ID: 1198668468

View in Genome Browser
Species Human (GRCh38)
Location X:139051365-139051387
Sequence TAAGTCAGGATCATTTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198668462_1198668468 15 Left 1198668462 X:139051327-139051349 CCTTAAAACCTGAAGAACCTTGA 0: 1
1: 1
2: 5
3: 40
4: 280
Right 1198668468 X:139051365-139051387 TAAGTCAGGATCATTTAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 82
1198668465_1198668468 -2 Left 1198668465 X:139051344-139051366 CCTTGATCAGGTTGTGTATCCTA 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1198668468 X:139051365-139051387 TAAGTCAGGATCATTTAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 82
1198668461_1198668468 30 Left 1198668461 X:139051312-139051334 CCAGATATCACAGAACCTTAAAA 0: 1
1: 0
2: 3
3: 15
4: 271
Right 1198668468 X:139051365-139051387 TAAGTCAGGATCATTTAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 82
1198668464_1198668468 7 Left 1198668464 X:139051335-139051357 CCTGAAGAACCTTGATCAGGTTG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1198668468 X:139051365-139051387 TAAGTCAGGATCATTTAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198668468 Original CRISPR TAAGTCAGGATCATTTAGCC TGG Intronic
902276574 1:15344210-15344232 TAAGGAAGGCTCATTTAGTCAGG - Intronic
902779372 1:18694521-18694543 TAAATCAAGAACATTTAGCCTGG + Intronic
908340310 1:63171560-63171582 TAAACCTGGATCATGTAGCCAGG + Intergenic
914886336 1:151587394-151587416 TCAGTCAGGGCTATTTAGCCAGG + Intergenic
1066977104 10:42379047-42379069 TAAGTGAGGTGCATTTACCCAGG - Intergenic
1067999682 10:51317796-51317818 AAAGTCTGGATTATTTAGCCAGG + Intronic
1070476742 10:76836386-76836408 TAAGTCAGTCACATTGAGCCAGG + Intergenic
1081385782 11:42471104-42471126 TATGCCAGGATCATCTTGCCAGG + Intergenic
1087987673 11:104704773-104704795 AAAGTCAAAATCCTTTAGCCTGG - Intergenic
1088505281 11:110521577-110521599 CAAGGCAGGATCATGTGGCCTGG + Intergenic
1091561959 12:1621496-1621518 TAATTCAGCATCAATTACCCAGG - Intronic
1093221053 12:16421098-16421120 TAAGTCTGGATCATTTCATCTGG - Intronic
1095162363 12:38933248-38933270 TAAATCGGGATCATTTAGCCTGG - Intergenic
1097144305 12:56929506-56929528 AAAGTCTGCATCATTGAGCCAGG - Exonic
1098555847 12:71817949-71817971 TAGGTCAGGATCATGAAGTCAGG + Intergenic
1099084339 12:78226555-78226577 TAACTCTGGATCCCTTAGCCTGG + Intergenic
1100514792 12:95317003-95317025 TAAGTCATGTTTATTTAGTCTGG + Intergenic
1106222584 13:27758841-27758863 CAAGTCAGGAGGATTTAGCAAGG - Intergenic
1109754930 13:66744984-66745006 TAATGCAGGATCATATTGCCTGG + Intronic
1114439055 14:22731533-22731555 CAAGTTGGGTTCATTTAGCCAGG + Intergenic
1126525023 15:49644339-49644361 TAAGTCAGGCTCTTTTCACCTGG - Exonic
1127817710 15:62626333-62626355 TATTTCAGGTTCATTTTGCCTGG + Intronic
1130900055 15:88200267-88200289 TAGGTCAGGCTGATTTATCCAGG + Intronic
1133529798 16:6644606-6644628 TAAGTAAGGATCACATATCCTGG - Intronic
1134187352 16:12095083-12095105 GGAGTCAGGATCACTTAGTCTGG - Intronic
1137474637 16:48797117-48797139 TAATTCAGGGTAATTCAGCCTGG + Intergenic
1138481979 16:57309562-57309584 TAAGTCTGCATCATTTAATCAGG - Intergenic
1140804082 16:78516701-78516723 TAAGTAAGGATCATTTCAGCTGG - Intronic
1141309780 16:82902413-82902435 TAGTTGAGGATCATTTTGCCAGG + Intronic
1147207924 17:38852059-38852081 TAAGTAATGAGCAATTAGCCGGG + Intronic
1149247553 17:54728504-54728526 TAAGTTAGGATCAGTTAACTGGG - Intergenic
1153993210 18:10418185-10418207 TAAGTCAGGGTAAATTTGCCAGG - Intergenic
1154254540 18:12771034-12771056 TAAGTCAGGACCATGTTGCTAGG - Intergenic
1167711524 19:51114479-51114501 TAAGTCTGGACCATTTTGACTGG + Intergenic
926351527 2:11999774-11999796 GAAATCAGGAATATTTAGCCAGG + Intergenic
927609747 2:24526056-24526078 TAGGCCAGGAAAATTTAGCCTGG - Intronic
