ID: 1198657613

View in Genome Browser
Species Human (GRCh38)
Location X:138932144-138932166
Sequence TAAGCTTTTAAGGACGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198657613_1198657615 0 Left 1198657613 X:138932144-138932166 CCAGCAACGTCCTTAAAAGCTTA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1198657615 X:138932167-138932189 AATATCGCCACGAAGATAAAAGG 0: 1
1: 0
2: 0
3: 5
4: 74
1198657613_1198657617 18 Left 1198657613 X:138932144-138932166 CCAGCAACGTCCTTAAAAGCTTA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1198657617 X:138932185-138932207 AAAGGTGCAGAGTATAAAGCTGG 0: 1
1: 0
2: 0
3: 40
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198657613 Original CRISPR TAAGCTTTTAAGGACGTTGC TGG (reversed) Intronic
902202905 1:14847148-14847170 TAAGCTTTTAAAAAGATTGCCGG - Intronic
910040880 1:82850445-82850467 AAAGCTTTTAAGGATGTTGAGGG + Intergenic
911935515 1:103965445-103965467 TAAGCATTTAAGGACATTGATGG - Intergenic
916764632 1:167848357-167848379 TTACCTTTTAATGACGTTGGAGG + Exonic
921764583 1:218955678-218955700 AAAGCTTTTAAGGACTATTCTGG + Intergenic
922018085 1:221673356-221673378 TAAGTTTCTATAGACGTTGCTGG - Intergenic
922120182 1:222658370-222658392 TAAGCTTATTAGGATGATGCAGG - Intronic
922210149 1:223480054-223480076 TAAGCTTTTAGGGACCATGCAGG - Intergenic
1063090492 10:2862110-2862132 TAAGATTTTAAGTCCCTTGCAGG - Intergenic
1065136200 10:22672832-22672854 TCACCTTTTTAGGACGTTGAGGG - Intronic
1067128729 10:43542514-43542536 TTTGCTTTTAAGGGTGTTGCAGG + Intergenic
1075987889 10:126803751-126803773 TGAGCTTTCAAGAACTTTGCAGG - Intergenic
1099045470 12:77711980-77712002 TAAGCTTTTTATGAAGTTGTGGG - Intergenic
1099919321 12:88938042-88938064 TGAGCCTTAAAAGACGTTGCAGG + Intergenic
1111355633 13:87098361-87098383 TAAACTCTTATGGATGTTGCAGG - Intergenic
1116813843 14:49565675-49565697 TATGCTCTTAAGCACCTTGCTGG + Intergenic
1117507214 14:56415734-56415756 TATGCTTGTAAGGATGTTTCTGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1122161012 14:99783904-99783926 TAAGGTTTTATGGCCGTTCCTGG - Intronic
1123034886 14:105467887-105467909 TAAGCTTTTATGTAACTTGCTGG - Intronic
1123184748 14:106506051-106506073 TAAGCTTTTGAGGGTGTTTCTGG - Intergenic
1124876796 15:33602343-33602365 TAAGCTTTTAACCACTTTGCTGG + Intronic
1126920185 15:53512793-53512815 TAGGCTTTTAAAGAGGTTTCTGG - Intergenic
1127246879 15:57186729-57186751 TAATCTTTTCAATACGTTGCTGG - Intronic
1130286886 15:82563217-82563239 TAAGGATTTAAGGACATTACTGG + Intronic
1131279944 15:91013003-91013025 TATGCTTATAAGGATGTGGCTGG - Intronic
1135751651 16:25063167-25063189 AAAGGTTTTAAGGAAGTTACAGG + Intergenic
1138877648 16:60972270-60972292 CAAGCTTTTAAGTACTTTGGAGG + Intergenic
1151363969 17:73605262-73605284 TAAGGTTTGAGGGACGTAGCAGG + Intronic
1153937429 18:9942044-9942066 TCAGCTTTTAACTGCGTTGCTGG + Intronic
1153986245 18:10353178-10353200 TAAGCTTTTAAACACCTTGGTGG + Intergenic
1156516504 18:37684854-37684876 TCAGCATTTAAGGATGATGCTGG - Intergenic
1158307065 18:56117417-56117439 TGAGCTTTTAAGGAGGTGGGAGG + Intergenic
1159763945 18:72462687-72462709 TAAGCTTTTAAGGTTGATGGAGG + Intergenic
