ID: 1198651488

View in Genome Browser
Species Human (GRCh38)
Location X:138867987-138868009
Sequence CTGAGTCATCTCTCCTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198651488_1198651490 -8 Left 1198651488 X:138867987-138868009 CCAAAGTAGGAGAGATGACTCAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1198651490 X:138868002-138868024 TGACTCAGTGGAGAAAAAGATGG 0: 1
1: 0
2: 5
3: 28
4: 413
1198651488_1198651491 7 Left 1198651488 X:138867987-138868009 CCAAAGTAGGAGAGATGACTCAG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1198651491 X:138868017-138868039 AAAGATGGCTGTACTGCTTATGG 0: 1
1: 0
2: 1
3: 8
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198651488 Original CRISPR CTGAGTCATCTCTCCTACTT TGG (reversed) Intronic
900794457 1:4699621-4699643 CTCCATCATCTCTCCTACATTGG - Intronic
902797709 1:18810162-18810184 GTGAGTCATCTCCCCTCCCTGGG + Intergenic
903730945 1:25494836-25494858 CTGAGGAATATTTCCTACTTGGG - Intronic
905054192 1:35079172-35079194 CTGAGTCAAGGGTCCTACTTTGG + Exonic
905511198 1:38521814-38521836 CTGAGCCATGACGCCTACTTGGG - Intergenic
905548806 1:38819560-38819582 CTGAGCCATCTCTGCTGCTCTGG - Intergenic
907768229 1:57432375-57432397 CTGAGTCACCTGTCCAACTCTGG - Intronic
910317579 1:85904313-85904335 CTGTGTCATCTCTCCTGTTTGGG + Intronic
911069610 1:93822300-93822322 CTGAGTAATCTCAGCTACTTGGG - Intronic
914337926 1:146732767-146732789 CTAAGTCATCTCACATATTTGGG + Intergenic
914713539 1:150235719-150235741 CTGAGTCATCTCACCTCCTCCGG + Exonic
918182702 1:182098257-182098279 CAAAGTCATCACTCCTACATAGG - Intergenic
920714667 1:208328339-208328361 CTTAGTCATCTTTCTAACTTGGG + Intergenic
923730876 1:236548385-236548407 CTCTGCCCTCTCTCCTACTTTGG + Exonic
1063814845 10:9759817-9759839 CTGAGTCATTTCACCTACAAGGG + Intergenic
1065297210 10:24288526-24288548 CTGTGCCATCTCTCCCACTAAGG - Intronic
1067005101 10:42653333-42653355 ACAAGTCATATCTCCTACTTGGG - Intergenic
1068073354 10:52223443-52223465 CTGTTCCATCTCTGCTACTTTGG + Intronic
1068931162 10:62592101-62592123 CTAAACCATCTCTCCCACTTAGG - Intronic
1070857616 10:79619851-79619873 CTGAGTCAACCCTCCTCCCTGGG + Intergenic
1071163344 10:82777909-82777931 CTGAGGCATCTCACCTCCATGGG - Intronic
1072535884 10:96362400-96362422 GTGAGTAAGCTCTCCTTCTTTGG + Intergenic
1072666255 10:97394907-97394929 CTGAATCAGTTCTCCCACTTTGG - Intronic
1075493337 10:122894141-122894163 ATGAGTCATCTGTCATACCTAGG - Intergenic
1079733265 11:23962310-23962332 CTCAGTCCTCTCTCCTGCTCTGG - Intergenic
1080695844 11:34602473-34602495 CTGAGTCATTTCACCTTCTTGGG + Intergenic
1080812050 11:35714477-35714499 CTGAGTCTTCTTTCCTACATAGG - Intronic
1081739549 11:45428717-45428739 CTCAGTCATCTTTCCTTCTGTGG + Intergenic
1081802225 11:45867892-45867914 TTGAGTCTTCTCTCCTCCTCCGG - Intronic
1084918586 11:72450469-72450491 CAGGGTCATTGCTCCTACTTAGG + Intergenic
1085951951 11:81342930-81342952 CTGAGTCATTTCACCTCCCTGGG + Intergenic
1088632020 11:111782812-111782834 CTGGGTCATTTTTCCAACTTTGG - Intronic
1088818709 11:113438770-113438792 ATGAGACATCTCTGCTACTCAGG + Intronic
