ID: 1198666215

View in Genome Browser
Species Human (GRCh38)
Location X:139026020-139026042
Sequence CTAGTTCTGAATCCTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198666215_1198666217 3 Left 1198666215 X:139026020-139026042 CCTGCCACAGGATTCAGAACTAG 0: 1
1: 0
2: 0
3: 19
4: 116
Right 1198666217 X:139026046-139026068 TGACATGTGTATGCTTAATGTGG 0: 1
1: 0
2: 1
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198666215 Original CRISPR CTAGTTCTGAATCCTGTGGC AGG (reversed) Intronic
900001667 1:17945-17967 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
903185375 1:21626088-21626110 CTAGGTCTGTAGACTGTGGCAGG - Intronic
903347833 1:22698835-22698857 TAAGCTCTGCATCCTGTGGCTGG + Intergenic
905345384 1:37307741-37307763 CTGGTTGAGAAGCCTGTGGCTGG + Intergenic
907405947 1:54253624-54253646 CTAGCTCTGAATCACTTGGCTGG + Intronic
907417429 1:54324202-54324224 CCACTTCTGATTTCTGTGGCCGG - Intronic
907577868 1:55544746-55544768 GTAGATCTGAAACCTGTGGAAGG + Intergenic
908855218 1:68419176-68419198 CTAGTTCTAAATCCTGGTTCCGG - Intergenic
909268994 1:73599605-73599627 CTAGTTCTCAAGCTTGTGGATGG - Intergenic
913181809 1:116329740-116329762 ATGCTTCTGAAGCCTGTGGCAGG - Intergenic
923752393 1:236758230-236758252 CTATTTACTAATCCTGTGGCTGG + Intronic
923977967 1:239286146-239286168 CTTCTTCTGAATTCTGTTGCTGG - Intergenic
1064116186 10:12579310-12579332 CTTCTTCTGAATCCTGTGTTGGG + Intronic
1070166061 10:73898962-73898984 CTAGTTCTGAGGTCAGTGGCAGG - Intergenic
1072429654 10:95359699-95359721 CCATTTCTGACTCCTGTGTCTGG - Intronic
1072742283 10:97916597-97916619 CTCAGTCTGAATCCTGGGGCTGG - Intronic
1074084050 10:110194048-110194070 CCAGCTCTGAACCCTGTGGCAGG + Intergenic
1074428197 10:113370631-113370653 CTACTTCCTAATCCTCTGGCTGG + Intergenic
1074683088 10:115930403-115930425 CTAGTTCTGAAGCTTGTGTATGG - Intronic
1075527973 10:123202211-123202233 CTGGTTTTGAATCCTGTTGGAGG + Intergenic
1076218729 10:128716265-128716287 CTAGTTGTGAGGCCTGGGGCTGG - Intergenic
1076627742 10:131832288-131832310 CTATTTCTGAAACCCGAGGCCGG - Intergenic
1077270713 11:1678311-1678333 CTGGTGCTGAAGCCTGGGGCTGG + Intergenic
1084860682 11:72015939-72015961 CCAGTTCTTGATCCTGTTGCTGG + Exonic
1085128216 11:74016511-74016533 CTTGTTCTGATTCCTGGGCCTGG - Intronic
1086157826 11:83687330-83687352 CTAGCTGTGAAACCTGGGGCAGG - Intronic
1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1092791938 12:12077734-12077756 CTAGTTTTGTGACCTGTGGCAGG - Intronic
1095831773 12:46595440-46595462 CTAGTTCTCCATCCTCTGACAGG + Intergenic
1096923522 12:55115978-55116000 CTGGTTCTTATTTCTGTGGCTGG + Intergenic
1100898552 12:99212984-99213006 CTAGGTGTGAATCCTGACGCTGG - Intronic
1101445545 12:104734542-104734564 CTAGTTCTGAATACGGTCACAGG + Intronic
1101910351 12:108856808-108856830 CTGGTTCTGAGACCTGTGGCCGG - Intronic
1104569664 12:129914062-129914084 CTAGTTCTCCATCCTGGGGCAGG - Intergenic
1106717839 13:32409595-32409617 CCAGGTCTGACTCCTTTGGCTGG - Intronic
1106933952 13:34697358-34697380 CAAGTTCTCAATCCGGTGGGAGG + Intergenic
1107591812 13:41915789-41915811 CTACTTCTGAATCCCATGGCTGG + Intronic
1111275356 13:85939177-85939199 CTAGTTCTGGACCCAGTGACCGG - Intergenic
1113577529 13:111404724-111404746 CAAGTTCTCACCCCTGTGGCTGG - Intergenic
1113927729 13:113950843-113950865 CTGGTTCTGAAGGCTGTGGTGGG - Intergenic