1159988851 18:74878160-74878182 TAAGCTTGTAAGGAAGTTTTGGG - Intronic
926901538 2:17755870-17755892 TTAGCTTTTAAGGAAGTTTTAGG + Intronic
927738973 2:25549983-25550005 TCAGACTTTAAGGACTTTGCTGG - Intronic
932973011 2:76568692-76568714 TAAACTTTTCAGGATCTTGCTGG - Intergenic
939596693 2:144134035-144134057 TCTGCTTTTAGGGAAGTTGCCGG - Intronic
941699387 2:168587764-168587786 TAAGTTTTTAAAGAAGTTGAGGG + Intronic
945155638 2:206834541-206834563 TAAGCTATTAAGGATGCTCCTGG + Intergenic
948196033 2:236097084-236097106 TAAGATTTGATGGACTTTGCAGG - Intronic
949716479 3:6937511-6937533 TAAACATTTAAGGATGTTTCAGG + Intronic
951017265 3:17744346-17744368 TAGGCCTTTAAAGACTTTGCAGG + Intronic
955083215 3:55677019-55677041 GAAGCTTTTAAGGAGATTGGAGG - Intronic
957221089 3:77383456-77383478 TATGCTTTTATGGTCATTGCAGG + Intronic
960981562 3:123232828-123232850 TAATTTTTTAAATACGTTGCTGG - Intronic
966958031 3:184904555-184904577 TAATCTTTTAAATATGTTGCTGG + Intronic
967673690 3:192270529-192270551 TAAGATGTTAAGTACATTGCAGG + Intronic
975029538 4:69598271-69598293 TAATCTTTTTAGAAAGTTGCAGG - Intronic
976688758 4:87845646-87845668 CAACCTTTTAAGGACATTCCTGG + Exonic
990803848 5:59635512-59635534 TAAGCTTTTTAATGCGTTGCTGG - Intronic
991176810 5:63698026-63698048 TAAGTTTTTCAGGCTGTTGCTGG + Intergenic
994917702 5:106001412-106001434 TAAGCTTTTTATGATGCTGCTGG + Intergenic
996046942 5:118884698-118884720 TAAGCTTTTAAAAACCTTCCAGG + Intronic
1000280393 5:159776767-159776789 TAAGCTTTTTAAGTCCTTGCAGG + Intergenic
1006704297 6:36004406-36004428 TAAGATTTTATGAATGTTGCTGG - Intronic
1007469503 6:42079371-42079393 CAAGTTTTTAAGGAAGATGCTGG + Exonic
1008155492 6:48008922-48008944 TAAGCTTATAAGGAAGCTCCAGG - Exonic
1012082722 6:94781805-94781827 TAAGCTTTTAAATGTGTTGCTGG + Intergenic
1015335626 6:132034529-132034551 TGCCCTTTTAAGGACATTGCAGG + Intergenic
1017427973 6:154342223-154342245 TAAGCTTGTAATGACGTTATTGG - Intronic
1018910614 6:168099238-168099260 TAAGCTTTTAAAGTCGGTGTTGG - Intergenic
1022521586 7:31011420-31011442 TATGCTTTTCAGGAAGTTACTGG - Intergenic
1030083858 7:105800579-105800601 TAAGCATTTGAGTACGTTTCTGG - Intronic
1030580492 7:111348884-111348906 TAAGCTCCTAAGGACTTTCCTGG + Intronic
1033593695 7:142838092-142838114 TAAGATTTTAAGGCCGAGGCAGG + Intergenic
1034105282 7:148484464-148484486 TAAGTTTTGAAGGAGTTTGCAGG + Intergenic
1036654191 8:10665279-10665301 TAAGAGTTAAAGGATGTTGCAGG + Intronic
1043328867 8:79088158-79088180 CATGCTGTTAGGGACGTTGCAGG + Intergenic
1043935467 8:86137381-86137403 CCAGCTTTTAAGGACCTTGAAGG - Intronic
1048813732 8:138311572-138311594 TAAGCATTTGAGGACATTTCTGG + Intronic
1051517204 9:17943240-17943262 TAAACTCTTAAGTACATTGCAGG - Intergenic
1052207319 9:25858192-25858214 AAATCTTTAAAGGACTTTGCAGG + Intergenic
1056531159 9:87488986-87489008 TAAGCTTTTAAGAAACTTGTAGG - Intergenic
1061318496 9:129813029-129813051 TAAGCTTTATAGGAGGTTTCGGG + Exonic
1186962622 X:14753212-14753234 AATGCTTTAAAGGACATTGCTGG - Intergenic
1189009384 X:37031017-37031039 TAAGCTTTTCAGGGTGCTGCTGG + Intergenic
1198657613 X:138932144-138932166 TAAGCTTTTAAGGACGTTGCTGG - Intronic