1091006786 11:131960921-131960943 ATGCGTCATGCCTCCTACTTTGG + Intronic
1094527729 12:31243598-31243620 CTCAGGCAATTCTCCTACTTTGG - Intergenic
1095655350 12:44662135-44662157 CTGAGTCATTTCCACAACTTTGG + Intronic
1096517269 12:52163913-52163935 CTGAGCCATCTCTCCTGCCCTGG - Intergenic
1096694611 12:53340581-53340603 CTGACTCATCTCTCCCTCTGTGG + Intronic
1098632496 12:72740990-72741012 CAGACTCATCTCTTCTCCTTAGG - Intergenic
1098847125 12:75551229-75551251 CTGTGTCTTCTCACCTACTCAGG - Intergenic
1099056354 12:77846043-77846065 CTGAGTCATATCTCCAATTCCGG + Intronic
1101023521 12:100577747-100577769 CTGAATCATCTCCCCAATTTAGG - Intronic
1101353499 12:103955507-103955529 CACAGTCATCTCAGCTACTTAGG + Intronic
1102362855 12:112303327-112303349 GTGAGTCATCTCTCTTCCTCTGG + Intronic
1104626958 12:130364966-130364988 CTGGGTCATCTCTGTTTCTTAGG + Intronic
1105657728 13:22458756-22458778 CTGATTATTCTCTCCTGCTTTGG + Intergenic
1108516717 13:51210178-51210200 TTGATTCATCTCTTCTGCTTAGG - Intergenic
1109896144 13:68693910-68693932 CTGAGGCTTCACTCCTTCTTAGG + Intergenic
1110666041 13:78118524-78118546 CTGAGTCCTCTCTACCACTCTGG - Intergenic
1111306658 13:86421931-86421953 CTGAGTAATAGCTCCAACTTAGG + Intergenic
1113052753 13:106232584-106232606 CTGAATACTCTTTCCTACTTCGG + Intergenic
1114602431 14:23967507-23967529 CTGAGTCCTCTCTCCACCTGGGG + Intronic
1114606800 14:24004633-24004655 CTGAGTCCTCTCTCCACCTGGGG + Intronic
1114612101 14:24049581-24049603 CTGAGTCCTCTCTCCACCTGGGG + Intergenic
1115079958 14:29438133-29438155 CTGAGTCTTCTCACCTCCTTTGG + Intergenic
1116347577 14:43814639-43814661 TTGAGTCTTCTCTCTTAATTGGG - Intergenic
1117769164 14:59114849-59114871 CTGAATCCTCACTCCTCCTTTGG - Intergenic
1121330577 14:93047046-93047068 CTGATTCTTCTCTCCCAGTTCGG - Intronic
1121686850 14:95841969-95841991 CTCACTCAGCTCTCCTACTGTGG - Intergenic
1127526495 15:59797808-59797830 CTAAATCATCTCCACTACTTTGG - Intergenic
1129172708 15:73817755-73817777 CTGGGCCATCTCTCCTCTTTTGG + Intergenic
1129381885 15:75173186-75173208 CTCAGAAATCTCCCCTACTTTGG - Intergenic
1129386220 15:75197509-75197531 CTGAGGCCTCTCTCCCACTGTGG + Intronic
1131231153 15:90660578-90660600 CTGTGTCATTCCTCCTACTCAGG - Intergenic
1131426506 15:92349578-92349600 CTGATTCATATCTCCACCTTGGG - Intergenic
1134853420 16:17500306-17500328 CTGAGTCATGTCCCACACTTTGG + Intergenic
1138535416 16:57657412-57657434 CTGAGCCTCCTCTCCTACGTGGG + Exonic
1140503972 16:75458460-75458482 CTGACTCTTATCTCCTACCTTGG - Intronic
1140659651 16:77175719-77175741 CTGCCTCATTTCTCCTTCTTTGG - Intergenic
1143198248 17:5093533-5093555 ATGAGTCAACTCTCATTCTTAGG - Exonic
1143269123 17:5662697-5662719 TTGAGTCATCTCTCTCAGTTAGG - Intergenic
1144531435 17:16042942-16042964 TTGAGTCATCTCATCTACTCTGG - Intronic
1145266320 17:21381189-21381211 CTGAGCCCTCCCTCCTGCTTGGG + Intronic
1147117162 17:38309393-38309415 GTGTGTAATCTCTGCTACTTGGG + Intronic
1148404612 17:47399523-47399545 CTTGGTCATTTCTCCCACTTTGG - Intronic
1149361261 17:55898317-55898339 ATGAGTCATGTCACTTACTTTGG - Intergenic