1120976170 14:90250113-90250135 CTAGGCCTGACTCCTGTAGCGGG + Intergenic
1121095534 14:91215731-91215753 GCAGTTCTGAATCGTGTGGCAGG + Intronic
1122057436 14:99112414-99112436 CTACTTCTGAATCATTTGACAGG - Intergenic
1125300595 15:38251108-38251130 GGAGCTCTGACTCCTGTGGCTGG + Intergenic
1129682275 15:77664560-77664582 GTAGGTCAGCATCCTGTGGCAGG + Intronic
1132451842 15:101972995-101973017 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG + Exonic
1135510239 16:23076540-23076562 CTAGCTCTGTGTCCTGGGGCAGG - Intronic
1139522112 16:67489457-67489479 CTACTGCTGAAGGCTGTGGCTGG + Intergenic
1144737893 17:17565050-17565072 CTGGTTTTGAAAACTGTGGCTGG + Intronic
1145067867 17:19774633-19774655 CAAGATCTAAATCCTGGGGCAGG + Exonic
1151688200 17:75662277-75662299 CTTGTTCTGGATCCTGTGGAAGG - Intronic
1151978060 17:77493337-77493359 CAAGTTCTGGATCCTGGTGCAGG + Intronic
1156163315 18:34386607-34386629 CAAGTTCTCAATCCTGGGGGAGG - Intergenic
1158360910 18:56672045-56672067 CTAGTTCTGTGTCCTAGGGCAGG + Intronic
1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG + Exonic
925650262 2:6081851-6081873 CTAATTCTGATTGCTTTGGCTGG + Intergenic
927689256 2:25196137-25196159 CTGGTACTGACTCCTATGGCTGG - Intergenic
934052704 2:88223708-88223730 TTAGTTCTTAAACCAGTGGCTGG - Intergenic
934774302 2:96927382-96927404 GTAGTTCTGAATCCTCTGATGGG + Intronic
936568056 2:113595463-113595485 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
939265984 2:139873204-139873226 TTATTTCTGAGTCCTGTGCCTGG + Intergenic
940261825 2:151788807-151788829 CTAGTTCTTATTCCTTTGGAAGG - Intergenic
943106864 2:183555647-183555669 CTAAATCTAAAGCCTGTGGCAGG - Intergenic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
948811810 2:240482227-240482249 CTTCTTCTTCATCCTGTGGCTGG + Exonic
1172352623 20:34255265-34255287 CTCGTTCTCAATCCTGTTCCTGG + Intronic
1173914415 20:46696290-46696312 CTGGTTCTGGCTTCTGTGGCAGG + Intergenic
1173993842 20:47322973-47322995 CTAGGTCTGAATCCAGGTGCTGG + Intronic
1174044185 20:47721820-47721842 CTAGCTCTGAATCCTGGACCAGG + Intronic
1175169398 20:57069679-57069701 CTTGGCCTGAATACTGTGGCCGG - Intergenic
1179892878 21:44345745-44345767 ATGGTTCAGATTCCTGTGGCAGG + Intergenic
1180601199 22:17017793-17017815 CTAGTTATTAATCCTTTGTCAGG - Intergenic
951400851 3:22230106-22230128 CTAGTGGTGAATCCTCTGGGAGG - Intronic
952090126 3:29875194-29875216 GTAATTCTGAATCTTGTGGCAGG - Intronic
955409864 3:58648600-58648622 GAAGTTCTGAATCCAGTGCCTGG + Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956405004 3:68919017-68919039 CTAAGTGTGAATCCTATGGCAGG - Intronic
956703361 3:71978537-71978559 CTTGCCCTGGATCCTGTGGCTGG + Intergenic
957743074 3:84299755-84299777 ATATTTCTTATTCCTGTGGCAGG - Intergenic
959022996 3:101209274-101209296 CTAATTTTGAACCCTTTGGCAGG - Intergenic
961968555 3:130933531-130933553 CTAGGTTTGAATCCAGTTGCTGG - Intronic
963005215 3:140720816-140720838 CTGGTGCTGAACCCTGTGGGAGG + Intergenic
963812532 3:149792953-149792975 ATTGTTCTGTACCCTGTGGCAGG - Intronic
974483080 4:62471077-62471099 CTGGTTCTGATTCCTGGGGTTGG + Intergenic
975075227 4:70198693-70198715 CTAGCTCTGACTCCTATAGCAGG + Intronic
978601831 4:110436842-110436864 CTAATTGTGAGTCATGTGGCAGG - Intronic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
990192665 5:53277740-53277762 CTAGATGTGAATCCGTTGGCAGG + Intergenic
