ID: 1198651075

View in Genome Browser
Species Human (GRCh38)
Location X:138864498-138864520
Sequence GGCCCAGCCAACCGAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198651073_1198651075 -2 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 232
1198651068_1198651075 7 Left 1198651068 X:138864468-138864490 CCTCAGGGGCCTGCTGTGAATGG 0: 1
1: 0
2: 4
3: 22
4: 211
Right 1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198651075 Original CRISPR GGCCCAGCCAACCGAAGTCC TGG Intronic
900410439 1:2510222-2510244 AGCCCAGCCACTCGAAGGCCGGG - Intronic
901272828 1:7966245-7966267 GGCCCAGGGAACCGCACTCCAGG - Intronic
902896481 1:19484009-19484031 GGCCCTTCCAACCTAAGTGCTGG + Intronic
902963175 1:19978900-19978922 CTCCCATCCAACCTAAGTCCAGG + Intronic
904161872 1:28528068-28528090 GCCTCAGCCTCCCGAAGTCCTGG - Intronic
904691313 1:32295162-32295184 GCCCCAGCCTACCAAAGTACTGG - Intronic
905012137 1:34754994-34755016 GGCCCAGCCAATGGCAGTGCAGG + Intronic
905140218 1:35837627-35837649 GGCTCAGCCTCCCGAAGTGCTGG + Intronic
905678843 1:39851691-39851713 GCCTCAGCCTACCGAAGTGCTGG - Intronic
905823962 1:41015509-41015531 GGCCCAGCCCACCTCTGTCCAGG - Intergenic
906047512 1:42843277-42843299 GGGCCAGGCGACTGAAGTCCAGG - Exonic
907156203 1:52336606-52336628 GGCTCAGCCTCCCGAAGTGCTGG + Intronic
907422280 1:54355596-54355618 GGCTCAGCCTCCCGAAGTGCTGG + Intronic
908792726 1:67798704-67798726 ACCTCAGCCAACCGAAGTGCTGG - Intronic
909724862 1:78822086-78822108 GCCCCAGCCTCCCGAAGTGCTGG + Intergenic
912525797 1:110281728-110281750 GGCCCAGCCTGCAGAGGTCCAGG + Intronic
912662930 1:111549900-111549922 GTCCCAGCCTACCAAAGTGCTGG + Intronic
913005298 1:114624555-114624577 GCCCCAGCCACCCAAAGTGCTGG + Intronic
914437235 1:147670682-147670704 GGCCCAGCCAGCCGTTTTCCAGG + Intergenic
914805780 1:150990595-150990617 GCCTCAGCCTACCAAAGTCCTGG - Intronic
919238930 1:194886350-194886372 GGCCCAGCCTCCCAAAGTGCTGG - Intergenic
920150699 1:203904965-203904987 GCCTCAGCCTCCCGAAGTCCTGG - Intergenic
921459284 1:215410083-215410105 GCCCCAGCCACCCAAAGTGCTGG + Intergenic
922468953 1:225863665-225863687 GGCTCAGCCTCCCGAAGTGCTGG - Intronic
922499163 1:226083862-226083884 GGCCCAGCCATGCGAACGCCTGG + Intergenic
1062913434 10:1229319-1229341 GCCCCAGCCACCCGAGGCCCAGG - Intronic
1063660514 10:8032719-8032741 GCCTCAGCCTACCGAAGTGCTGG - Intergenic
1065711343 10:28521368-28521390 GCCCCAGCCTCCCGAAGTGCTGG + Intergenic
1066602634 10:37125047-37125069 CGCTCAGCCTTCCGAAGTCCTGG + Intergenic
1067227793 10:44386665-44386687 GGCCCAGCCCAGCAAAGGCCTGG - Intergenic
1067608289 10:47686459-47686481 GCCTCAGCCTCCCGAAGTCCTGG + Intergenic
1068644989 10:59455946-59455968 GCCTCAGCCTCCCGAAGTCCTGG + Intergenic
1069756819 10:70778654-70778676 GGTCCTGCCAACTGAAGTCAGGG + Intronic
1069972772 10:72187469-72187491 GGCCCAGCCTCCCAAAGTGCTGG - Intronic
