ID: 1198670174

View in Genome Browser
Species Human (GRCh38)
Location X:139071685-139071707
Sequence GGAGAAATTCTATGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198670174_1198670177 11 Left 1198670174 X:139071685-139071707 CCTGTTATTCATAGAATTTCTCC 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1198670177 X:139071719-139071741 CTCAAAATGCCTTTATTGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 249
1198670174_1198670178 17 Left 1198670174 X:139071685-139071707 CCTGTTATTCATAGAATTTCTCC 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1198670178 X:139071725-139071747 ATGCCTTTATTGGCTGGATGCGG 0: 1
1: 0
2: 2
3: 54
4: 371
1198670174_1198670176 7 Left 1198670174 X:139071685-139071707 CCTGTTATTCATAGAATTTCTCC 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1198670176 X:139071715-139071737 TCATCTCAAAATGCCTTTATTGG 0: 1
1: 0
2: 0
3: 23
4: 227
1198670174_1198670180 20 Left 1198670174 X:139071685-139071707 CCTGTTATTCATAGAATTTCTCC 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1198670180 X:139071728-139071750 CCTTTATTGGCTGGATGCGGTGG 0: 1
1: 0
2: 20
3: 198
4: 1311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198670174 Original CRISPR GGAGAAATTCTATGAATAAC AGG (reversed) Intronic
905070689 1:35222685-35222707 TGAGAAATTATCTGAATAGCTGG + Intergenic
909051381 1:70772648-70772670 AGGCAAATTCTATGAATCACTGG - Intergenic
916469612 1:165109956-165109978 GGAGAACTTCTGTGAAACACTGG + Intergenic
916899877 1:169209930-169209952 CAAGAAATTATATTAATAACAGG - Intronic
918136388 1:181677827-181677849 GGAGAAGTTTTAGGAATAACAGG + Intronic
918154664 1:181832892-181832914 GGAGAAATTTTATGCCTAGCCGG + Intergenic
918910725 1:190564994-190565016 TGAGAAAATCTATAAATAAGTGG + Intergenic
920816280 1:209335945-209335967 GGACACACTTTATGAATAACAGG - Intergenic
922492882 1:226032604-226032626 GGAGACATTCAAGGAAAAACAGG + Intergenic
923835138 1:237603073-237603095 GAAGAAATTCAATGAAGGACGGG + Intronic
924387421 1:243511715-243511737 GGAGAAATACCATAAATAAGTGG - Intronic
1064927119 10:20581748-20581770 AGAGAAATTCTATGCAGAAAAGG + Intergenic
1065290725 10:24226968-24226990 GTAGAAATTCTGTGAATAACTGG - Intronic
1065518034 10:26544303-26544325 GGAGAAATTTTCTGAAACACTGG + Intronic
1066749855 10:38643518-38643540 GGAGAATCTCCTTGAATAACAGG + Intergenic
1066966787 10:42274202-42274224 GGAGAATCTCCTTGAATAACAGG - Intergenic
1068850036 10:61727490-61727512 AGAGAAATTCTGTGTATAAGGGG - Intronic
1071335595 10:84597903-84597925 GGTCAATTTCTATGAAGAACGGG + Intergenic
1072048540 10:91681180-91681202 GGAGAAATTCTCTAAAGAAGTGG - Intergenic
1072219131 10:93312937-93312959 GGAGTAAGTCTATGGATAAAGGG + Intronic
1072559279 10:96555436-96555458 GGAGGATATCTATGAAGAACCGG - Intronic
1074052175 10:109889949-109889971 GGAGAAACTGTATTAATAAGTGG - Intronic
