 7:86587608-86587630 TGCAGGCCAGAAGACAGTGGGGG + Intergenic
1028176772 7:87669796-87669818 TACAAGCCAGAAGAGATTGGGGG - Intronic
1028329074 7:89565807-89565829 TATGAGCTGGAAGAGATTGGGGG + Intergenic
1028329844 7:89576555-89576577 TATAATCCAGAAGATATTGGGGG + Intergenic
1028458093 7:91060726-91060748 TACAAGCCAGAAGACAGTGGGGG - Intronic
1028459369 7:91073322-91073344 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1028497706 7:91481001-91481023 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1028508076 7:91591457-91591479 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1028518224 7:91700701-91700723 TACAAGCTAGAAGAGATTTGGGG + Intronic
1028677810 7:93488073-93488095 TACAAGCTAGAAGAGATTGGAGG + Intronic
1028691886 7:93662346-93662368 TGCAAGCCAGAAGAGATTGGGGG - Intronic
1028734163 7:94188326-94188348 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1028886456 7:95940124-95940146 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1028967996 7:96824448-96824470 TAGAATCTATAAGACATTGGAGG - Intergenic
1029052614 7:97704677-97704699 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1029062449 7:97812145-97812167 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1029807573 7:103012471-103012493 TACAAGCCAGAAGAGATTGGGGG + Intronic
1029810235 7:103039641-103039663 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1030374789 7:108743144-108743166 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1030500620 7:110355103-110355125 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1030692000 7:112545771-112545793 TACAAGCCAGAAGAGATTGGAGG - Intergenic
1030827900 7:114184437-114184459 TTTTAGCTATAGGACATTGGGGG + Intronic
1030830044 7:114209473-114209495 TACAAGCTAGCAGACATTAGGGG - Intronic
1030905045 7:115172087-115172109 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1031032195 7:116746955-116746977 TACAAGCCAGAAGACAGTGGGGG + Intronic
1031096957 7:117431881-117431903 TGCAAGCCAGAAGAGATTGGGGG - Intergenic
1031182837 7:118438454-118438476 TGCAAGTCAGAAGAAATTGGCGG + Intergenic
1031294587 7:119984999-119985021 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1031391889 7:121225300-121225322 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1031598616 7:123676240-123676262 TGTAAGTGAGTAGATATTGGAGG - Intergenic
1032250516 7:130253345-130253367 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1032603863 7:133328747-133328769 TATAAGCAAGAAGACAGTGAGGG - Intronic
1032775454 7:135108532-135108554 TACAAGCCAGAAGAGATTGGGGG - Intronic
1033110739 7:138572741-138572763 TTTAAGCCCAAAGACATTGGTGG + Intronic
1033780426 7:144662845-144662867 TGCAAGCCAGAAGAGATTGGGGG - Intronic
1033791753 7:144798593-144798615 TACAAGCCAGAAGAGATTGGGGG + Intronic
1033976996 7:147115136-147115158 TACAAGCTAGAAGAGATTGGGGG - Intronic
1034236766 7:149578130-149578152 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1034652807 7:152705459-152705481 TGTAAGGTAGAATAGATTGAAGG - Intergenic
1034963801 7:155378909-155378931 TTTAAGCTATAAAACCTTGGCGG - Intergenic
1036022021 8:4856079-4856101 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1036516081 8:9445634-9445656 TATAAGCCAGAAGACAGTGGGGG - Intergenic
1036536382 8:9656555-9656577 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1036835315 8:12059420-12059442 TATAAGCCAGAAGAGATTGTGGG + Intergenic
1036857156 8:12305983-12306005 TATAAGCCAGAAGAGATTGTGGG + Intergenic
1037285285 8:17292781-17292803 TATAAGCCAGAAGAGAATGGGGG - Intronic
1038211777 8:25524857-25524879 TGCAAGCCAGAAGAGATTGGGGG + Intergenic
1038872671 8:31512738-31512760 TATAAGCCAGAACAGATTGGGGG - Intergenic
1038936241 8:32255518-32255540 TACAAGCCAGAAGAGATTGGGGG - Intronic
1039102512 8:33956371-33956393 TGCAAGCCAGAAAAGATTGGGGG - Intergenic
1039103496 8:33966044-33966066 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1039138862 8:34359966-34359988 TGCAAGCCAGAAGACATTTGGGG - Intergenic
1039146176 8:34450066-34450088 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1039265349 8:35817513-35817535 TACAAGCCAGAAGAGATTGGTGG + Intergenic
1039636923 8:39177836-39177858 TGCAAGCCAGAAGAGATTGGGGG - Intronic
1040403576 8:47077313-47077335 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1040438868 8:47420936-47420958 TGCAAGCCAGAAGATAATGGGGG - Intronic