1070769810 10:79075663-79075685 GGGCCAGGCAGCCGGAGTCCTGG - Intronic
1070810745 10:79296589-79296611 TGCCCAGCCAGCCGAGCTCCGGG + Exonic
1072828740 10:98635529-98635551 GCCCCAGCCACCCAAAGTGCAGG - Intronic
1073206267 10:101770955-101770977 GGGCCAGGGAACCGAAGTCCTGG - Intronic
1075037594 10:119082075-119082097 GCCCCAGCCACCCAAAGTGCTGG - Intergenic
1076110550 10:127856136-127856158 GGCCCAGCAAGCCCAGGTCCAGG + Intergenic
1076409016 10:130232706-130232728 GGCCCAGCCCAGGGCAGTCCAGG + Intergenic
1076564945 10:131392232-131392254 GGCCCAGGCATCTGGAGTCCAGG + Intergenic
1077023587 11:430357-430379 AGCCCAGCCAGACGAAGTACAGG + Exonic
1077303565 11:1858003-1858025 GCCCCAGCCTCCCAAAGTCCTGG + Intronic
1077355963 11:2117479-2117501 GCCTCAGCCACCCGAAGTGCTGG + Intergenic
1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG + Exonic
1079020996 11:16908743-16908765 GGCTCAGCCTCCCGAAGTGCTGG + Intronic
1080706394 11:34699022-34699044 GCCCCAGCCTCCCGAAGTGCTGG - Intergenic
1083351345 11:62031198-62031220 GCACCAGCCAACCCAAGTGCAGG + Intergenic
1083426139 11:62587428-62587450 GCCCCAGCCTACCAAAGTGCTGG + Intronic
1083453737 11:62763989-62764011 GGCTCAGCCACCCAAAGTGCTGG + Intronic
1084597562 11:70126085-70126107 CGCCCAGCCAGGCGAAGTACAGG - Exonic
1085461708 11:76698001-76698023 GGCTCAGCCTCCCAAAGTCCTGG + Intergenic
1088430392 11:109752229-109752251 GCCTCAGCCAACCGAAGTGCTGG + Intergenic
1089964761 11:122646887-122646909 GGCACAGACAATCGAAGGCCAGG + Intergenic
1091248387 11:134119920-134119942 AGCACAGCCAGCTGAAGTCCTGG - Intronic
1093048095 12:14474646-14474668 GCCTCAGCCAACCAAAGTACTGG + Intronic
1096323179 12:50633527-50633549 GCCTCAGCCAACCAAAGTGCTGG - Intronic
1099767842 12:87012424-87012446 GCCTCAGCCTCCCGAAGTCCTGG - Intergenic
1100471000 12:94892831-94892853 ACCACAGCCCACCGAAGTCCTGG - Intergenic
1100493656 12:95104690-95104712 AGCTCAGCCTCCCGAAGTCCTGG + Intronic
1103485532 12:121280113-121280135 GGCTCAGCCAGCCAAAGTCAGGG + Intronic
1104873026 12:132014279-132014301 GCCACAGCCGACCCAAGTCCTGG - Intronic
1105010498 12:132753058-132753080 GGCTCAGCCTCCCGAAGTGCTGG - Intronic
1108648743 13:52455363-52455385 GGCCCCGGCAACTGCAGTCCAGG + Intergenic
1109801683 13:67387501-67387523 GTACCAGCCAAAAGAAGTCCAGG + Intergenic
1109962518 13:69649622-69649644 GCCCCAGCCACCCAAAGTGCTGG + Intergenic
1113907677 13:113827542-113827564 GGTCCAGCCAGGCAAAGTCCCGG + Intronic
1113970234 13:114183029-114183051 AGCCCATCCAAGAGAAGTCCAGG - Intergenic
1114471174 14:22963682-22963704 GCCTCAGCCTCCCGAAGTCCTGG + Intronic
1115179983 14:30612606-30612628 GCCCCAGCCTCCCGAAGTGCTGG - Intronic
1121456051 14:94039469-94039491 GGCCCAGCCAGCTGAATGCCTGG - Intronic
1122056723 14:99103673-99103695 GGCTCAGCCTCCCGAAGTGCTGG + Intergenic
1122544685 14:102515835-102515857 GTCTCAGCCTACCGAAGTGCTGG - Intergenic
1122805300 14:104253435-104253457 GGCCCAGCCACCCCTAGGCCTGG + Intergenic
