ID: 1198651068

View in Genome Browser
Species Human (GRCh38)
Location X:138864468-138864490
Sequence CCATTCACAGCAGGCCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198651068_1198651081 17 Left 1198651068 X:138864468-138864490 CCTCAGGGGCCTGCTGTGAATGG No data
Right 1198651081 X:138864508-138864530 ACCGAAGTCCTGGCCCAGGTGGG No data
1198651068_1198651075 7 Left 1198651068 X:138864468-138864490 CCTCAGGGGCCTGCTGTGAATGG No data
Right 1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG No data
1198651068_1198651080 16 Left 1198651068 X:138864468-138864490 CCTCAGGGGCCTGCTGTGAATGG No data
Right 1198651080 X:138864507-138864529 AACCGAAGTCCTGGCCCAGGTGG No data
1198651068_1198651078 13 Left 1198651068 X:138864468-138864490 CCTCAGGGGCCTGCTGTGAATGG No data
Right 1198651078 X:138864504-138864526 GCCAACCGAAGTCCTGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198651068 Original CRISPR CCATTCACAGCAGGCCCCTG AGG (reversed) Intronic