932661249 2:73654644-73654666 TAAGTCAGGATAATTTTCCGTGG + Intergenic
937081569 2:119144017-119144039 TCAGTCAGGATCCTTTAGAGAGG - Intergenic
940144456 2:150531646-150531668 TAAATCAGGAGCATTTTGCCAGG - Intronic
940317424 2:152339882-152339904 TAAGTAATGATTATTTAGGCTGG + Intronic
940352811 2:152707669-152707691 TGAATCGGGATCATTTAGTCTGG + Intronic
941772395 2:169359559-169359581 TAAGTCAGGATCATTACAACAGG + Intronic
945017310 2:205532731-205532753 TAAGTTAGGATGAGTTTGCCTGG + Intronic
945336339 2:208597314-208597336 TCAGTCTGGACCATTTAGACAGG - Intronic
1171062437 20:21978961-21978983 TGGGTCAGGAGCATTTACCCTGG - Intergenic
949682708 3:6533918-6533940 TAAGTCTGTATTATTGAGCCTGG - Intergenic
952036557 3:29209606-29209628 TAGGTCAATATCATTTAGTCTGG + Intergenic
952669405 3:35948050-35948072 TAGGTCAGGAGGATTTAGCTTGG + Intergenic
953124245 3:40076456-40076478 TAAGTCAGAATCACTGGGCCAGG + Intronic
953598137 3:44337338-44337360 CAAGTTGGGTTCATTTAGCCAGG - Intergenic
954542601 3:51404534-51404556 TAAGCTAGGATCATTCAGCAGGG + Intronic
955292095 3:57701552-57701574 TAAGTCAAGAACTTTTGGCCAGG - Intergenic
957302910 3:78416183-78416205 AAACTCAAGATCATTCAGCCAGG + Intergenic
958463503 3:94428541-94428563 TAAGTCAGGACCAGTGATCCAGG - Intergenic
960814159 3:121656442-121656464 TGATTCAGGATCATCTAACCAGG - Intronic
967424857 3:189315395-189315417 TAATTGAGGATAATTGAGCCAGG - Intronic
975669508 4:76766807-76766829 TAACTGAGGAACATTCAGCCAGG + Intronic
976829125 4:89293589-89293611 CAAGTCAGGGTCATTGAGGCTGG + Intronic
977261300 4:94800235-94800257 TAAGTCAAGATCATTTGTGCAGG + Intronic
979411269 4:120382880-120382902 TAGATCAGGACCAATTAGCCTGG - Intergenic
982032410 4:151313843-151313865 TAAGACAGGATCATTTACATGGG + Intronic
983424918 4:167571320-167571342 TAGTTCAGGGTTATTTAGCCAGG - Intergenic
984470176 4:180159699-180159721 TAAATCAGGCTAAATTAGCCTGG - Intergenic
986761327 5:10882539-10882561 TAATTCAGGATCCTTGGGCCAGG - Intergenic
988682820 5:33500782-33500804 TAAGTCAGGATCTTAAAGCATGG + Intergenic
994783609 5:104126025-104126047 TAATCCAGGATAATTTATCCAGG + Intergenic
995247835 5:109955522-109955544 GCATTTAGGATCATTTAGCCTGG + Intergenic
1001776877 5:174335560-174335582 TAAGACAGGAGGATTTAGTCTGG - Intergenic
1002665044 5:180816945-180816967 TAAATCAGGAGCATTTGTCCAGG + Intergenic
1004943470 6:20586170-20586192 TAAGCCAGCATCATCTTGCCTGG + Intronic
1020745420 7:12073115-12073137 TGAATCAGGATCATTTAGTCTGG + Intergenic
1021984068 7:26082037-26082059 GAACTCTGGAGCATTTAGCCTGG - Intergenic
1023130659 7:36999515-36999537 TAAGTCAGGAGCATTGGCCCTGG - Intronic
1027197957 7:76044250-76044272 TAAGGCAGGAGAATTGAGCCTGG - Intronic
1027333010 7:77119936-77119958 TAAGTCATGATCATATATACTGG - Intergenic
1029221996 7:98997620-98997642 TAATTCAGGAACATTCAGCTTGG + Intronic
1029782776 7:102751360-102751382 TAAGTCATGATCATATATACTGG + Intronic
1037982271 8:23262684-23262706 TAAGTCTGGATCATTTAACAAGG - Intergenic
1044288997 8:90445780-90445802 TAAGCCTGGAGCATTTAGGCTGG - Intergenic
1045407861 8:101885164-101885186 TAAGTCAGGATGGTTTTGTCTGG - Intronic
1045435997 8:102165062-102165084 TTAGCCAGGCTCATTTAGTCAGG + Intergenic
1046353201 8:113043401-113043423 TAAGTCAGCATCATTTTAACAGG + Intronic
1048397951 8:134032719-134032741 GAAGTCAGGCACATTTAGGCTGG + Intergenic
1062258156 9:135640903-135640925 TAAGACAGGCCCATCTAGCCAGG + Intergenic
1187521023 X:20014184-20014206 TAAGTAAAGAGCATATAGCCAGG - Intronic
1188039740 X:25357982-25358004 TAAGTTAGCATCCTTTAGCAAGG - Intergenic
1189693207 X:43638068-43638090 CAAGTTAGGTTCATTTAGCCAGG - Intergenic
1194647225 X:96472466-96472488 CAAGTCTGGATCCTTTAGCAAGG - Intergenic
1198668468 X:139051365-139051387 TAAGTCAGGATCATTTAGCCTGG + Intronic
1198746645 X:139897770-139897792 GAAGCCAGGGACATTTAGCCAGG + Intronic