1078203717 11:9209424-9209446 AGAGAAAGGCTATGAATCACTGG + Intronic
1078349947 11:10584390-10584412 GGAGAAATGTTATGAACAGCTGG - Intronic
1078659231 11:13273111-13273133 GGAGTAATTCTATCAATGACAGG + Intergenic
1080183821 11:29455451-29455473 TGACAAATTCTAAAAATAACAGG - Intergenic
1080354562 11:31427352-31427374 GTAGAAATTCAGTGAATAATTGG + Intronic
1080785187 11:35468946-35468968 GGAGAAATACAAGGAAGAACAGG + Intronic
1082744706 11:56949225-56949247 GGAGACAATCTCTGAATCACTGG + Intergenic
1085604699 11:77886494-77886516 GAAGAAATTCAATGAAGCACGGG + Intronic
1087208575 11:95422298-95422320 GTAGAAATTGTATCAAGAACAGG + Intergenic
1087497867 11:98913229-98913251 GGAGAAATTCAAAGGATAACTGG - Intergenic
1089912512 11:122116089-122116111 AGGGAAATTCCATGAATAGCAGG - Exonic
1090168575 11:124577944-124577966 GGAGATGTTCTCTAAATAACTGG - Intergenic
1091223054 11:133941892-133941914 GGAGAACTTCTCTGAAGAAATGG - Intronic
1092049830 12:5460542-5460564 GGAGAAATTCCTTGGATGACTGG - Intronic
1092455418 12:8638385-8638407 GGAGAAAGTCCATAAATAAGGGG + Intronic
1092519803 12:9258068-9258090 GGAGAAAGTCTATGAAAAAAAGG + Intergenic
1092744711 12:11662396-11662418 AGAGAAATTCTCAGAAGAACTGG - Intronic
1093188076 12:16044747-16044769 GTAGAACTTCTATGAATCAATGG - Intergenic
1093417182 12:18933402-18933424 GGAGAAATTCTGGGAGTAGCTGG - Intergenic
1096109934 12:49022589-49022611 GGAGAAAATCTACGAAGAGCAGG - Exonic
1098113638 12:67151334-67151356 GGAGAATTTCTTTAAATAACAGG - Intergenic
1099148184 12:79074536-79074558 GGTGAAATTCTATCAGCAACTGG - Intronic
1100575774 12:95890436-95890458 GGGTAAATTCTCTGAATCACTGG + Intronic
1101199597 12:102420818-102420840 GAAGAAATTTTATAAATCACGGG + Intronic
1105240276 13:18601577-18601599 GGGGAATTTCTATGAAGAAGAGG - Intergenic
1106843756 13:33714373-33714395 GCAGAAATTTTATGATTAAATGG - Intergenic
1108486608 13:50933235-50933257 GGAGAAATGCTATCAAAAAGGGG - Intronic
1108907929 13:55501642-55501664 GTAGAAAATCTCTGAAAAACTGG - Intergenic
1109037635 13:57286467-57286489 GGAGAACATTTATGAATAGCTGG - Intergenic
1109797123 13:67330295-67330317 AAAGAAATTCAATGAATTACAGG + Intergenic
1110154082 13:72292619-72292641 AGAGAAAATATATGAATAAAGGG + Intergenic
1117384108 14:55194134-55194156 GGAAGAATTCTCTGAATTACAGG + Intergenic
1117834611 14:59790440-59790462 GGAGAAAAATTATGAATAAAAGG - Intronic
1117989299 14:61418008-61418030 GGAGAAATTCAATAAACAGCTGG - Intronic
1121460863 14:94076870-94076892 GAAGAAATTCTGTGTATAAGTGG - Intronic
1122104566 14:99442481-99442503 GAAGAAAATCTATGTATAAGTGG - Intronic
1123149730 14:106169450-106169472 GGAGAAATAGTCTGAAAAACAGG + Intergenic
1123223488 14:106878331-106878353 GGAGAAATAGTCTGAAAAACAGG + Intergenic
1123547454 15:21351595-21351617 GGGGAATTTCTATGAAGAAGAGG + Intergenic