1150691257 17:67369162-67369184 CTGAGTAGTCTCAGCTACTTGGG - Intergenic
1151120783 17:71790409-71790431 TTGAGTAATATCTCCTAATTGGG - Intergenic
1152457434 17:80424362-80424384 CTGTGGCTTCTCTCCTGCTTTGG - Intronic
1153566857 18:6427442-6427464 CTGTGTGATCTCTCATACTAGGG - Intergenic
1154396606 18:13996588-13996610 CTATGTCATCTCTGCAACTTTGG - Intergenic
1155047303 18:22114056-22114078 CTGAGACATCTTTCCTCGTTTGG + Intergenic
1155928115 18:31679355-31679377 CTGAGTCACATATGCTACTTAGG + Intronic
1156212237 18:34957350-34957372 CTGAGGCATCTGTTCTACATAGG + Intergenic
1157634208 18:49133709-49133731 CTGGTACATCTCTCCTGCTTTGG + Intronic
1160754864 19:751792-751814 TTGAGTCATCTCAGCTCCTTGGG - Intronic
1161679346 19:5671830-5671852 CCGAGGCATCTCTCCTGCCTAGG - Intergenic
1163130546 19:15270056-15270078 CTGAGTCATCACTCTGACTGAGG + Intronic
1163283431 19:16331217-16331239 CTCTGTCATCTCAGCTACTTGGG + Intergenic
1163512529 19:17744204-17744226 TTGAGTCCTGCCTCCTACTTTGG + Intergenic
1163715338 19:18869633-18869655 CTGGCTCATGTCTCCCACTTCGG - Intronic
1164084857 19:21891774-21891796 GTGAGTCTTCTCTCTTACTTTGG + Intergenic
1164461863 19:28455886-28455908 CTGAGCTATATCTCCTTCTTAGG - Intergenic
926433059 2:12809601-12809623 CTGATTCATGTCTTCTTCTTCGG + Intergenic
929069606 2:38016255-38016277 CTGTGACATCTCTGCTACTGAGG - Intronic
932216136 2:69967172-69967194 CTGATTCATCTCTCCAAGTGAGG - Intergenic
933152371 2:78931052-78931074 TTGAGTCATCTCTGTTACCTGGG + Intergenic
933690998 2:85179483-85179505 CTAGGTCATCTCTCAGACTTGGG + Intronic
934604953 2:95687502-95687524 CAGACACATCTCTCCTTCTTAGG - Intergenic
936538402 2:113330041-113330063 CAGACACATCTCTCCTTCTTAGG - Intergenic
939674444 2:145054455-145054477 CTGAGTCTTCTCTCCTCTCTTGG - Intergenic
940276286 2:151944151-151944173 TTGTGTCATCTCAGCTACTTAGG - Intronic
941010469 2:160293870-160293892 CTGAGGCATGTCTCCTAATTTGG + Intronic
941088540 2:161147053-161147075 CTGACTCATCCCTCCTTATTGGG - Intronic
943164165 2:184296237-184296259 CTGAGTAATCTCTCCAAATAAGG - Intergenic
1169003760 20:2189781-2189803 CTGTGTAATCTCAGCTACTTGGG - Intergenic
1169493018 20:6087015-6087037 CTCAGTCATGTCTTCTGCTTTGG + Intronic
1170661816 20:18349333-18349355 CACAGTCAGCCCTCCTACTTGGG + Intergenic
1173984476 20:47250410-47250432 GTGAGGCATCTGTCCTACTCCGG + Intronic
1174756527 20:53164260-53164282 TTGATTAATCTCTCCTACTGGGG - Intronic
1177229177 21:18297113-18297135 TTAAGTCATTTCTCCTATTTGGG - Intronic
1182019212 22:27066790-27066812 CTGAGTTCTCTCTTCTACTTTGG - Intergenic
1183396000 22:37571242-37571264 GTGACTTATTTCTCCTACTTGGG - Intronic
1183751881 22:39725563-39725585 CTGAGTCATGTCTGCTATTCGGG - Intergenic
949491912 3:4597532-4597554 AGAAGTCATCTCTCCAACTTGGG - Intronic
951477039 3:23118055-23118077 CTAAGTCATCCCTCATCCTTTGG - Intergenic
954364426 3:50138646-50138668 CTGAGTCCCCTCTCCAACCTGGG + Intergenic
954902564 3:54032225-54032247 CTGAGCCACCTCTGCAACTTGGG - Intergenic
956781283 3:72605315-72605337 CTAAGTCAACTCTCAGACTTGGG - Intergenic
957035164 3:75287675-75287697 GAGAGTGTTCTCTCCTACTTAGG + Intergenic
