ID: 1198651075

View in Genome Browser
Species Human (GRCh38)
Location X:138864498-138864520
Sequence GGCCCAGCCAACCGAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198651068_1198651075 7 Left 1198651068 X:138864468-138864490 CCTCAGGGGCCTGCTGTGAATGG No data
Right 1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG No data
1198651073_1198651075 -2 Left 1198651073 X:138864477-138864499 CCTGCTGTGAATGGCAGGTGGGG No data
Right 1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198651075 Original CRISPR GGCCCAGCCAACCGAAGTCC TGG Intronic