1123969548 15:25494227-25494249 AGAGAACTGCAATGAATAACAGG - Intergenic
1128200031 15:65797165-65797187 TGAGAAATTATAGGAGTAACAGG - Intronic
1128842551 15:70862018-70862040 GTAGAAATTCTAAGAAACACAGG + Intronic
1129421264 15:75428809-75428831 GGAGAAAATCCATGTATAAGTGG - Intronic
1129577589 15:76767355-76767377 TGTGAAATTATATAAATAACAGG + Intronic
1202955784 15_KI270727v1_random:78825-78847 GGGGAATTTCTATGAAGAAGAGG + Intergenic
1133610432 16:7428203-7428225 GGAGAAACTAAATGAATAAAAGG - Intronic
1134616084 16:15651824-15651846 GGATAAAATATATGAATCACAGG - Intronic
1135849409 16:25949679-25949701 GGAGAAATATCATGAATAAGGGG + Intronic
1136732861 16:32433572-32433594 GGAGAATATCCTTGAATAACAGG - Intergenic
1137665055 16:50245179-50245201 GGAGGAAATCTATGACAAACAGG - Intergenic
1137829842 16:51533917-51533939 GGAAGAATTCCATGAATAAGTGG + Intergenic
1203020220 16_KI270728v1_random:396031-396053 GGAGAATATCCTTGAATAACAGG + Intergenic
1203038555 16_KI270728v1_random:669189-669211 GGAGAATATCCTTGAATAACAGG + Intergenic
1144773499 17:17772265-17772287 GGAGAAATTCTAGAAATGTCAGG - Intronic
1145277102 17:21438528-21438550 TGAGTAATTCTATGAAAACCTGG + Intergenic
1145314938 17:21724421-21724443 TGAGTAATTCTATGAAAACCTGG + Intergenic
1149076611 17:52602912-52602934 AGCGAAATGCTATGAATAATAGG + Intergenic
1154448555 18:14457197-14457219 GGGGAATTTCTATGAACAAGAGG + Intergenic
1155106582 18:22672769-22672791 GAAGAAAATCCATGTATAACTGG - Intergenic
1155401808 18:25447676-25447698 GAGGAAATTCTATGAATAGCAGG + Intergenic
1156276250 18:35585344-35585366 TGAGCAAATCTATGAAAAACAGG - Intronic
1156878013 18:42039756-42039778 GGGTAAATACTATGAATAAAGGG - Intronic
1158701811 18:59755081-59755103 GGAGACATTTTAGGAATAAATGG - Intergenic
1159899605 18:74033540-74033562 GTAGAAATTCTGTGCACAACTGG + Intergenic
1162222418 19:9189161-9189183 GGAGAAATTCTAGGCAGAAAAGG + Intergenic
1162275711 19:9652782-9652804 GGAGAAATACTATGAATGTAAGG - Exonic
1162280256 19:9690914-9690936 AGAGAAATTCTGTGAATTTCAGG - Exonic
1162283925 19:9723670-9723692 GGAGAAACCCTATGAATATAAGG - Intergenic
1163057433 19:14731111-14731133 AGAGAAATTGAATGAATAAAGGG - Intronic
1164237973 19:23354008-23354030 GTAGTAATTCTTTGAATATCTGG - Intronic
1164415995 19:28046903-28046925 TGAGAATGGCTATGAATAACTGG - Intergenic
1164962705 19:32448734-32448756 GAAGAAAATCTATGTATAATTGG + Intronic
1168593309 19:57654263-57654285 GGGTAAATTCTATGGAAAACTGG - Intergenic
925500378 2:4497323-4497345 GGAGAAAATATATGAAAGACTGG - Intergenic
926220252 2:10931578-10931600 GGAGAAATTAGATGAATTAGAGG - Intergenic
927825050 2:26302663-26302685 GGAAAAAAGCTATGAATCACAGG + Intergenic
930345190 2:50171177-50171199 GAAGAAACTCTATGTATAAGTGG + Intronic
930766504 2:55090713-55090735 GGAGAAATTGTATGAGCAATTGG - Intronic