957444942 3:80304191-80304213 CTGTGTCATCTCACTTACATTGG - Intergenic
960839744 3:121944939-121944961 CTGATTCATCCTTACTACTTAGG - Intergenic
961079047 3:124009272-124009294 GAGAGTGTTCTCTCCTACTTAGG + Intergenic
961304431 3:125947200-125947222 GAGAGTGTTCTCTCCTACTTAGG - Intergenic
964586548 3:158312425-158312447 CAGAGTCATCTCTCCTGATCTGG - Intronic
965200850 3:165655847-165655869 CTGAGAGATGTCTCCTAGTTAGG - Intergenic
965690688 3:171353616-171353638 CTGAGTCATCTCTTGTAGTCAGG - Intronic
971021822 4:22544964-22544986 CCAAGTCATCTCCTCTACTTGGG - Intergenic
971500786 4:27316103-27316125 TAGAGGCATCTCTCCTGCTTAGG + Intergenic
972633736 4:40864127-40864149 CCGAGTAATCTCAGCTACTTGGG + Intronic
974499705 4:62684253-62684275 CTGAGCCATCTCTCCTCACTGGG + Intergenic
977312225 4:95401698-95401720 CTGAGTCAGAGCCCCTACTTGGG + Intronic
978608202 4:110505632-110505654 CTGAGTCAGCTGTTCTAATTAGG + Intronic
978625074 4:110676096-110676118 CTCAGTTCTCTCTCCTACTTAGG - Intergenic
980184612 4:129446269-129446291 CTGAGTCATCTGAGCTCCTTGGG + Intergenic
980541700 4:134203610-134203632 CTCAGTAATCTCTCATATTTTGG - Intergenic
980915597 4:139030534-139030556 CTGGCCCATTTCTCCTACTTAGG - Intronic
982037377 4:151359237-151359259 ATGAGTGATCACTGCTACTTAGG + Intergenic
982486068 4:155967374-155967396 TTGAGTCATCTCTGATACTTAGG + Intergenic
984107956 4:175574048-175574070 CTGAGTAATATCTCCTATATAGG - Intergenic
984764372 4:183388278-183388300 CTGGTTCTTCTCTACTACTTTGG + Intergenic
988278555 5:29114419-29114441 CTGAGTCATATCAGTTACTTGGG + Intergenic
989089131 5:37711180-37711202 ATGAGTCACCCCTCTTACTTGGG + Intronic
989942819 5:50174224-50174246 CTGGGACATGCCTCCTACTTAGG + Intergenic
991339056 5:65585488-65585510 CTGAGTTCTCTCTCCTCCTCTGG - Intronic
991714128 5:69435626-69435648 CTGAGTAATCTCAGCTACTTGGG + Intronic
992164460 5:74035666-74035688 CTGTATCTTCTCTCCCACTTGGG + Intergenic
993824067 5:92659462-92659484 CTGAGTGAGCTTTTCTACTTTGG - Intergenic
994278798 5:97874678-97874700 CTGACTCATCTGTACAACTTGGG - Intergenic
994581194 5:101644383-101644405 CTGAGCCCACTCTCCTCCTTTGG - Intergenic
994696610 5:103079771-103079793 CTGATACATCCCTCCTCCTTGGG - Intergenic
994880612 5:105489176-105489198 CTAAGTCTTCTCTCTGACTTCGG + Intergenic
995166828 5:109053256-109053278 CTGTGTAATCTCAGCTACTTGGG + Intronic
996066039 5:119080380-119080402 CTCAGTCAACTCCCCTACCTTGG + Intronic
998942966 5:147304971-147304993 CTGAGTAATCTCAGCTTCTTTGG + Intronic
999637029 5:153633721-153633743 CTTAGTCATTTCTCCTCTTTGGG - Intronic
1003854729 6:10261811-10261833 TTGACTCAGCTCTCTTACTTAGG - Intergenic
1005389452 6:25318502-25318524 CTTTGTCATCTGTCCTACTCCGG + Intronic
1006384354 6:33721187-33721209 CTGACTCAACTCTCCCACCTTGG + Intergenic
1007462516 6:42028704-42028726 CTGAGTCATCTCCCTTGCTGAGG - Intronic
1008639328 6:53445357-53445379 CTGAGTCATTTTTCCTAAGTTGG - Intergenic
1009645920 6:66400973-66400995 CGTTCTCATCTCTCCTACTTGGG - Intergenic
1012386594 6:98690106-98690128 CTGAGTCTTCTCTCCCACTATGG + Intergenic