1122930961 14:104932940-104932962 AGCCCTGCCAAACGCAGTCCTGG - Exonic
1123753055 15:23373360-23373382 CGCTCGGCCATCCGAAGTCCTGG + Intergenic
1124066005 15:26344484-26344506 GCCTCAGCCAACCAAAGTGCTGG - Intergenic
1124972028 15:34496801-34496823 GGCCCAGGCATCCGCAGCCCAGG - Intergenic
1127974501 15:63987221-63987243 GGCCCAGCCAACCCAAGGGCAGG + Intronic
1128434493 15:67632347-67632369 GTCTCAGCCACCCGAAGTCCTGG + Intronic
1128452104 15:67811628-67811650 GCCCCAGCCTCCCGAAGTGCTGG - Intergenic
1129001882 15:72342195-72342217 AGCCCAGCCTAGCCAAGTCCAGG - Exonic
1129041688 15:72692560-72692582 GCCTCAGCCTACCGAAGTGCTGG + Intronic
1129909055 15:79211094-79211116 AGCCCAGCCAATCTAAGTGCTGG - Intergenic
1132545056 16:529076-529098 GGCACACCCAACCCAAGGCCAGG - Intronic
1132870717 16:2114639-2114661 CGCCCAGGCAGCCGCAGTCCAGG + Exonic
1132953455 16:2578144-2578166 GGCCGAGCAACCCGAAGGCCGGG - Intronic
1132960897 16:2622024-2622046 GGCCGAGCAACCCGAAGGCCGGG + Intergenic
1133090660 16:3401391-3401413 GGCCCAGCCAGCCCCAGGCCTGG - Intronic
1135378958 16:21977102-21977124 GCCCCAGCCTCCCAAAGTCCTGG - Intronic
1138548484 16:57734436-57734458 GCCCCAGCCTCCCGAAGTGCTGG - Intergenic
1139417166 16:66822319-66822341 GCCTCAGCCACCCAAAGTCCTGG - Intronic
1139875380 16:70141848-70141870 GCCCCAGCCTCCCGAAGTGCTGG - Intronic
1140441923 16:74994541-74994563 CGCCCAGCCTACCTAAGTGCTGG + Intronic
1140513330 16:75524246-75524268 GTCCCAGCCTCCCGAAGTGCTGG + Intergenic
1142900093 17:3006377-3006399 GGCCCAGCCTCCCAAAGTGCCGG + Intronic
1143162885 17:4882869-4882891 GCCCCAGCCTCCCGAAGTGCTGG - Intronic
1143858557 17:9871116-9871138 GTCCCAGCCTCCCAAAGTCCTGG - Intronic
1147561094 17:41509676-41509698 GGCCCAGAATACTGAAGTCCAGG + Intergenic
1148374869 17:47133998-47134020 GTCCCAGCCTACCAAAGTGCCGG + Intronic
1148575645 17:48709101-48709123 AGCCAAGCCAAGAGAAGTCCAGG + Intergenic
1148766942 17:50045089-50045111 GGGCCCGCCAAGCAAAGTCCTGG + Intergenic
1148825856 17:50393567-50393589 GGTCCATCCTACCCAAGTCCTGG + Intronic
1150363570 17:64560709-64560731 GCCCCAGCCTTCCGAAGTGCTGG - Intronic
1150417558 17:64999715-64999737 GCCTCAGCCACCCGAAGTGCTGG - Intergenic
1151299322 17:73211204-73211226 GCCTCAGCCAACCAAAGTGCTGG - Intronic
1155225536 18:23726219-23726241 GGCCCAGGCAGCTGAAATCCAGG + Intronic
1156812904 18:41274079-41274101 GGCCCAGCCTGCCTATGTCCAGG + Intergenic
1157668883 18:49511801-49511823 GCCCCAGCCACCCGAAGTGCTGG + Intergenic
1157964512 18:52192698-52192720 GCCTCAGCCACCCGAAGTGCCGG + Intergenic
1158345887 18:56516957-56516979 GAGCCAGCCACCTGAAGTCCTGG - Intergenic
1158943138 18:62424782-62424804 GCCTCAGCCTACCGAAGTGCTGG - Intergenic
1159102358 18:63970644-63970666 GGCCCCGCCACCCGCACTCCCGG - Intronic
1159171637 18:64776847-64776869 GGCTCAGCCTCCCTAAGTCCTGG - Intergenic
1159273327 18:66182294-66182316 GCCTCAGCCACCCGAAGTGCTGG - Intergenic
