ID: 1198668469

View in Genome Browser
Species Human (GRCh38)
Location X:139051366-139051388
Sequence AAGTCAGGATCATTTAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198668465_1198668469 -1 Left 1198668465 X:139051344-139051366 CCTTGATCAGGTTGTGTATCCTA 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1198668469 X:139051366-139051388 AAGTCAGGATCATTTAGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1198668464_1198668469 8 Left 1198668464 X:139051335-139051357 CCTGAAGAACCTTGATCAGGTTG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1198668469 X:139051366-139051388 AAGTCAGGATCATTTAGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1198668462_1198668469 16 Left 1198668462 X:139051327-139051349 CCTTAAAACCTGAAGAACCTTGA 0: 1
1: 1
2: 5
3: 40
4: 280
Right 1198668469 X:139051366-139051388 AAGTCAGGATCATTTAGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198668469 Original CRISPR AAGTCAGGATCATTTAGCCT GGG Intronic
900983153 1:6058053-6058075 AAGTGAGGATCACTGAGCCCAGG + Intronic
908489680 1:64630915-64630937 AAATGTGGATCATTTAGCCAAGG - Intronic
908728512 1:67202092-67202114 AAGACAGGATGATTCAGACTTGG - Intronic
911619909 1:100054786-100054808 ATGTCAGGATCCTTTAGCACTGG - Intronic
917935818 1:179866030-179866052 AATTCTGGATCATTTATACTAGG + Intronic
923361822 1:233219189-233219211 AGGGCTGGATCATGTAGCCTAGG + Intronic
923589224 1:235303763-235303785 AAGTCAGATTCATATAGCTTTGG - Intronic
924029887 1:239875659-239875681 AAGACAGTATCATGTAGCCATGG + Intronic
1067958331 10:50818847-50818869 AAGGGAGGATCTCTTAGCCTAGG - Intronic
1069566974 10:69470082-69470104 AAGTAAGGATAGTCTAGCCTGGG - Intronic
1073269202 10:102247468-102247490 AAGGCAGGATCATCAAACCTGGG - Intronic
1077515090 11:2996555-2996577 AACTCAGTATCCTTTAGCCAAGG - Intergenic
1081564159 11:44246804-44246826 AGGTCAGGATCATCTGTCCTCGG + Intergenic
1086668619 11:89518551-89518573 ATGTCAGGAGCATTTGGTCTGGG + Intergenic
1087711251 11:101555217-101555239 AAGGCAGGATGTTTTAGGCTTGG + Intronic
1087789964 11:102395225-102395247 AAGACAGCATCATTTTACCTTGG + Intergenic
1093356411 12:18173339-18173361 ATGTGAGGATCCTTTACCCTAGG - Intronic
1093481344 12:19606937-19606959 AACTCAGCCTCATTTAGCATAGG + Intronic
1094210335 12:27883791-27883813 ATGTTAGAATCATTTAGCATGGG - Intergenic
1094298114 12:28930714-28930736 AAGTCAGAATCACTGAGGCTTGG + Intergenic
1094451007 12:30583036-30583058 AAGTCAGGAACATTTAACTGAGG + Intergenic
1097117401 12:56707705-56707727 AAGCCAGGATCGCTTGGCCTGGG - Intergenic
1097144304 12:56929505-56929527 AAGTCTGCATCATTGAGCCAGGG - Exonic
1098041722 12:66359668-66359690 AATTCAGTATCCTTTAACCTTGG - Intronic
1100159296 12:91839203-91839225 ACTTCAGGATCATTTGGTCTGGG - Intergenic
1101860953 12:108482002-108482024 AAGTCAGCATCCTTTGGCCCTGG - Intergenic
1104377308 12:128275997-128276019 AGGTAAGGATCATTTAGAATGGG - Intronic
1104995211 12:132649837-132649859 ATGTCAGGAGCACTTGGCCTCGG + Exonic
1106315220 13:28587291-28587313 AAGTAAGGAACATTTAGTGTAGG - Intergenic
1106341034 13:28826774-28826796 AAGCCAGGAATATATAGCCTTGG + Intronic
1109071204 13:57771505-57771527 AAGTCAGAATCTTTTAGTTTGGG + Intergenic
1110908273 13:80920651-80920673 AAGTCAGTTTCTTTTACCCTTGG + Intergenic
1111818299 13:93182621-93182643 AAGTCAGGATGATTTGGCACAGG + Intergenic
1113028735 13:105970544-105970566 AAGTCAGAATGATTCAGCCCAGG - Intergenic