1040613104 8:49005867-49005889 TACAAGCAAGAAGAGATTGGGGG - Intergenic
1040651116 8:49449703-49449725 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1040736234 8:50512242-50512264 TGCAAGCCAGAAGAGACTGGGGG - Intronic
1040753091 8:50735936-50735958 TACAAGCTAGAAGAGATTGGGGG + Intronic
1040756449 8:50782031-50782053 TAAAAGCCAGAAGACAGTGGGGG - Intronic
1040766624 8:50918788-50918810 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1040789111 8:51204560-51204582 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1040863784 8:52027442-52027464 TGCAAGCCAGAAGAGAGTGGAGG - Intergenic
1040959968 8:53020925-53020947 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1040962588 8:53050662-53050684 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1040992882 8:53370799-53370821 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1041341249 8:56848066-56848088 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1041382995 8:57271902-57271924 TGCAAGCCAGAAGAGAATGGAGG - Intergenic
1041400480 8:57437979-57438001 TGAAGGCCAGAAGACAGTGGAGG - Intergenic
1041418897 8:57645313-57645335 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1041427309 8:57737262-57737284 TACAAGCTAGAAGAGATTTGGGG - Intergenic
1041482176 8:58333538-58333560 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1041666493 8:60449877-60449899 TGCAAGCCAGAAGATAGTGGGGG + Intergenic
1041785068 8:61622680-61622702 TGCAAGGTGGAAGCCATTGGAGG - Intronic
1041877809 8:62711062-62711084 TACAAGCTAGAAGAGGTTGGGGG - Intronic
1041907229 8:63047028-63047050 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1041972423 8:63759397-63759419 TGCAAGCCAGAAGAGATTGGGGG - Intergenic
1042308543 8:67357264-67357286 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1042473304 8:69215821-69215843 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1042597349 8:70464378-70464400 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1042626982 8:70769263-70769285 TACAAGCCAGAAGACAGTGGGGG - Intronic
1042636178 8:70877975-70877997 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1042766046 8:72322818-72322840 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1042833633 8:73057570-73057592 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1042970250 8:74400879-74400901 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1043036480 8:75206650-75206672 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1043089026 8:75874704-75874726 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1043123621 8:76361794-76361816 TATAAGCTAGAAGAGAGTGAGGG + Intergenic
1043191065 8:77223957-77223979 TATAAGTCAGAAGAGATTGGGGG - Intergenic
1043212990 8:77549298-77549320 TATAAGCCATAAGAGATTGGGGG - Intergenic
1043223663 8:77698027-77698049 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1043227585 8:77750803-77750825 TAAAAGCCAGAAGAGATTGGGGG + Intergenic
1043229705 8:77786740-77786762 TGCAAGCCAGAAGAGATTGGGGG - Intergenic
1043304792 8:78781543-78781565 TACAAGCCAGAAGAGATTGGGGG - Intronic
1043363015 8:79498127-79498149 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1043938718 8:86172804-86172826 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1044008928 8:86967532-86967554 TCTGAGATAGAAGACATTGATGG - Intronic
1044042464 8:87386922-87386944 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1044135098 8:88575886-88575908 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1044596852 8:93968153-93968175 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1044793700 8:95873960-95873982 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1044873208 8:96640494-96640516 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1044940056 8:97333468-97333490 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1045083341 8:98652146-98652168 TACAAGCCAGAAGACAGTGGGGG + Intronic
1045087085 8:98698690-98698712 TACAAGCCAGAAGACAGTGGGGG - Intronic
1045090775 8:98740409-98740431 TACAAGCCAGAAGACAGTGGGGG + Intronic
1045104073 8:98874169-98874191 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1045205174 8:100031832-100031854 TATAAGCCAGAAGACAGTGGGGG + Intronic
1045450431 8:102318754-102318776 TACAAGCCAGAAGACAGTGGGGG + Intronic