932052517 2:68412858-68412880 GGAAAAGTACAATGAATAACAGG - Intergenic
932837971 2:75055167-75055189 GGAGAAATTGAGTGAATAAGTGG - Intronic
934312850 2:91885694-91885716 GGAGAATCTCCTTGAATAACAGG + Intergenic
935758773 2:106299390-106299412 TGAGAAATTCTAGTAAAAACAGG + Intergenic
937519437 2:122693658-122693680 GGAGAAATTCTATCAACATGTGG - Intergenic
938563494 2:132495721-132495743 GGAGAAATTTTATCAGTATCTGG + Intronic
939745333 2:145960452-145960474 GGAGAAATTTTATGTCTAGCCGG - Intergenic
940185048 2:150975182-150975204 GTAGAAATTTCCTGAATAACAGG + Intergenic
940428847 2:153563735-153563757 GGAAAACTTCTATGAATAAATGG - Intergenic
941148085 2:161878416-161878438 GAAGAAATGCTAAGAATAAAGGG - Intronic
941196993 2:162465043-162465065 GGGGAAAGTCTAGGAATAAAAGG + Intronic
941484474 2:166062141-166062163 GAAGAAATCCTATGAAAAAATGG - Intronic
943547150 2:189294503-189294525 TGATAAATTCCAAGAATAACAGG - Intergenic
943549149 2:189317369-189317391 GAAGAAATTCTATTAAAAAATGG - Intergenic
944890286 2:204110216-204110238 GAAGACATTCTACTAATAACAGG + Intergenic
945664111 2:212720751-212720773 GGAGAACTTCTATGTCTAGCTGG - Intergenic
945770243 2:214034074-214034096 GGAGACATTCTATAAATAGCTGG - Intronic
945781260 2:214175352-214175374 AGAGAAATTCTGTGAATAAAAGG + Intronic
946992928 2:225355916-225355938 GGTAAAATTCTATGAAAAACAGG + Intergenic
947555122 2:231085436-231085458 AGAGAAATTCAGTGAAGAACAGG + Intronic
1169961975 20:11170491-11170513 GGAGAAATTCTATTCCTAAAAGG - Intergenic
1170419320 20:16176877-16176899 GAAGAAAATCTATGAATATGTGG - Intergenic
1172015827 20:31872190-31872212 GGAGAACCTCTCTGAATAAGTGG + Intronic
1173760158 20:45552916-45552938 AGAGCAATGCTATGAATTACTGG + Intronic
1175643116 20:60648438-60648460 GGATAAATTATAGGAATATCAGG + Intergenic
1175653247 20:60747268-60747290 CGAGAAATGCTATGGATAAGGGG - Intergenic
1176447678 21:6833322-6833344 GGGGAATTTCTATGAACAAGAGG - Intergenic
1176825847 21:13698348-13698370 GGGGAATTTCTATGAACAAGAGG - Intergenic
1177051801 21:16245243-16245265 AGAGAAATTATATGTATATCAGG + Intergenic
1177366714 21:20149160-20149182 GGAGAAAATCTGTGTATAAGTGG + Intergenic
1178159735 21:29898129-29898151 GGGAAAATTCTATTAATACCAGG - Intronic
1179021637 21:37646344-37646366 TGTGAAATTCTAGTAATAACAGG + Intronic
1180539591 22:16431551-16431573 GGAGAATATCCTTGAATAACAGG + Intergenic
949218802 3:1604593-1604615 GGAGTAAATATATGAATCACAGG + Intergenic
950073826 3:10172975-10172997 GGCCAAACTCTATGAAAAACAGG + Intronic
952098720 3:29985938-29985960 GAAGAAATTCTGTGAATTAGAGG - Intronic
952388173 3:32858131-32858153 GAAGAAAATCTATGTATAAGTGG + Intronic
952725863 3:36583314-36583336 AGAAAAATTCTATGAATTACTGG - Intergenic
953168646 3:40487782-40487804 GGAGAAACCCTATGAATGCCAGG + Exonic
954249595 3:49357817-49357839 GGAGATTTTCTATGAGTCACCGG + Intronic