1161377133 19:3945572-3945594 GCCTCAGCCACCCAAAGTCCTGG - Intergenic
1164275776 19:23716580-23716602 GCCTCAGCCAACCAAAGTGCTGG - Intergenic
1164630676 19:29759670-29759692 AGCCCTCCCCACCGAAGTCCCGG - Intergenic
1164952088 19:32345529-32345551 GGCCCCGCCTACCGGCGTCCCGG - Intergenic
1164980602 19:32610863-32610885 GCCCCAGCCTCCCAAAGTCCTGG - Intronic
1165833441 19:38740891-38740913 CCCCCACCAAACCGAAGTCCTGG - Intronic
1165860634 19:38907440-38907462 GGCCCAGGCAGCCGATGTGCTGG + Exonic
1166093335 19:40524253-40524275 GTCTCAGCCTACCGAAGTGCTGG - Intronic
1167895914 19:52580872-52580894 GTCTCAGCCTCCCGAAGTCCTGG - Intronic
1167936576 19:52913571-52913593 GGCTCAGCCTCCCAAAGTCCTGG + Intergenic
1168092838 19:54096877-54096899 GTCCCAGCCCAGCGATGTCCTGG - Exonic
1168511843 19:56979746-56979768 GGCCCATCCATCTGAGGTCCTGG - Intergenic
1168511881 19:56979862-56979884 GGCCCATCCATCTGAGGTCCTGG - Intergenic
1168511901 19:56979920-56979942 GGCCCATCCATCGGAGGTCCTGG - Intergenic
926430269 2:12778508-12778530 GGCCCAGAGAGCCAAAGTCCGGG + Intergenic
927003543 2:18824517-18824539 GGCCAAACCTACTGAAGTCCTGG + Intergenic
931384930 2:61789974-61789996 GACTCAGCCTACCGAAGTGCTGG - Intergenic
932792598 2:74668877-74668899 GCCCCAGCCTCCCAAAGTCCTGG + Intronic
933823872 2:86140827-86140849 GCCTCAGCCTCCCGAAGTCCTGG - Exonic
937244545 2:120484111-120484133 GGCCCACCCTACTGAAGCCCAGG - Intergenic
941113160 2:161440086-161440108 GGCCCAGTGACCAGAAGTCCAGG - Intronic
941979029 2:171434544-171434566 GGCCCAGCCTACCCAGGGCCCGG + Exonic
944555382 2:200883201-200883223 GCCTCAGCCACCCGAAGTGCTGG + Intronic
944760070 2:202806077-202806099 GGCTCAGCCTCCCGAAGTGCTGG - Intronic
946766008 2:223041655-223041677 GGCCCAACCCACAGAAATCCTGG - Intergenic
1169254681 20:4087755-4087777 GTCCCAGCCTACCAAAGTACTGG - Intergenic
1171122675 20:22579843-22579865 CGCCCAGCCAGCAGATGTCCTGG + Intergenic
1172737890 20:37142036-37142058 GCCTCAGCCAACCAAAGTGCTGG + Intronic
1172960997 20:38799546-38799568 GGCCCAACCAACAGAAGAGCAGG - Intergenic
1173520004 20:43692298-43692320 TGCCCAGCCCACGGAAGGCCAGG + Exonic
1175821011 20:61908848-61908870 GGCCCAGCCACCTGCAGCCCTGG + Intronic
1177419333 21:20835968-20835990 GCCTCAGCCACCCGAAGTGCTGG - Intergenic
1178846930 21:36181789-36181811 GGCCCAGCCCACCCAAATCACGG - Intronic
1178860540 21:36285538-36285560 GGCCCAGCCCCCCTGAGTCCTGG + Intronic
1178900609 21:36595224-36595246 GCCTCAGCCTCCCGAAGTCCTGG + Intergenic
1179801808 21:43814726-43814748 GCCCCAGCCAGCCCAACTCCAGG - Intergenic
1180754804 22:18153695-18153717 GCCTCAGCCAACCAAAGTGCTGG + Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181691334 22:24563116-24563138 GGCCCAGCCTCCCAAAGTGCTGG - Intronic
1183334726 22:37240134-37240156 AGCCCAGCCCACCCAAGTCTGGG + Intronic
1183667405 22:39253721-39253743 GGCCCTGCCCACTGCAGTCCCGG - Intergenic
1184486267 22:44781772-44781794 GCCTCAGCCACCCGAAGTGCTGG + Intronic