1045516682 8:102865925-102865947 TGACATCAAGAAGACATTGGAGG + Intronic
1045586701 8:103545691-103545713 TACAAGCTAGAAGAGATTGGGGG + Intronic
1045619103 8:103953416-103953438 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1045647193 8:104310377-104310399 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1045802323 8:106116292-106116314 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1045954793 8:107894205-107894227 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1045969226 8:108060849-108060871 TACAAGCCAGAAGACAGTGGGGG + Intronic
1046047776 8:108984890-108984912 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1046276168 8:111963435-111963457 TACAAGCCAGAAGAGATTGGAGG - Intergenic
1046422521 8:114004615-114004637 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1046454702 8:114442421-114442443 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1046702903 8:117420469-117420491 TACAAGCTAGAAGATATTGGGGG + Intergenic
1046734955 8:117767042-117767064 TGTAAGCTCTAAGATAGTGGGGG - Intergenic
1046895333 8:119465325-119465347 TATAAGCCAAAAGAGATTGGGGG + Intergenic
1047159408 8:122360673-122360695 TACAAGCCAGAAGAGATTGGAGG - Intergenic
1047168737 8:122468552-122468574 TACAAGCCAGAAGACATTGGGGG + Intergenic
1047604307 8:126459060-126459082 TATAAGCCAGAAGAAAGTGGGGG + Intergenic
1047656631 8:126984760-126984782 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1048092113 8:131252136-131252158 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1048101838 8:131360628-131360650 TACAAGCTAGAAGAGGTTGGGGG - Intergenic
1048173261 8:132129007-132129029 TGTATCCTAGAAGAGATTAGCGG + Exonic
1049486133 8:142864065-142864087 TACAAGCCAGAAGAGATTGGGGG - Intronic
1049493877 8:142919908-142919930 TGCAAGCAAGAAGACAGTGGAGG - Intergenic
1049506839 8:143006917-143006939 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1050185933 9:2973479-2973501 TGCAGGCCAGAAGGCATTGGTGG + Intergenic
1050201015 9:3146217-3146239 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1050215148 9:3314187-3314209 TACAAGCCAGAAGACAGTGGGGG + Intronic
1050294448 9:4190848-4190870 TACAAGCCAGAAGACAGTGGGGG + Intronic
1050311419 9:4356835-4356857 TGTAATCTTGCAAACATTGGTGG - Intergenic
1050675809 9:8051899-8051921 TGCAAGCCAGAAGAGATTGGGGG - Intergenic
1050878574 9:10672632-10672654 TATCAGCTAGAAGAGATTGTGGG - Intergenic
1050928339 9:11295089-11295111 TGCAAGCCAGAAGAGACTGGGGG - Intergenic
1050960435 9:11723005-11723027 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1050966495 9:11810551-11810573 TGTAAGACAGAAGAGATTGGGGG - Intergenic
1051110436 9:13628962-13628984 TCCAAGCCAGAAGAGATTGGGGG + Intergenic
1051142859 9:13996575-13996597 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1051320948 9:15904341-15904363 TACAAGCCAGAAGACAGTGGGGG + Intronic
1051458917 9:17292125-17292147 TACAAGCGAGAAGAGATTGGGGG - Intronic
1051674349 9:19544752-19544774 TACAAGCTAGAAGAGAGTGGGGG - Intronic
1051917374 9:22224656-22224678 TATGAGCCAGAAGACAGTGGGGG - Intergenic
1052009968 9:23396008-23396030 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1052116789 9:24658474-24658496 TGTAAGCTAGAAGATAGTGGAGG - Intergenic
1052150046 9:25103801-25103823 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1052176579 9:25470713-25470735 TAGAAGCCAGAAGAGATTGGGGG - Intergenic
1052250557 9:26392697-26392719 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1052382136 9:27783533-27783555 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1052410504 9:28116240-28116262 TACAAGCCAGAAGACAGTGGGGG - Intronic
1052425692 9:28301893-28301915 TACAAGCCAGAAGAGATTGGGGG + Intronic
1052506483 9:29360209-29360231 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1052694265 9:31855583-31855605 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1053039218 9:34855601-34855623 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1053088439 9:35249681-35249703 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1053214471 9:36258890-36258912 TGACTGCTAGAAGACACTGGTGG + Intronic
1053531015 9:38880846-38880868 TAGAAGCCAGAAGAGATTGGGGG + Intergenic
1053671289 9:40366319-40366341 TGAAAGCAAGAAGAGAGTGGGGG + Intergenic
