ID: 1198665704

View in Genome Browser
Species Human (GRCh38)
Location X:139020065-139020087
Sequence TACTCAACCCCCTTGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198665701_1198665704 14 Left 1198665701 X:139020028-139020050 CCCTAAGATCTAGCTTGTGGTGT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1198665704 X:139020065-139020087 TACTCAACCCCCTTGAGATCTGG 0: 1
1: 0
2: 1
3: 5
4: 105
1198665699_1198665704 30 Left 1198665699 X:139020012-139020034 CCTGTCAAACTAGCTGCCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1198665704 X:139020065-139020087 TACTCAACCCCCTTGAGATCTGG 0: 1
1: 0
2: 1
3: 5
4: 105
1198665702_1198665704 13 Left 1198665702 X:139020029-139020051 CCTAAGATCTAGCTTGTGGTGTT 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1198665704 X:139020065-139020087 TACTCAACCCCCTTGAGATCTGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198665704 Original CRISPR TACTCAACCCCCTTGAGATC TGG Intronic
900531914 1:3158272-3158294 AAAGCAACCCCCTTGAGGTCAGG - Intronic
902641218 1:17767503-17767525 AACTCAACCCCCAGGAGAGCAGG - Intronic
904983271 1:34524366-34524388 CACTCAAATCCCGTGAGATCTGG - Intergenic
910329735 1:86057152-86057174 TTCTCAACTCACATGAGATCTGG + Intronic
910727571 1:90355071-90355093 TTCCCCACCCCCTTGACATCTGG - Intergenic
921151715 1:212408181-212408203 TACTCAACCTCCCTGAGGTTGGG + Intronic
924125005 1:240841183-240841205 TACTTAACCCCCATCAAATCTGG - Intronic
1068350300 10:55836018-55836040 TAATCAACCCTCTTGGAATCAGG + Intergenic
1075655801 10:124160336-124160358 TACCCAACCCCGTTGGGAACGGG - Intergenic
1077609791 11:3637144-3637166 TACTCCACCTCCTCCAGATCTGG + Intergenic
1079375599 11:19888970-19888992 TCGACAAGCCCCTTGAGATCCGG + Intronic
1081374262 11:42340157-42340179 TACTCAAACCCCTTGAGGGATGG - Intergenic
1081450853 11:43169645-43169667 TACTCTACCCCCTGGATATTAGG + Intergenic
1082168293 11:48971167-48971189 TACTCTACCCCCTGGATATTAGG + Intergenic
1082168501 11:48972527-48972549 TACTCTACCCCCTGGATATTTGG + Intergenic
1082235151 11:49814782-49814804 TACTCTACCCCCTGGATATTAGG - Intergenic
1082608840 11:55275753-55275775 TACTCTACCCCCTGGATATTAGG - Intergenic
1082832980 11:57633161-57633183 GTCTCAAACCCCTTGAGATAGGG - Intergenic
1084485640 11:69446518-69446540 TTCTCATCCCCGTTGAAATCAGG - Intergenic
1086701636 11:89905918-89905940 TACTCTACCCCCTGGATATTAGG - Intergenic
1086701959 11:89908119-89908141 TACTCCACCCCCTGGATATTCGG + Intergenic
1086704209 11:89936407-89936429 TACTCCACCCCCTGGATATTCGG - Intergenic
1086704532 11:89938607-89938629 TACTCTACCCCCTGGATATTAGG + Intergenic
1087779599 11:102288284-102288306 TTCTCAACCCCCTCGAGGGCTGG - Intergenic
1090397564 11:126429270-126429292 GACACAACACCTTTGAGATCTGG + Exonic
1091909578 12:4218388-4218410 TACTCAACCTCATTGTGATCAGG - Intergenic
1101357809 12:103996960-103996982 TAGTCAAGCCACTTGAAATCAGG - Intronic
1101385427 12:104253057-104253079 AATTCAAACTCCTTGAGATCTGG - Intronic