1118672035 14:68139510-68139532 AAAGCAGGTTCATCTAGCCTAGG + Intronic
1120519543 14:85510506-85510528 AAGCCCGGATCATTTAGACGAGG + Intergenic
1124797699 15:32798473-32798495 AAGGCTGCCTCATTTAGCCTGGG + Intronic
1129467122 15:75730442-75730464 ATGACAGGGTCATTTAGCTTGGG + Intergenic
1131440783 15:92458073-92458095 AAGTCAGGATAATCAATCCTAGG + Intronic
1131836242 15:96394302-96394324 AAGTCAGAATTACTAAGCCTGGG - Intergenic
1133529797 16:6644605-6644627 AAGTAAGGATCACATATCCTGGG - Intronic
1134286108 16:12863298-12863320 AAGTCTGGCTGATTTAGGCTGGG + Intergenic
1134867262 16:17619697-17619719 AGGGCAGGAGGATTTAGCCTGGG - Intergenic
1137474638 16:48797118-48797140 AATTCAGGGTAATTCAGCCTGGG + Intergenic
1140734449 16:77885563-77885585 AAGTCAAGATTTCTTAGCCTTGG + Intronic
1141803917 16:86330130-86330152 ATGTCAGAATCATTGTGCCTGGG + Intergenic
1148527784 17:48357955-48357977 AAGGCAGGAGTATTCAGCCTGGG + Intronic
1150015759 17:61554935-61554957 AATTCAGAATCATTTATTCTTGG - Intergenic
1153519793 18:5940855-5940877 ATGAGAGGATCATTGAGCCTAGG + Intergenic
1155765360 18:29624307-29624329 AAGTCTCCATCATTTACCCTTGG - Intergenic
1158246950 18:55443094-55443116 AAGTCAGGTTCATCTAACCTTGG + Intronic
1164616517 19:29669816-29669838 AAGTCAGGAGTAAGTAGCCTGGG - Intronic
1165684584 19:37808208-37808230 AAGTCAAGCTCATATAGCATGGG + Intronic
1166869911 19:45864751-45864773 AAGTCAGGAAAATTTAGCCAAGG + Intronic
1166958607 19:46483904-46483926 AAGTAAGGATCATTATGCATAGG + Intronic
1167585120 19:50370015-50370037 ATGGCAGGATCACTTAGCCCAGG + Intronic
925481387 2:4278245-4278267 AAGTCAGTTTCAGTTATCCTTGG + Intergenic
925628226 2:5863159-5863181 AAGTCAGGACAAAATAGCCTGGG - Intergenic
926351528 2:11999775-11999797 AAATCAGGAATATTTAGCCAGGG + Intergenic
926973163 2:18486939-18486961 GAGGCAGGATAATTTAGCCTTGG + Intergenic
927169471 2:20356736-20356758 ATGGCAGGATGGTTTAGCCTGGG + Intergenic
932031611 2:68192384-68192406 AAATCAGGATCATTTCTTCTAGG + Intronic
932661250 2:73654645-73654667 AAGTCAGGATAATTTTCCGTGGG + Intergenic
939955151 2:148521596-148521618 AAATCAGGATTATTTAGAATCGG + Intergenic
940317425 2:152339883-152339905 AAGTAATGATTATTTAGGCTGGG + Intronic
940874931 2:158888886-158888908 AAGTCAGGAAGATTGAGCCCAGG + Intergenic
941661852 2:168203466-168203488 AAAACAGGATCATTTTGCCTTGG + Intronic
942901184 2:181121116-181121138 AAGGCAGGATCACTGAGGCTGGG + Intergenic
943345975 2:186737447-186737469 AAGGAAGGATGATTTAGCCCAGG - Intronic
944408904 2:199417167-199417189 AAGCCATGATCATTTAGGCCAGG + Intronic
947511757 2:230761617-230761639 AAGCCAGGACCATTTAGAGTAGG - Intronic
1169063546 20:2679145-2679167 ACGTGAGGAACATTGAGCCTGGG - Intergenic
1169752830 20:9012321-9012343 GTGTCAGCATCATTTATCCTTGG + Intergenic
1172492624 20:35352620-35352642 AGGTCAGGATCATCTAGACCAGG - Intronic
1173539867 20:43843226-43843248 AAGCCAGGCTCATTTAGGCCAGG + Intergenic
1178327392 21:31657046-31657068 AAGACAGGATGATAGAGCCTTGG - Intergenic
949986973 3:9549043-9549065 AAGTCAGGAGTATTTGGCTTCGG - Intronic
951985064 3:28610363-28610385 AAGTCAGAGTCATACAGCCTGGG + Intergenic
952033121 3:29168430-29168452 AATTCAGAATCTTTTAGACTGGG - Intergenic
955159431 3:56449260-56449282 AACTCAGGGTCATTTAGGCAAGG + Intronic
956704636 3:71988802-71988824 AGGGGAGGATCATTGAGCCTGGG + Intergenic
957302911 3:78416184-78416206 AACTCAAGATCATTCAGCCAGGG + Intergenic