1053672140 9:40376867-40376889 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1053678901 9:40466273-40466295 CATAAGCCAGAAGAAATTGGGGG + Intergenic
1053726436 9:41006628-41006650 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1053921099 9:42992694-42992716 TGAAAGCAAGAAGAGAGTGGGGG + Intergenic
1053921956 9:43003225-43003247 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1053928884 9:43094626-43094648 CATAAGCCAGAAGAAATTGGGGG + Intergenic
1054203239 9:62105278-62105300 TAGAAGCCAGAAGAGATTGGGGG + Intergenic
1054284822 9:63158670-63158692 CATAAGCCAGAAGAAATTGGGGG - Intergenic
1054291979 9:63301811-63301833 CATAAGCCAGAAGAAATTGGGGG + Intergenic
1054382403 9:64506375-64506397 TGAAAGCAAGAAGAGAGTGGGGG + Intergenic
1054383255 9:64516911-64516933 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1054389999 9:64606353-64606375 CATAAGCCAGAAGAAATTGGGGG + Intergenic
1054505717 9:65910022-65910044 CATAAGCCAGAAGAAATTGGGGG - Intergenic
1054512483 9:65999443-65999465 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1054635123 9:67483086-67483108 TAGAAGCCAGAAGAGATTGGGGG - Intergenic
1054890160 9:70242118-70242140 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1055168434 9:73224922-73224944 TACAAGCCAGAAGAAATTGGAGG + Intergenic
1055225196 9:73986575-73986597 TTCAAGCCAGAAGAGATTGGGGG + Intergenic
1055232292 9:74079881-74079903 TTTAAGCCAGAAGATATTAGGGG + Intergenic
1055341387 9:75287757-75287779 TAAAAGCCAGAAGAGATTGGGGG - Intergenic
1055343132 9:75307284-75307306 TACAAGCCAGAAGAAATTGGAGG - Intergenic
1055344925 9:75326003-75326025 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1055373175 9:75622653-75622675 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1055388150 9:75787138-75787160 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1055494944 9:76844671-76844693 TGGGAGGTAGAAGACATAGGGGG - Intronic
1055531839 9:77192665-77192687 TACAAGCCAGAAGAAATTGGGGG - Intronic
1055541435 9:77309983-77310005 TGGATGGTAGAAGACAATGGAGG + Intronic
1055842900 9:80527312-80527334 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1056001166 9:82217726-82217748 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1056095835 9:83252186-83252208 TACAAGCAAGAAGAGATTGGGGG + Intronic
1056284639 9:85075991-85076013 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1056321104 9:85435225-85435247 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1057495389 9:95556347-95556369 TTTGAGCTAGAAGAAATTGTTGG + Intergenic
1057697815 9:97339484-97339506 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1058074433 9:100636591-100636613 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1058108320 9:101001562-101001584 TGTATGTTTGAAGGCATTGGAGG + Intergenic
1058189072 9:101891169-101891191 TGTGAGTGAGAAGACATTGGGGG + Intergenic
1058558862 9:106202663-106202685 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1058591219 9:106566955-106566977 TACAAGCCAGAAGAGATTGGAGG + Intergenic
1058916354 9:109569804-109569826 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1059004011 9:110382391-110382413 TAAAAGCCAGAAGACATTGGGGG - Intronic
1059076538 9:111198979-111199001 TACAAGCTAGAAGAGATTGGGGG + Intergenic
1059509813 9:114834752-114834774 TATAATCCAGAAGAGATTGGGGG - Intergenic
1059746027 9:117202660-117202682 TACAAGCCAGAAGAGATTGGGGG - Intronic
1059884143 9:118726879-118726901 TATAAGCCAGAAGAAATTGGGGG - Intergenic
1060336775 9:122731356-122731378 TATAAACCAGAAGAGATTGGGGG + Intergenic
1060983401 9:127806637-127806659 TGTAAGACAGATGACATTGTGGG + Intronic
1062709180 9:137964016-137964038 TACAAGCTAGAAGAGATTGGGGG - Intronic
1203417618 Un_KI270363v1:1640-1662 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1203533767 Un_KI270743v1:10843-10865 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1203537555 Un_KI270743v1:55607-55629 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1203554639 Un_KI270743v1:195349-195371 TGCAAGCAAGAAGAGAGTGGGGG + Intergenic
1185952671 X:4453444-4453466 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1186431134 X:9505125-9505147 TACAAGCCAGAAGAGATTGGGGG + Intronic
1186740811 X:12516521-12516543 TGCAAGCCAGAAGAGATTGGGGG - Intronic