1103788788 12:123454389-123454411 GTCTCAAACTCCTTGAGATCAGG + Intergenic
1108818012 13:54314550-54314572 TACTCTACCCCCTGGATATTAGG + Intergenic
1110106817 13:71687688-71687710 TCCTCAACCTCCTTGGGCTCAGG + Intronic
1115761647 14:36582578-36582600 TACTTAACACCCTGGAGACCCGG - Exonic
1116169666 14:41384171-41384193 TAATTAACCACCTTGACATCTGG - Intergenic
1117037377 14:51742948-51742970 TACTCTACCCCCTGGATATTAGG - Intergenic
1117041564 14:51773569-51773591 TACTCTACCCCCTGGATATTAGG - Intergenic
1117593753 14:57305264-57305286 TAGTTAAGCTCCTTGAGATCAGG - Intergenic
1119628535 14:76205328-76205350 TACTCAGCCCCCTCCAAATCTGG - Exonic
1125488058 15:40126172-40126194 TCCTCGACCCCCTAGATATCAGG - Intergenic
1125488738 15:40130979-40131001 TCCTCGACCCCCTGGATATCAGG - Intergenic
1125963008 15:43848154-43848176 GCCTCAACCGCCTTGAGCTCAGG - Intronic
1128391034 15:67182679-67182701 TCCCCAACCCCCTAGACATCAGG - Intronic
1130371592 15:83289048-83289070 CCCACCACCCCCTTGAGATCTGG - Intergenic
1131917305 15:97282709-97282731 TCCTCAAACCTCTTGAGATTGGG + Intergenic
1133760830 16:8797291-8797313 TACTCCACACCCCTGAGATTCGG + Intronic
1134303992 16:13015748-13015770 TCATCAACACCCTTGAAATCTGG + Intronic
1135228014 16:20678427-20678449 TACTCCACCCCCAGGAGTTCAGG + Intronic
1138866878 16:60832576-60832598 TAATAAAACCCCTTGATATCAGG + Intergenic
1140230268 16:73112174-73112196 TTCTTATCCCTCTTGAGATCAGG - Intergenic
1141796018 16:86274816-86274838 TGCTCAACCACCTGGAGCTCTGG - Intergenic
1147263531 17:39222373-39222395 TTCTCCACCCCCCTGGGATCTGG - Intronic
1153800332 18:8662937-8662959 CACTCAATGCCCTTGAGAGCAGG + Intergenic
1154345467 18:13540105-13540127 TACTCAACCTCCCTGGCATCTGG - Intronic
1156162389 18:34374724-34374746 TACACAACCCCCTTGACCACAGG + Intergenic
1156489838 18:37489549-37489571 TCCTCAACCCCTGTGAGATGTGG - Intronic
1160234365 18:77074312-77074334 CACTGAACCCCCTTGAGACCGGG - Intronic
1160234374 18:77074338-77074360 CACTGAACCCCCTTGAGACCCGG - Intronic
1162300212 19:9840676-9840698 GCCTCAACCTCCTTGGGATCAGG + Intronic
925530016 2:4849219-4849241 TACTCAACCCACTTCAGATCAGG - Intergenic
925622659 2:5808833-5808855 TACACAACCTCCTTGACATTTGG - Intergenic
928259977 2:29757883-29757905 TACTCAAAATCCTTTAGATCAGG - Intronic
930787752 2:55286984-55287006 TACTCATCCCCTTTCAGTTCTGG + Intergenic
933456848 2:82528621-82528643 TACTCTACCCCCTGGATATTAGG - Intergenic
943842455 2:192599664-192599686 TACTCTACCCCCTGGATATTAGG + Intergenic
946083367 2:217146953-217146975 TTCTCCACCCCCTTTAAATCAGG - Intergenic
946450344 2:219774174-219774196 AACTCAAACCCATTGTGATCAGG - Intergenic
946691801 2:222314007-222314029 CACTCAACCCCATGGAGATGTGG + Intergenic
1168845731 20:943291-943313 GCCTCAACCCCCCTGAGTTCAGG - Intergenic
1169387805 20:5165964-5165986 CATACAAGCCCCTTGAGATCAGG - Intronic
1170202236 20:13757478-13757500 GCCTCAACCTCCTTGAGCTCAGG + Intronic
1183116156 22:35694194-35694216 TACTCTACCCCCTGGATATTAGG - Intergenic