1184785080 22:46667758-46667780 GGCCCAGCCAATGGGAGCCCTGG - Intronic
1184992713 22:48181728-48181750 GCCCCAGCCAGCCTAAGACCAGG + Intergenic
950404029 3:12793488-12793510 GCCTCAGCCTACCGAAGTGCTGG - Intergenic
950681189 3:14586141-14586163 GGCCCAACCAAGGGAAGACCTGG - Intergenic
954420032 3:50413892-50413914 GGCCCTGGCAACCGAAACCCTGG - Intronic
954566036 3:51600850-51600872 GTCCCAGCCACCCGAATTGCTGG - Intronic
954877506 3:53811748-53811770 GGCCCACCCAACTGAAGGCATGG + Exonic
955967150 3:64400207-64400229 GGCTCAGCCTCCCAAAGTCCTGG - Intronic
958872844 3:99581402-99581424 AGCTCAGCCTCCCGAAGTCCTGG + Intergenic
961244075 3:125436410-125436432 GGCTCAGCCTCCCGAAGTGCTGG + Intergenic
962509002 3:136079654-136079676 GCCTCAGCCTCCCGAAGTCCTGG + Intronic
965107318 3:164373450-164373472 GCCCCAGCCTCCCGAAGTGCTGG - Intergenic
966345001 3:178969518-178969540 GGGCCAACCAACAGTAGTCCCGG + Intergenic
966589059 3:181659929-181659951 GTCCCAGCCTACCAAAGTGCTGG - Intergenic
968348179 3:198029425-198029447 GCCTCAGCCAACCAAAGTGCTGG - Intronic
970783158 4:19763979-19764001 GGCCCAGCCAAGAAAAGCCCAGG - Intergenic
973533888 4:51861386-51861408 GGCCCAGCTCACCGAAGTCCTGG + Intronic
973776986 4:54252535-54252557 AGCCCAGACAACCCAAGTGCAGG - Intronic
975578192 4:75883878-75883900 GTCCCAGCCTCCCGAAGTGCTGG - Intronic
976583421 4:86767180-86767202 GCCCCAGCCTACCAAAGTGCTGG + Intronic
977114604 4:93007789-93007811 GGCCCAGCCTCCCAAAGTGCTGG - Intronic
979468725 4:121071379-121071401 GGTCGGGCCAACCGAACTCCCGG + Intronic
985543900 5:499822-499844 GGCCCAGCCACTCCCAGTCCAGG + Intronic
986077270 5:4350928-4350950 GGGCCAACCAACCGTAGTCTGGG - Intergenic
986201626 5:5584515-5584537 GGACCAGCCAAGAGATGTCCAGG + Intergenic
987443396 5:17985402-17985424 GCCTCAGCCAACCAAAGTGCTGG + Intergenic
988775886 5:34477819-34477841 GGGCCAGGCAACCAAAGCCCAGG + Intergenic
988792178 5:34619125-34619147 GCCTCAGCCAACCAAAGTGCTGG - Intergenic
991276553 5:64854303-64854325 GGCCCAGCAATCCCAAGTCTAGG - Intronic
991584690 5:68189980-68190002 GGCCCAGCCAAGGTAAGACCAGG + Exonic
991733210 5:69608740-69608762 GTCCCAGCCTCCCGAAGTTCTGG + Intergenic
991809645 5:70463886-70463908 GTCCCAGCCTCCCGAAGTTCTGG + Intergenic
991861743 5:71019111-71019133 GTCCCAGCCTCCCGAAGTTCTGG - Intronic
992734032 5:79700993-79701015 GCCTCAGCCTCCCGAAGTCCTGG - Intronic
996062924 5:119051796-119051818 GCCCCAGCCTCCCAAAGTCCTGG - Intronic
996153629 5:120071184-120071206 GCCTCAGCCTCCCGAAGTCCCGG - Intergenic
997304108 5:132825837-132825859 GCCGCAGCCAACAGAGGTCCCGG - Exonic
998258670 5:140610446-140610468 GCCTCAGCCAACCAAAGTGCTGG + Intergenic
999231799 5:150066063-150066085 GGCCCAGCCCACCCACCTCCAGG - Intronic
999365861 5:151023045-151023067 GCCCCAGCCAGCCAGAGTCCTGG + Intronic
999410963 5:151349430-151349452 GGCCCAGGCATCCGAAGCCCTGG + Intergenic
1002143079 5:177156564-177156586 GCCTCAGCCACCCAAAGTCCTGG - Intronic