954849271 3:53586668-53586690 GGAGAGGTACTAGGAATAACAGG - Intronic
955049564 3:55396822-55396844 GGAGAAATGCTAAGAACAATGGG + Intergenic
957389522 3:79545937-79545959 GAAGAAACTCTGTGAATAAGTGG - Intronic
957534152 3:81479448-81479470 TGAGAAGTACTAGGAATAACTGG + Intergenic
957540074 3:81556776-81556798 GGAGAAATTCTTTATTTAACTGG - Intronic
958480507 3:94640289-94640311 GTATAAATTCTTTGAATATCTGG + Intergenic
959315487 3:104800754-104800776 GGAGAAATCCTATAATTAAATGG + Intergenic
959515635 3:107263740-107263762 GGAGAATTTCTAGGAATTCCAGG + Intergenic
960397068 3:117150923-117150945 GGGGAAATTGTATGATTAAATGG + Intergenic
960648371 3:119916272-119916294 GGTGAAATGCTATGGATTACTGG + Intronic
962081799 3:132147590-132147612 GGATAAATTCTATGAATGGCTGG - Intronic
963880992 3:150528020-150528042 GCAGCAATTCTCTGAAAAACTGG - Intergenic
964246073 3:154655359-154655381 GAAGAAATTATATGATGAACGGG - Intergenic
964381723 3:156104285-156104307 GGAGAAAATCTATCAGAAACAGG - Intronic
965744108 3:171906810-171906832 GGAGAACTTCTATGTCTAGCTGG - Intronic
966230129 3:177642451-177642473 GAAGTAATTATATGAATAAATGG + Intergenic
970687267 4:18582849-18582871 GAAGAAAGCCTATGAATAATGGG + Intergenic
971440006 4:26674490-26674512 GGATAACTTCTATGATTAATGGG - Intronic
971487816 4:27178292-27178314 CGAGAAATTCTCTGAAGAAACGG + Intergenic
971606980 4:28670440-28670462 GAAGAATTTCTATGAATATGAGG - Intergenic
971872087 4:32254501-32254523 GGAGAAATTCAAAGAGAAACTGG - Intergenic
972216367 4:36901198-36901220 GGTCAAATTTTATTAATAACTGG - Intergenic
972223934 4:36989949-36989971 GGAGAAATTCTATAGAAAAATGG + Intergenic
972242280 4:37205841-37205863 GGGGAAATTCTAGTGATAACAGG - Intergenic
972717415 4:41661234-41661256 GGAGACATTCTATGGAGAACAGG - Intronic
974375267 4:61068207-61068229 GTAGAAATTGTCTAAATAACAGG - Intergenic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
974838137 4:67275009-67275031 GGAGAAATTTTATGTTTAGCTGG - Intergenic
974892208 4:67896443-67896465 GGAGAACTTCTATGTCTAGCTGG - Intergenic
974977194 4:68905811-68905833 GGTGAAATGCTAGGAAAAACAGG - Intergenic
975750910 4:77522775-77522797 GAAGAAATTGTATCAATAAACGG - Intronic
976096436 4:81513189-81513211 GGAGAAATGATGGGAATAACTGG + Intronic
976113510 4:81701874-81701896 AGAGAAAGTGTATGAATAAACGG - Intronic
976130076 4:81874595-81874617 GGAGACATTCTATGACTGCCTGG - Intronic
977338759 4:95730425-95730447 AGAGAAATTCTAGGCATAAAAGG - Intergenic
977490874 4:97708512-97708534 GGAAAAATTCTTAGAATCACTGG - Intronic
979606811 4:122646890-122646912 GGAGAATTTCTAAGAAGAAATGG + Intergenic
982539157 4:156645694-156645716 GGGGAAATTATATGTATACCAGG - Intergenic
982683265 4:158458550-158458572 GGAGGAATTCTCTGATTACCAGG + Intronic
982837379 4:160137288-160137310 GGAGAAAATCTGTGTATAAGTGG + Intergenic
