ID: 1198668465

View in Genome Browser
Species Human (GRCh38)
Location X:139051344-139051366
Sequence TAGGATACACAACCTGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198668465_1198668468 -2 Left 1198668465 X:139051344-139051366 CCTTGATCAGGTTGTGTATCCTA 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1198668468 X:139051365-139051387 TAAGTCAGGATCATTTAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 82
1198668465_1198668469 -1 Left 1198668465 X:139051344-139051366 CCTTGATCAGGTTGTGTATCCTA 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1198668469 X:139051366-139051388 AAGTCAGGATCATTTAGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198668465 Original CRISPR TAGGATACACAACCTGATCA AGG (reversed) Intronic
905008868 1:34733241-34733263 GAGGATAAACAACTTGTTCAAGG - Intronic
918449042 1:184641514-184641536 GAGGTTAGACAGCCTGATCAAGG - Intergenic
920958736 1:210645129-210645151 GAGGTTACACAACTTGTTCAAGG + Intronic
923261111 1:232268745-232268767 TATGATAAACATCCTGCTCATGG - Intergenic
1069187623 10:65445345-65445367 TAAGATGCACAACATAATCAGGG + Intergenic
1072170585 10:92856640-92856662 TAGGATACACAGTCTTCTCAAGG - Intronic
1077821253 11:5743635-5743657 TTGGATACACAACAAAATCAAGG + Intronic
1080016673 11:27514460-27514482 CAGGATGCACAACCTGAAGAGGG - Intergenic
1081428290 11:42949603-42949625 TAGGATACCCAATCAGGTCATGG - Intergenic
1085043055 11:73338138-73338160 TAGGAAACAGGACCTGACCAGGG + Intronic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1093800177 12:23363226-23363248 TAGGATACAGGGCCTGAGCAGGG + Intergenic
1097772679 12:63606960-63606982 TATTACACACAACCTGAACAAGG - Intronic
1099695013 12:86007442-86007464 TATGATACACTACCAGATCATGG - Intronic
1109960667 13:69625002-69625024 AAATATACACAACCTGATAATGG + Intergenic
1111021028 13:82452613-82452635 TATGTTACACCACCTGAACATGG - Intergenic
1113334133 13:109361919-109361941 TAGGAATGACAAACTGATCATGG - Intergenic
1113352822 13:109546161-109546183 CAGGATTCACTTCCTGATCAGGG + Intergenic
1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG + Intergenic
1121186124 14:91971440-91971462 TAGGATACAAAAGCTGGTGATGG - Intronic
1124586057 15:31008532-31008554 TGGGATAAACTACCTGATCGTGG + Intronic
1129318259 15:74759292-74759314 TTGGAAACACTACATGATCAAGG + Intergenic
1133893066 16:9900041-9900063 TGAGATACACAACGTGATAAAGG + Intronic
1138579333 16:57930070-57930092 TTGGATAAACAACCAGAACAGGG - Intronic
1141015201 16:80442477-80442499 TATGAGACACAACCAGCTCAGGG - Intergenic
1150271011 17:63865121-63865143 TAGCATAAACAACCAGCTCAGGG + Intergenic
1150298048 17:64025161-64025183 GAGGTTACACAACTTGCTCAAGG - Intergenic
1151400211 17:73850962-73850984 GAGGTTAAACAACCTGCTCAAGG - Intergenic
1152825338 17:82461286-82461308 TTGGATACATAACCTGAGCCTGG + Intronic
1153278226 18:3390058-3390080 TAGTATACACAACCAAAACAAGG - Intergenic
1155386055 18:25278622-25278644 AAAGATAAACAACCTGAGCAAGG - Intronic
1156567259 18:38206259-38206281 TACAATACTCAACCTGATTATGG - Intergenic
1164423627 19:28119876-28119898 TAGGAAACCCAAGCAGATCAAGG - Intergenic
1165686142 19:37821858-37821880 TAGGATACACAACATTTTTAAGG - Intergenic
925422240 2:3722154-3722176 GAGGTTATACAACTTGATCAAGG + Intronic
930380048 2:50616600-50616622 TAGAATACAGAACCCTATCAAGG - Intronic
930686353 2:54312607-54312629 TAGGAAACAAAAACTGATGATGG - Intergenic
932001578 2:67890000-67890022 TAGGTAAAACAACCTGGTCATGG + Intergenic
939431259 2:142111470-142111492 TAGGAAGCAAAACATGATCATGG + Intronic
940966514 2:159843857-159843879 TTGTATAAACAATCTGATCAGGG - Intronic
1169432056 20:5545394-5545416 TGTGATGCACAGCCTGATCAAGG + Exonic