1002606675 5:180387396-180387418 GCCTCAGCCAACCAAAGTGCTGG - Intergenic
1003595745 6:7472672-7472694 GTCCCAGCCTCCCAAAGTCCTGG + Intergenic
1004643290 6:17536066-17536088 AGCCCAGCCACCCAAAGTGCTGG + Intronic
1011702265 6:89966825-89966847 GCCCCAGCAACCTGAAGTCCTGG - Intronic
1012007070 6:93726462-93726484 GCCTCAGCCAACCAAAGTGCTGG - Intergenic
1013763088 6:113541132-113541154 GGCTCAGCCTACCAAAGTACTGG - Intergenic
1014756933 6:125311620-125311642 GCCTCAGCCTACCAAAGTCCTGG + Intergenic
1018085766 6:160300202-160300224 GCCCCAGCCTTCAGAAGTCCTGG + Intergenic
1018779008 6:167045370-167045392 GGCCCAGCCTCCCAAAGTGCTGG + Exonic
1018981988 6:168608190-168608212 GGCCCACCCAGCCAAAGCCCGGG + Exonic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1021709587 7:23401857-23401879 GTCTCAGCCAACCAAATTCCTGG - Intronic
1023423229 7:40006562-40006584 GCCTCAGCCAACCAAAGTGCTGG - Intronic
1024311245 7:47971315-47971337 GGCTCAGCCATCCTCAGTCCTGG - Intronic
1026334771 7:69384159-69384181 GCCTCAGCCTACCGAAGTGCTGG - Intergenic
1026706853 7:72701511-72701533 GTCCCAGCCTCCCGAAGTGCTGG + Intronic
1029231818 7:99076152-99076174 GCCACAGCCTACCGAAGTGCTGG + Intronic
1029236765 7:99126406-99126428 GCCTCAGCCAACCAAAGTGCTGG - Intronic
1032234826 7:130111452-130111474 GCCCCAGCCATCCAAAGTGCTGG - Intronic
1038094610 8:24293949-24293971 GGCCCAGCAGGCGGAAGTCCTGG - Intergenic
1041766194 8:61420717-61420739 GCCTCAGCCTACCGAAGTGCTGG - Intronic
1041925879 8:63235811-63235833 GTCTCAGCCACCCAAAGTCCTGG - Intergenic
1044551242 8:93514846-93514868 GCCCCAGCCAACTGCAATCCTGG + Intergenic
1044991565 8:97800860-97800882 GCCCCGGCCTCCCGAAGTCCTGG - Intronic
1046935332 8:119879892-119879914 GCCTCAGCCTACCAAAGTCCTGG - Intronic
1047468695 8:125145634-125145656 AGCCCTGCCAAGCGAAGTCTGGG - Intronic
1051933993 9:22422271-22422293 GACCCAGCCTCCCGAAGTGCTGG + Intergenic
1056969654 9:91191698-91191720 GGGCCAGCCATCCCAAGTCTAGG + Intergenic
1058089388 9:100787261-100787283 GCCTCAGCCTACCGAAGTGCTGG - Intergenic
1061826789 9:133262846-133262868 GGCTCAGCCTCCCAAAGTCCTGG - Intronic
1062115144 9:134804721-134804743 GCCCAATCCAACCCAAGTCCAGG + Intronic
1185789268 X:2916238-2916260 GGCTCAGCCTCCCGAAGTGCTGG - Intronic
1187728062 X:22224230-22224252 GCCCCAGCCTCCCGAAGTGCTGG + Intronic
1192234970 X:69289876-69289898 GGCCCAGCCTACCCAAGCTCTGG + Intergenic
1192400645 X:70831375-70831397 GCCCCAGCCACCCAAAGTACTGG - Intronic
1195133736 X:101881701-101881723 GCCCCAGCCACCCAAAGTGCTGG + Intergenic
1196512692 X:116531014-116531036 GGCCCAACCAAAAAAAGTCCAGG + Intergenic
1197538528 X:127723917-127723939 GCCCCAGCCTCCCAAAGTCCTGG + Intergenic
1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG + Intronic
1199550504 X:149056649-149056671 AGCCCAGCCAATGGTAGTCCTGG - Intergenic
1202149082 Y:21828559-21828581 GGCCCTGCCAACAGAACTGCTGG - Intergenic