990342847 5:54841194-54841216 GAAGTTCTGAATGCTTTGGCTGG + Intergenic
991404557 5:66289286-66289308 CTAGGTCCGTATACTGTGGCAGG + Intergenic
992971884 5:82069503-82069525 GTGGTTCTGAACCCTGTGACTGG + Intronic
998488123 5:142521351-142521373 CTAGTTTTAAACCCTGTGCCAGG - Intergenic
999280437 5:150361818-150361840 CTAATGCTAAGTCCTGTGGCTGG + Intronic
999440991 5:151600681-151600703 CTAGATCTGAACCCTGAAGCTGG - Intergenic
999668569 5:153937747-153937769 CTAGTTCAGAAGTCTGTGGAGGG + Intergenic
999907666 5:156161435-156161457 ATAGTTCTTAGTCCTGTGACTGG - Intronic
1000451038 5:161387149-161387171 CTATTTTCTAATCCTGTGGCAGG + Intronic
1002775876 6:327184-327206 CCAGGTCTGAATCTTGGGGCTGG + Intronic
1002842466 6:918043-918065 CTTGTTCTAAATCCTGCTGCTGG + Intergenic
1009529094 6:64786842-64786864 CTAGTGATAAATCCTGGGGCTGG + Intronic
1009938172 6:70257886-70257908 ATTCTTCTGAATCATGTGGCTGG - Intronic
1010454362 6:76038238-76038260 GTAGTTCTGTGTCCTGTGGTAGG - Intronic
1013046232 6:106488559-106488581 CCAGTTGTCAATCCTGGGGCAGG + Intergenic
1014370994 6:120607223-120607245 CAAGTTCTCAATCCGGTTGCAGG + Intergenic
1015204548 6:130619919-130619941 CTATTTCTGAATCCCCTGCCAGG - Intergenic
1017775865 6:157680428-157680450 CTAGTTCTGTAACCTCAGGCAGG + Intergenic
1018301069 6:162403611-162403633 CTATTTCTGACACCTGTGTCAGG - Intronic
1019438691 7:1035755-1035777 CATTTGCTGAATCCTGTGGCAGG - Intronic
1019933617 7:4240139-4240161 CTATTACAGAATCCTGTGTCTGG + Intronic
1022019872 7:26388288-26388310 CTTGTTCTGCTTCCTGTGGACGG - Intergenic
1028814919 7:95132742-95132764 CTAAGTGTGGATCCTGTGGCGGG - Intronic
1031579896 7:123460112-123460134 CTAGTTTTCAATCCTGGTGCTGG + Intronic
1034558018 7:151862180-151862202 CTAGTACAGCATCCTGTGTCTGG - Intronic
1035032156 7:155868392-155868414 CTATTTGTGACTCCTGAGGCTGG + Intergenic
1037009130 8:13819146-13819168 ACAGTTCTGAATCCTGAGGGTGG + Intergenic
1039728899 8:40253206-40253228 CCAGTTCTGGGTCCTGTGGCCGG - Intergenic
1043373439 8:79620455-79620477 TTTGTTCTGAAGCCTGTGCCAGG + Intronic
1045950078 8:107841492-107841514 CCAGTACTGAATTCTGTGACAGG + Intergenic
1047299092 8:123597469-123597491 CTAGTTCTGCAAGCTGTGGCTGG + Intergenic
1049199773 8:141334377-141334399 CTGGTTGTGAAGCCTGTGGTCGG - Intergenic
1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1057893446 9:98887262-98887284 TGAGTTCAGAATCCTGAGGCTGG + Intergenic
1059551873 9:115237248-115237270 CTAATGAGGAATCCTGTGGCAGG + Intronic
1186844368 X:13516322-13516344 CTAGTAGTGAATCCTGTAGCAGG - Intergenic
1189170656 X:38906250-38906272 CTACTTCTGTATCCATTGGCTGG + Intergenic
1192209347 X:69117749-69117771 CTAGTTCTTGCTTCTGTGGCTGG + Intergenic
1192320966 X:70090394-70090416 CTAGTGCTGAGTCCAGTGTCTGG - Intergenic
1192863048 X:75098868-75098890 CTAGTTATGAATCCTGGGCCTGG - Intronic
1195295105 X:103468794-103468816 CTACTTCTGAACACTGTAGCTGG - Intergenic
1196286150 X:113882637-113882659 CTAGATCAGCATCCTGAGGCTGG + Intergenic
1197769429 X:130080749-130080771 CTTGTCCTGAATCCTCAGGCTGG + Intronic
1198666215 X:139026020-139026042 CTAGTTCTGAATCCTGTGGCAGG - Intronic
1198691437 X:139289243-139289265 CTTGTTCAGCATCCTATGGCTGG - Intergenic
1200401331 X:156022093-156022115 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1200779634 Y:7202746-7202768 CTAGTTCTGTATACTGTGTTGGG - Intergenic