1173226028 20:41162932-41162954 CAGGAAACAGAACCTGGTCAGGG - Intronic
1176733104 21:10519976-10519998 TAGGATACAAAACCACACCATGG - Intergenic
1181542151 22:23579415-23579437 TAGGAGACACAAGCTTATCCAGG - Intronic
1181794870 22:25299838-25299860 CAGGATAAACAAACTAATCAAGG - Intergenic
1181835437 22:25603487-25603509 CAGGATAAACAAACTAATCAAGG - Intronic
950195045 3:11003300-11003322 TATAATAAACCACCTGATCAGGG - Intronic
953268501 3:41416673-41416695 TAGGAAACACAGCCTGAGTAAGG + Intronic
955664140 3:61332454-61332476 TAGGAAAGAAAACCTAATCATGG + Intergenic
957281185 3:78153806-78153828 TGGGATACACCCCCTGACCAAGG + Intergenic
958768056 3:98394937-98394959 CAGGATACACATCCCCATCAGGG + Intergenic
959611944 3:108305179-108305201 TAGAAAACAGAACCTGAGCAAGG + Intronic
961100706 3:124196181-124196203 TAAGATAGACAACCTAATAAGGG - Intronic
965904530 3:173687129-173687151 TAAGGTAAACAACCTGATCGTGG - Intronic
967234414 3:187370328-187370350 AAGGATACGCAACCTGCTTAAGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG + Intergenic
983973040 4:173897648-173897670 AAAGATAATCAACCTGATCATGG + Intergenic
984922891 4:184781307-184781329 TAGGGTAAAAAACCTAATCATGG + Intronic
992220036 5:74562754-74562776 GAGGATGCAGAACCAGATCAAGG - Intergenic
994717241 5:103336286-103336308 CAGAATACACAACCTGCCCAAGG - Intergenic
996241982 5:121215363-121215385 TAGGATACACAAGCACAACAAGG - Intergenic
997719335 5:136065349-136065371 TAGGATACCCAGCATGAGCAAGG - Intergenic
999710803 5:154316622-154316644 TGGGATACACAGTCTAATCAGGG - Intronic
999971629 5:156869520-156869542 TAAGATACATAACCTGCTCTAGG + Intergenic
1003870664 6:10400076-10400098 TAGGATACAAAAACTGATATAGG + Intronic
1015504222 6:133964830-133964852 TAGCATAGACAACCTGTTTAAGG - Intronic
1016205586 6:141464670-141464692 TAGTTTACACAACAAGATCAAGG + Intergenic
1022365549 7:29711709-29711731 TATTACACACAACCTGAACAAGG + Intergenic
1022932241 7:35130654-35130676 TATTACACACAACCTGAACAAGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023474926 7:40566713-40566735 AAGCATCCACAACCTGCTCACGG - Intronic
1024497532 7:50065461-50065483 TAGGAAAAACAACCTGCCCAAGG - Intronic
1029828173 7:103223453-103223475 TATTACACACAACCTGAACAAGG - Intergenic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1035279712 7:157769969-157769991 TAGGATACACACCCCGACCTCGG + Intronic
1035327532 7:158074664-158074686 TAGAATTCATACCCTGATCAGGG - Intronic
1035822198 8:2605500-2605522 CAGGATACACAGGCTGATGATGG + Intergenic
1044730662 8:95226322-95226344 GAGGATGCACAACCTGATCCAGG + Intergenic
1047601548 8:126430571-126430593 TTGGAGACACAGTCTGATCAAGG - Intergenic
1050585849 9:7110595-7110617 TTGGATCCACAGCCTGATTATGG + Intergenic
1051829834 9:21263566-21263588 TAATATACACAACATAATCATGG + Intergenic
1052057028 9:23917903-23917925 TAACATACACAACCCGTTCAAGG - Intergenic
1054865332 9:69994485-69994507 GAGGCTAAACAACTTGATCATGG + Intergenic
1054928670 9:70614136-70614158 AAGGATACCCAGCCTGTTCATGG - Intronic
1059891817 9:118812426-118812448 TAGGATACACGGCCTTCTCAGGG + Intergenic
1061760090 9:132844967-132844989 CAAGATACACAACCTCTTCAAGG + Intronic
1188001366 X:24985601-24985623 TAGGATATTCAACCTGTACAAGG - Intronic
1188004574 X:25008202-25008224 AGGGATACACAACCTGCTCTTGG + Intronic
1189377949 X:40480484-40480506 TAGGAGATAGAAACTGATCAGGG + Intergenic
1192694243 X:73398187-73398209 TAGGAGAAACACCCTGCTCATGG + Intergenic
1195124090 X:101787677-101787699 TTGGATACATAAACTGATTAAGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199681116 X:150225314-150225336 TGGGCTTCACAACCTCATCAGGG - Intergenic