957422655 3:79991546-79991568 AAGTCAGTATGAATCAGCCTTGG + Intergenic
959630698 3:108504221-108504243 CAATCAGGGTCACTTAGCCTTGG - Intronic
964514742 3:157495619-157495641 AAGCCAGGATCTATTAGTCTAGG - Intronic
973534981 4:51872101-51872123 CAGGCAGGATCCTTGAGCCTGGG + Intronic
979411268 4:120382879-120382901 AGATCAGGACCAATTAGCCTGGG - Intergenic
981947170 4:150361678-150361700 AAGTGTGGCTCATCTAGCCTGGG - Intronic
983767105 4:171498233-171498255 AAGTCAGGATCCTCTCACCTCGG + Intergenic
984272397 4:177563278-177563300 AAGGCTGTATCATTTAGCCTAGG + Intergenic
988636997 5:32995522-32995544 AAGTAAACATCATTTAGCATTGG - Intergenic
988682821 5:33500783-33500805 AAGTCAGGATCTTAAAGCATGGG + Intergenic
988811502 5:34789391-34789413 AAGCCATTAACATTTAGCCTCGG - Intronic
989393619 5:40929051-40929073 AAGCCAGCATCATTTATCCAAGG + Intronic
998055313 5:139071134-139071156 AAATCAGCAAAATTTAGCCTGGG + Intronic
1006756581 6:36421233-36421255 AAGGCAGGATCATTGAGCCCAGG + Intronic
1007918963 6:45588824-45588846 AAGGCAGGAGCAGCTAGCCTGGG + Intronic
1008675750 6:53816294-53816316 TATTCAGGATAATTTAGTCTTGG + Intronic
1012357567 6:98334721-98334743 AGGTCAGGATCATCTAGTATGGG - Intergenic
1013737291 6:113242573-113242595 AAGTGAGGATCATGGAGGCTGGG + Intergenic
1016625505 6:146162483-146162505 AAGCCACGATCATTTTCCCTTGG + Intronic
1016695615 6:146991568-146991590 TAGTCACTATCATTTAGCTTTGG + Intergenic
1016747162 6:147592953-147592975 ACTTCAGGATCATGTAGTCTAGG + Intronic
1017381045 6:153830254-153830276 AAGGCTGTATCATATAGCCTAGG - Intergenic
1017828093 6:158097662-158097684 TAGTAAGGATCATCTTGCCTGGG + Exonic
1020745421 7:12073116-12073138 GAATCAGGATCATTTAGTCTGGG + Intergenic
1021984067 7:26082036-26082058 AACTCTGGAGCATTTAGCCTGGG - Intergenic
1026491971 7:70871132-70871154 AAGTCAGGAAGACTGAGCCTTGG + Intergenic
1027197956 7:76044249-76044271 AAGGCAGGAGAATTGAGCCTGGG - Intronic
1027333009 7:77119935-77119957 AAGTCATGATCATATATACTGGG - Intergenic
1029782777 7:102751361-102751383 AAGTCATGATCATATATACTGGG + Intronic
1037052031 8:14385578-14385600 AAGTCAGAATGACTTAGCCTTGG - Intronic
1039840611 8:41290460-41290482 AAGTCAGGACCATTTATGATGGG + Intronic
1044015428 8:87044778-87044800 AAGGGAGGAACATTTTGCCTGGG + Intronic
1045407860 8:101885163-101885185 AAGTCAGGATGGTTTTGTCTGGG - Intronic
1047443380 8:124899131-124899153 ATGTGAGGATCATTTACCCCAGG - Intergenic
1053111217 9:35461401-35461423 ATGTGAGGATCATTTAAGCTAGG + Intergenic
1055688085 9:78799447-78799469 GAGTCAGTAAAATTTAGCCTAGG + Intergenic
1057252169 9:93512373-93512395 AAGTCAAGATCATACAGCCGAGG + Intronic
1059685740 9:116633952-116633974 AAGTCTAGATCATTTAACCCAGG + Intronic
1185741966 X:2540939-2540961 ATGGGAGGATCATTGAGCCTGGG - Intergenic
1186714734 X:12239583-12239605 AACTCAGGATCTTTCAGTCTAGG + Intronic
1187176612 X:16901865-16901887 GAATCAGGATGATTTAGGCTAGG + Intergenic
1189460465 X:41238607-41238629 AAGTAAGGATGATTTTGGCTGGG + Intergenic
1190092977 X:47455863-47455885 AAGTCAGTATCACTTTCCCTAGG - Intronic
1191659578 X:63635885-63635907 CAGACAGGATATTTTAGCCTGGG + Exonic
1195000449 X:100638329-100638351 CAGTTGGGGTCATTTAGCCTAGG - Intronic
1197350774 X:125380405-125380427 AAGTAAGGATTACTTAGCCCAGG + Intergenic
1198668469 X:139051366-139051388 AAGTCAGGATCATTTAGCCTGGG + Intronic
1200857462 Y:7954619-7954641 AAGTGGGGATCAATAAGCCTTGG + Intergenic