1186775671 X:12862622-12862644 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1186832673 X:13405752-13405774 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1186964243 X:14770959-14770981 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1187838270 X:23458200-23458222 TATAAGCCAGAAGATACTGGGGG - Intergenic
1188035899 X:25317256-25317278 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1188037727 X:25337753-25337775 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1188061266 X:25604838-25604860 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1188147166 X:26628446-26628468 TATAAGCCAGAAGAGGTTGGGGG - Intergenic
1188201888 X:27301341-27301363 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1188362419 X:29272479-29272501 TACAAGCCAGAAGAGATTGGGGG - Intronic
1188455073 X:30355017-30355039 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1188645517 X:32561856-32561878 TATAAGCCAGTAGAGATTGGGGG + Intronic
1188779839 X:34268412-34268434 TGGAAGCTTGAAGACACTGTGGG - Intergenic
1188828580 X:34867988-34868010 TATAAGCCAGAAGAGATTGAAGG + Intergenic
1188851379 X:35136858-35136880 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1188854764 X:35180035-35180057 AGTAAACTATAAAACATTGGTGG + Intergenic
1188871580 X:35380062-35380084 TACAAGCCAGAAGACATTAGAGG - Intergenic
1188884541 X:35532886-35532908 CATAAGCCAGAAGAGATTGGGGG + Intergenic
1188900925 X:35732723-35732745 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1188915263 X:35903176-35903198 TGCAAGCCAGAAGAGAGTGGAGG - Intergenic
1189557509 X:42161106-42161128 TACAAGCCAGAAGAAATTGGGGG - Intergenic
1189653298 X:43212884-43212906 TAGAAGCCAGAAGAGATTGGGGG + Intergenic
1189665251 X:43348426-43348448 CACAAGCTAGAAGACATTGGGGG - Intergenic
1189668451 X:43382252-43382274 TATAAGCTAGAAGAGATTTGGGG + Intergenic
1190134567 X:47783633-47783655 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1190751746 X:53368047-53368069 TGGAAGATAGAAGTCAATGGAGG + Intergenic
1190943766 X:55071375-55071397 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1190971989 X:55358285-55358307 TATAAGCCAGAAGAGATTGGGGG + Intergenic
1190977300 X:55418104-55418126 TATAAGCCAGAAGAGATTAGGGG + Intergenic
1190991303 X:55553421-55553443 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1190997745 X:55627557-55627579 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1191030034 X:55960062-55960084 TGCAAGCCAGAAGACATTGGAGG + Intergenic
1191034560 X:56010277-56010299 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1191043056 X:56106044-56106066 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1191062054 X:56309084-56309106 TATAAGCCAGAAGTGATTGGAGG - Intergenic
1191068124 X:56371928-56371950 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1191072767 X:56419945-56419967 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1191099430 X:56709831-56709853 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1191122806 X:56923742-56923764 TATAATCCAGAAGACATTAGGGG - Intergenic
1191154191 X:57253584-57253606 TAAAAGCCAGAAGAGATTGGGGG + Intergenic
1191206896 X:57843892-57843914 TATAAGCCAGAAGAAAGTGGGGG + Intergenic
1191609495 X:63096592-63096614 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1191704758 X:64083185-64083207 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1191743493 X:64461898-64461920 TGCAAGCCAGAAGAGATTGGTGG - Intergenic
1191754166 X:64576195-64576217 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1191762431 X:64660533-64660555 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1191766386 X:64703524-64703546 TGCAACCCAGAAGAGATTGGGGG - Intergenic
1191768651 X:64731632-64731654 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1191804692 X:65122200-65122222 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1191809340 X:65170360-65170382 TAAAAGCCAGAAGACAGTGGGGG - Intergenic
1191815438 X:65239901-65239923 TGCAAGCAAGAAGAGATGGGGGG - Intergenic
1191827419 X:65380272-65380294 TATAAGCCAGAAGAGAGTGGGGG + Intronic
1191877156 X:65808731-65808753 TACAAGCCAGAAGACATTGGGGG + Intergenic
1191882256 X:65854966-65854988 TGCAAGCCAGAAGAGAGTGGAGG - Intergenic
