ID: 1198651073

View in Genome Browser
Species Human (GRCh38)
Location X:138864477-138864499
Sequence CCCCACCTGCCATTCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198651073_1198651087 26 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651087 X:138864526-138864548 GTGGGAACGAGAAGCAAAAAGGG No data
1198651073_1198651088 27 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651088 X:138864527-138864549 TGGGAACGAGAAGCAAAAAGGGG No data
1198651073_1198651086 25 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651086 X:138864525-138864547 GGTGGGAACGAGAAGCAAAAAGG No data
1198651073_1198651078 4 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651078 X:138864504-138864526 GCCAACCGAAGTCCTGGCCCAGG No data
1198651073_1198651081 8 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651081 X:138864508-138864530 ACCGAAGTCCTGGCCCAGGTGGG No data
1198651073_1198651080 7 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651080 X:138864507-138864529 AACCGAAGTCCTGGCCCAGGTGG No data
1198651073_1198651089 30 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651089 X:138864530-138864552 GAACGAGAAGCAAAAAGGGGAGG No data
1198651073_1198651075 -2 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198651073 Original CRISPR CCCCACCTGCCATTCACAGC AGG (reversed) Intronic