1013003793 6:106051379-106051401 GTGAGTCCACTCTCCTAGTTTGG - Intergenic
1014986953 6:128022928-128022950 CTGCCTCATCTCAGCTACTTGGG + Intronic
1016682172 6:146844029-146844051 CTGATTCACCTCTCCTGCCTAGG + Intergenic
1017637546 6:156456956-156456978 TTGATTCATCTCTTCTGCTTAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020712350 7:11623660-11623682 CTCACTCATCTCTCCCTCTTCGG + Intronic
1023846610 7:44124235-44124257 CTGAGTGCTGTCTCCCACTTTGG + Intronic
1023907247 7:44531525-44531547 CTGGGCCATCTCTCTTACTGTGG + Intronic
1024881159 7:54087127-54087149 TTGAGTCCTGTCTCCTCCTTTGG + Intergenic
1024915390 7:54493187-54493209 CAGAGTCCTCCCTCCTCCTTGGG - Intergenic
1025785405 7:64639270-64639292 GTGAGTCTTCTCTTCTGCTTTGG + Intergenic
1027700549 7:81464813-81464835 CTGTTTTCTCTCTCCTACTTTGG + Intergenic
1028053862 7:86220066-86220088 CAGAGTGATCTCTTCTCCTTAGG - Intergenic
1028070768 7:86447306-86447328 CTGACTCATCTATGCTACTCAGG - Intergenic
1031767350 7:125798132-125798154 CTGAGAAATCTCTCCATCTTGGG - Intergenic
1032283757 7:130526322-130526344 CTCAGTCATCTCTTCTCCATAGG - Intronic
1032284490 7:130530565-130530587 CTCAGTCATCTCTTCTCCATAGG - Intronic
1032285312 7:130535127-130535149 CTCAGTCATCTCTTCTCCATAGG - Intronic
1032286096 7:130539527-130539549 CTCAGTCATCTCTTCTCCATAGG - Intronic
1033132429 7:138756104-138756126 CTGAGTCATTTCTGCTTCTATGG + Intronic
1035106559 7:156446225-156446247 CTGAGACATCTCCCCGACTCCGG - Intergenic
1037094197 8:14963810-14963832 ATGAGTGATCTCTCCTACAGAGG - Intronic
1038612042 8:29067004-29067026 CTGAGTCATCTTTCCTTGTTTGG - Intergenic
1040040537 8:42912380-42912402 TTCATTCATGTCTCCTACTTAGG + Intronic
1042765012 8:72311888-72311910 GTGAGTCATCTCTTCCCCTTGGG - Intergenic
1042963765 8:74329559-74329581 CTGAGTCCTGTCATCTACTTGGG - Intronic
1042991948 8:74650996-74651018 CTGTGTCATCTCTCATATCTTGG + Intronic
1043301890 8:78744314-78744336 CTGAGCCATCCCTCCTTATTGGG - Intronic
1046603920 8:116349789-116349811 CTGAGTCAACTGTGCTAATTTGG + Intergenic
1047042770 8:121016148-121016170 CTGGGTCATCTTACTTACTTTGG - Intergenic
1047845234 8:128798591-128798613 CTGAGTCATCTCTGGCACTTTGG + Intergenic
1048017886 8:130513766-130513788 CAGAGTAATCTCTTCTACTCTGG - Intergenic
1050087093 9:1977534-1977556 CTGTGTAATCTCTGCTACTCAGG + Intergenic
1050424237 9:5497527-5497549 CTGAGTCTCCTCTCATTCTTGGG - Intergenic
1052522632 9:29568374-29568396 CTGACTCACCACTCCTATTTTGG - Intergenic
1056318072 9:85410466-85410488 CTGAGGGGTCTCTCCTGCTTTGG + Intergenic
1058389823 9:104482797-104482819 CTGTGTCCTCTCTCCCTCTTGGG - Intergenic
1187090383 X:16089893-16089915 AATAGTCCTCTCTCCTACTTAGG + Intergenic
1188559890 X:31455665-31455687 CTGAAGCATCTCTCATTCTTTGG + Intronic
1191866136 X:65705376-65705398 CCAACTCATCTCTCCTTCTTAGG - Intronic
1195756696 X:108205784-108205806 CTCAGCCATCTTTCCTGCTTTGG + Intronic
1198651488 X:138867987-138868009 CTGAGTCATCTCTCCTACTTTGG - Intronic
1199270119 X:145873122-145873144 CTGAATCATAGCTCCTACTCTGG - Intergenic
1202040261 Y:20675189-20675211 CTCAGTGATGTCTCCTAGTTAGG - Intergenic