1191908786 X:66125556-66125578 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1191931167 X:66374966-66374988 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1191956598 X:66649158-66649180 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1191993957 X:67069797-67069819 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1192067496 X:67902182-67902204 TATAAGCCAGAAGACATTGGGGG - Intergenic
1192136345 X:68604060-68604082 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1192256289 X:69462865-69462887 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1192303118 X:69927476-69927498 TACAAGCCAGAAGAGATTGGGGG - Intronic
1192403905 X:70864399-70864421 TACAAGCCAGAAGACAGTGGGGG + Intronic
1192662314 X:73054189-73054211 TCCAAGCCAGAAGACAGTGGGGG + Intergenic
1192701911 X:73482943-73482965 TACAAGCCAGAAGAGATTGGAGG + Intergenic
1192755637 X:74044895-74044917 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1192767557 X:74157682-74157704 TATAAGCCAGAAGAGATTAGGGG + Intergenic
1192910636 X:75600825-75600847 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1192931265 X:75809128-75809150 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1192931991 X:75815993-75816015 TGCAAGCCTGAAGACAGTGGGGG + Intergenic
1192937836 X:75879974-75879996 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1192955987 X:76070483-76070505 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1192976326 X:76289671-76289693 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1192999292 X:76546941-76546963 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1193024939 X:76836556-76836578 TACAAGCCAGAAGACATTTGGGG - Intergenic
1193033686 X:76926172-76926194 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1193048194 X:77075439-77075461 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1193052188 X:77113180-77113202 TGTAAGCCAGAAGAGATAGGGGG + Intergenic
1193088871 X:77472431-77472453 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1193094307 X:77529473-77529495 TGTAAGCCGGAAGAGATTAGGGG + Intronic
1193162495 X:78242891-78242913 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1193164145 X:78262674-78262696 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1193171342 X:78340110-78340132 TATAAGCCAGAAGAGATTTGGGG - Intergenic
1193188677 X:78543903-78543925 TACAAGCCAGAAGACATTAGGGG - Intergenic
1193258939 X:79381907-79381929 TGCAAGGCAGAAGAGATTGGTGG + Intergenic
1193348548 X:80431293-80431315 TGTAAGAGAGAAAAAATTGGGGG + Intronic
1193360707 X:80575327-80575349 TATAAGCCAGAAGAAATTGAGGG - Intergenic
1193376579 X:80768395-80768417 TACAAGCCAGAAGAGATTGGGGG + Intronic
1193398919 X:81019490-81019512 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1193422986 X:81307101-81307123 TAGAAGCCAGAAGAGATTGGGGG - Intergenic
1193435781 X:81473788-81473810 TACAAGCCAGAAGAGATTGGCGG - Intergenic
1193479381 X:82009049-82009071 TAAAAGCCAGAAGACATTGGGGG - Intergenic
1193528283 X:82620395-82620417 TGCAAGCCAGAAGACATTGGAGG + Intergenic
1193593728 X:83420920-83420942 TATAAGCCGGAAGAGATTGGCGG + Intergenic
1193637009 X:83963518-83963540 TACAAGCCAGAAGAGATTGGAGG - Intergenic
1193637472 X:83969663-83969685 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1193685629 X:84573304-84573326 TACAAGCCAGAAGACAGTGGAGG + Intergenic
1193712332 X:84894580-84894602 TGTTGGCCAGAAAACATTGGTGG + Intergenic
1193725996 X:85040224-85040246 TATAAGCCAGAAGAGATTTGGGG - Intronic
1193736331 X:85160979-85161001 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1193762845 X:85488913-85488935 TGTCAGCCAGAAAACACTGGTGG + Intergenic
1193773699 X:85618894-85618916 TACAAGCTAGAAGAGATTGTGGG - Intergenic
1193817756 X:86124713-86124735 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1193844642 X:86454102-86454124 TACAAGCCAGAAGAGATTGGGGG - Intronic
1194085579 X:89523814-89523836 TGCAAGCCAGAAGACATTGGTGG - Intergenic
1194144813 X:90248618-90248640 TGGAAGCCAGAAGAGATTGGGGG + Intergenic
1194158717 X:90424241-90424263 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1194175017 X:90634575-90634597 TATAAGCCAGAAAAGATTGGGGG + Intergenic
1194252031 X:91587695-91587717 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1194263811 X:91732113-91732135 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1194281190 X:91956579-91956601 TACAAGCCAGAAGAGATTGGGGG - Intronic