1183117045 22:35700216-35700238 TACTCTACCCCCTGGATATTAGG - Intergenic
1183956597 22:41383891-41383913 TGCTCTCCTCCCTTGAGATCTGG - Intronic
1184030828 22:41893433-41893455 TACTCAACCTCCCTGAGCTTTGG - Intronic
952245719 3:31589516-31589538 TAATCATGCCCCCTGAGATCAGG - Intronic
953374384 3:42416598-42416620 TAGTCAGCCCCCTTCAGGTCAGG - Intergenic
954784430 3:53082539-53082561 TACACAGCCCCCTTTAGCTCTGG - Intronic
958445292 3:94207610-94207632 TACTCAGCCCCCTTGCCATGAGG + Intergenic
962441847 3:135427241-135427263 TACTGAGTTCCCTTGAGATCTGG + Intergenic
965751178 3:171976426-171976448 TACTCCACTCCCTTGACATCCGG - Intergenic
982869081 4:160553397-160553419 TGCTCAAACCCCTTGAGAGTGGG + Intergenic
983511327 4:168612300-168612322 TCTTCAACCCCCTTGAAATAGGG + Intronic
987262449 5:16216864-16216886 TACACAAGCTCCTTGAGAGCAGG + Intergenic
993851302 5:93013508-93013530 TACTCATCTCCCTTGTGATTTGG - Intergenic
994174460 5:96696349-96696371 TACTTAACCTCCTTGAGCTCTGG - Intronic
994397102 5:99234131-99234153 TACTCTACCCCCTGGATATTAGG - Intergenic
998791374 5:145769053-145769075 ATCTCAACCCCCAGGAGATCAGG + Intronic
998936304 5:147234067-147234089 TACTCCACCCCCTGGAAATTAGG - Intergenic
1003566673 6:7228586-7228608 GACTCAACCTCCTTAAGCTCAGG + Intronic
1007798076 6:44367313-44367335 TACTGAATCCCCTTGAGGCCAGG - Intronic
1008531419 6:52464025-52464047 TTTTCATCCCCCTTGTGATCAGG + Intronic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1017400630 6:154056867-154056889 TACTCAGCCCCCATAAGCTCTGG + Intronic
1026517927 7:71088676-71088698 TACTCAACCTACTTGAAACCAGG - Intergenic
1028883470 7:95906280-95906302 TACTTAATCCCCTTGAGCTACGG + Intronic
1031150638 7:118049812-118049834 TACTCATTCCCTTGGAGATCTGG + Intergenic
1033403027 7:141045383-141045405 TCATCAACCCCTTTGAGATGGGG + Intergenic
1035259968 7:157654795-157654817 TACTCAAGCACCTTGAAATGTGG + Intronic
1043111563 8:76190394-76190416 TAATCAACCCTCTAGACATCTGG + Intergenic
1044841363 8:96339648-96339670 TACTCACCACCCTGGTGATCTGG + Intergenic
1050902563 9:10965507-10965529 TACTCTACCCCCTGGATATTAGG + Intergenic
1051071654 9:13175699-13175721 TCCTCAACCCCCTTGACAAGGGG - Intronic
1051467484 9:17396819-17396841 TACTCAAGCCCCTTGTCCTCAGG + Intronic
1051504329 9:17811018-17811040 TCTTCAACCCCCTTGAAAACAGG + Intergenic
1052800838 9:32966412-32966434 TACTGAACCACCTTGAATTCTGG - Intergenic
1056495037 9:87148177-87148199 TACTCAACCGCCTTTAGGTGGGG - Intergenic
1187560809 X:20401730-20401752 TACTCCACCACCTTGATAACCGG + Intergenic
1191688737 X:63918850-63918872 TACTCAAACCACTTGAGACTGGG - Intergenic
1191744009 X:64465734-64465756 TGCTCAACCCCCTAGAGTTATGG - Intergenic
1193747304 X:85298023-85298045 TCCTCTACCTCCTTGGGATCAGG + Intronic
1196779307 X:119368443-119368465 AATTCAAACTCCTTGAGATCAGG - Intergenic
1198314450 X:135452092-135452114 CACTCAGCCACCTAGAGATCAGG + Intergenic
1198665704 X:139020065-139020087 TACTCAACCCCCTTGAGATCTGG + Intronic