1194320100 X:92435598-92435620 TGCAAGCCAGAAGAGATTGGGGG + Intronic
1194444777 X:93974484-93974506 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1194485812 X:94484905-94484927 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1194519372 X:94900202-94900224 TACAAGGCAGAAGACATTGGGGG - Intergenic
1194525809 X:94976624-94976646 TACAAGCTAGAAGGGATTGGGGG - Intergenic
1194632123 X:96297677-96297699 TACAATCTAGAAGAGATTGGGGG + Intergenic
1194838482 X:98711610-98711632 TACAAGCCAGAAGAGATTGGAGG - Intergenic
1194851434 X:98874703-98874725 TACAAGCCAGAAGAGATTGGTGG - Intergenic
1194852158 X:98882620-98882642 TAGAAGCCAGAAGAGATTGGGGG + Intergenic
1194854512 X:98913286-98913308 TACAAGCCAGAAGATATTGGGGG - Intergenic
1194867619 X:99087695-99087717 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1194953220 X:100151635-100151657 TGCAGGCCAGAAGAGATTGGGGG - Intergenic
1194962536 X:100251880-100251902 TACAAGCTAGAAGAGATTGGGGG + Intergenic
1195104536 X:101591599-101591621 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1195125918 X:101810014-101810036 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1195140304 X:101952011-101952033 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1195203922 X:102576102-102576124 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1195212932 X:102668169-102668191 TACAAGCCAGAATACATTGGGGG - Intergenic
1195367906 X:104143915-104143937 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1195414860 X:104609178-104609200 TGCAAGCCAGAAGAGAGTGGGGG - Intronic
1195417373 X:104635169-104635191 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1195421077 X:104676426-104676448 TATAAGCCAGAAGAGAGTGGGGG - Intronic
1195440553 X:104894112-104894134 TATAAGCCAGAAGAGAGTGGTGG - Intronic
1195441919 X:104908630-104908652 TACAAGCCAGAAGACAGTGGGGG - Intronic
1195473330 X:105258256-105258278 TACAAGCCAGAAGAGATTGGGGG - Intronic
1195548601 X:106140443-106140465 TACAAGCAAGAAGAAATTGGGGG + Intergenic
1195567664 X:106361896-106361918 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1195580095 X:106492152-106492174 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1195838438 X:109145465-109145487 TACAAGCTAGAAGGAATTGGGGG + Intergenic
1195979167 X:110559757-110559779 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1196054658 X:111341690-111341712 TACAAGCCAGAAGAGATTGGGGG + Intronic
1196152474 X:112390619-112390641 TACAAGTTAGAAGAGATTGGGGG - Intergenic
1196468352 X:115995296-115995318 TTCAAGCCAGAAGACATTGGGGG + Intergenic
1196515326 X:116604543-116604565 TAAAAGCCAGAAGACATTGGGGG - Intergenic
1196600082 X:117591288-117591310 TACAAGCTAGAAGAGAATGGGGG + Intergenic
1196600501 X:117596684-117596706 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1196615324 X:117761507-117761529 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1196770712 X:119290715-119290737 TGTAAACTAGCAGACCCTGGGGG - Intergenic
1196932912 X:120698566-120698588 TATAGGCCAGAAGAGATTGGGGG + Intergenic
1197023019 X:121714758-121714780 TATAAGCCAGAAGAGATTGGGGG - Intergenic
1197076661 X:122362076-122362098 TATAATCCAGAAGAAATTGGGGG - Intergenic
1197077066 X:122364815-122364837 TGTCAGCTAGAGGACATTTGTGG + Intergenic
1197114912 X:122819954-122819976 TGCAAGCCAGAAGAGATTGGGGG + Intergenic
1197191283 X:123650122-123650144 TACAAGCCAGAAGAGATTGGGGG + Intronic
1197356916 X:125446279-125446301 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1197395403 X:125921660-125921682 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1197413651 X:126149252-126149274 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1197476152 X:126928266-126928288 TACAAGCTAGAAGGGATTGGGGG - Intergenic
1197478169 X:126948601-126948623 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1197543130 X:127790579-127790601 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1197564126 X:128060252-128060274 TATATGCCAGAAGAGATTGGGGG + Intergenic
1197601914 X:128541632-128541654 TACAAGCTAGAAGAGATTGGGGG - Intergenic
1197909347 X:131463393-131463415 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1197973006 X:132134424-132134446 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1198067382 X:133112179-133112201 TACAAGCTAGAAGAGAGTGGGGG + Intergenic
1198577744 X:138028302-138028324 TATAAGCCAGGAGAGATTGGGGG + Intergenic
1198620050 X:138497655-138497677 TGGAAGGTAGAATAGATTGGAGG + Intergenic
1198648474 X:138836009-138836031 TGTAAGCTAGAAGACATTGGGGG - Intronic
1198662715 X:138987901-138987923 TGTAACCTACAATACCTTGGAGG + Intronic
1198786181 X:140291021-140291043 TGTAAGCCAGAAGAGATTGGGGG - Intergenic
1199063226 X:143384348-143384370 TATAAGCCAGAATATATTGGAGG - Intergenic
1199098166 X:143766626-143766648 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1199099260 X:143779953-143779975 TATAAGCCAGAAGAGTTTGGGGG - Intergenic
1199120665 X:144049513-144049535 TAAAAGCCAGAAGAGATTGGAGG + Intergenic
1199245743 X:145601516-145601538 TATAAGCCAGAAAATATTGGGGG + Intergenic
1199269896 X:145871324-145871346 TGTAAGCCAGAAGAGATTGGGGG - Intergenic
1199308052 X:146291218-146291240 TACAAGCCAGAAGAAATTGGGGG - Intergenic
1199422069 X:147655413-147655435 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1199484078 X:148329787-148329809 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1199486201 X:148351233-148351255 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1199559651 X:149149294-149149316 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1199913168 X:152309464-152309486 TATAAGCCAGAAGAGATTGGAGG + Intronic
1200148501 X:153939874-153939896 TGTAAGCAAGCAGACCTAGGTGG - Intronic
1200321419 X:155194319-155194341 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1200336442 X:155355517-155355539 TACAAGCCAGAAGAGATTGGGGG + Intergenic
1200343455 X:155423780-155423802 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1200350028 X:155485710-155485732 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1200438224 Y:3179698-3179720 TGCAAGCCAGAAGACATTGGTGG - Intergenic
1200490571 Y:3817922-3817944 TGGAAGCCAGAAGAGATTGGGGG + Intergenic
1200505031 Y:4001208-4001230 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1200521662 Y:4215539-4215561 TATAAGCCAGAAAAGATTGGGGG + Intergenic
1200570962 Y:4828933-4828955 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1200598784 Y:5181243-5181265 TACAAGCCAGAAGAGATTGGGGG - Intronic
1200628220 Y:5548730-5548752 TGCAAGCCAGAAGAGATTGGGGG + Intronic
1200818411 Y:7556865-7556887 TATAAGCCAGAAGAGATTAGGGG + Intergenic
1201072762 Y:10164401-10164423 TACAAGCCAGAAGACAGTGGGGG - Intergenic
1201229239 Y:11847148-11847170 TGTAAGCCAGAAAAGATTGAGGG + Intergenic
1201302579 Y:12522720-12522742 TACAAGCTAGAAGAGAGTGGGGG - Intergenic
1201418706 Y:13775036-13775058 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1201491063 Y:14541620-14541642 TGCAAGCCAGAAGAGAGTGGGGG + Intronic
1201527263 Y:14950226-14950248 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1201545450 Y:15157227-15157249 TACAAGCCAGAAGAGATTGGGGG - Intergenic
1201566537 Y:15370510-15370532 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1201619916 Y:15945293-15945315 TACAAGCTAGAAGAGAGTGGTGG - Intergenic
1201688607 Y:16736430-16736452 TACAAGCTAGAAGAAAGTGGGGG - Intergenic
1201886981 Y:18895565-18895587 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1201892485 Y:18957802-18957824 TATAAGCCAGAAGAGAGTGGGGG + Intergenic
1201908876 Y:19113243-19113265 TGCAAGCCAGAAGAGAATGGAGG - Intergenic
1201923179 Y:19256224-19256246 TACAAGCCAGAAGACAGTGGGGG + Intergenic
1201988128 Y:19992190-19992212 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1202022400 Y:20478954-20478976 TGCAAGCCAGAAGAGAGTGGGGG + Intergenic
1202034569 Y:20619164-20619186 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1202089145 Y:21171099-21171121 TGCAAGCCAGAAGAGAGTGGGGG - Intergenic
1202170945 Y:22042724-22042746 TGAAAGCCAGAAGAGAGTGGGGG + Intergenic
1202220417 Y:22543649-22543671 TGAAAGCCAGAAGAGAGTGGGGG - Intergenic
1202250950 Y:22872233-22872255 TGCAAGTCAGAAGACATTGGGGG + Intergenic
1202298178 Y:23382761-23382783 TATAAGCCAGAAGAGAGTGGGGG - Intergenic
1202322696 Y:23652014-23652036 TGAAAGCCAGAAGAGAGTGGGGG + Intergenic
1202403939 Y:24505982-24506004 TGCAAGTCAGAAGACATTGGGGG + Intergenic
1202466840 Y:25164100-25164122 TGCAAGTCAGAAGACATTGGGGG - Intergenic
1202548077 Y:26018042-26018064 TGAAAGCCAGAAGAGAGTGGGGG - Intergenic
1202572630 Y:26287838-26287860 TATAAGCCAGAAGAGAGTGGGGG + Intergenic