983714138 4:170756145-170756167 TGACAAATTCTATGAATTATTGG - Intergenic
984304081 4:177964583-177964605 GGAGAAATCAAAGGAATAACAGG - Intronic
985127584 4:186710670-186710692 GGAGACATTCTGTGAACAACTGG - Intronic
987310773 5:16679239-16679261 GGAGACCTTCTAGGAGTAACCGG - Intronic
987824500 5:23011587-23011609 GGATAAATACTATGAATAGCTGG - Intergenic
988026263 5:25694367-25694389 GTGGAAATTCTGTGAAAAACAGG + Intergenic
988936569 5:36089336-36089358 GGATAAATTCACTGAATAAATGG - Intergenic
990102160 5:52204273-52204295 GGAGAAATTGTATGATTGACAGG - Intergenic
991412146 5:66356168-66356190 GGGAAAATGCTATGAATAATGGG + Intergenic
991500898 5:67276262-67276284 GGAGAAAATCTTTGCAAAACTGG - Intergenic
992048959 5:72925970-72925992 GGAGAACTTTTATGTCTAACTGG + Intergenic
992240130 5:74760109-74760131 GGAGAAATGGTTTAAATAACAGG - Intronic
992658472 5:78933993-78934015 GGAGAAAGTCAAAGAATAAGGGG + Intronic
993827047 5:92702916-92702938 TGATAAATTATATGAATAAGAGG + Intergenic
994332965 5:98528822-98528844 CAAGGAACTCTATGAATAACTGG + Intergenic
994494206 5:100489003-100489025 GCAGAAATTCTATAAGTAATGGG - Intergenic
995582716 5:113617790-113617812 GGAGAAATTTTATGTCTAGCTGG + Intergenic
995789340 5:115867526-115867548 TGAGAAATACTCTGGATAACAGG + Intronic
996746030 5:126846656-126846678 GGGGAAATTCCATGAAAAAAAGG + Intergenic
999170866 5:149593864-149593886 GAAGAAATTCTGTGTATAAGTGG + Intronic
999794573 5:154977053-154977075 GGACAAATTCCATTTATAACAGG - Intergenic
1000664283 5:163975580-163975602 GAAGAAAATCCATGAATAAGTGG - Intergenic
1001130629 5:169060729-169060751 AGAGAAGTTCTATGAACAACAGG + Intronic
1004034610 6:11911120-11911142 GAAGAAAATCTACGTATAACTGG + Intergenic
1005060473 6:21772407-21772429 GGAGATATTCTTTGAAAGACTGG + Intergenic
1006301346 6:33194985-33195007 GGAGAAAGTGTATGCATCACTGG - Exonic
1006434034 6:34017052-34017074 GGAGAACTTTTATGTCTAACTGG - Intergenic
1007051460 6:38835364-38835386 GGAGAAATTTGATGAAGAAGTGG + Intronic
1008367917 6:50704330-50704352 GGAGACATTCCAAGAATCACTGG + Intergenic
1008572432 6:52829031-52829053 GGAGAACTTCTATGTCTAGCTGG - Intergenic
1010088050 6:71944643-71944665 GGAGAATTTTTATGAAAAACAGG + Intronic
1010736545 6:79450338-79450360 AGAGAAATTCTAGGAAGAAAAGG + Intergenic
1012457231 6:99421124-99421146 GGAGAAATTTGATTAATGACGGG + Intronic
1013036197 6:106386252-106386274 GGAGAGCTTCTTTGAAAAACGGG - Intergenic
1014252270 6:119127182-119127204 AGAGAAATTCTAGGCATAAAAGG - Intronic
1016096827 6:140048120-140048142 GGAAAAAATCAATAAATAACTGG - Intergenic
1016209567 6:141512641-141512663 GGAAAAATACTATGCACAACAGG + Intergenic
1016642492 6:146365466-146365488 GGAGAAATGCTGTGAATCATGGG + Intronic
1016786738 6:148018934-148018956 GAACAAATTCCATGAATAATAGG - Intergenic
1017871768 6:158492994-158493016 GAAGAAATTATAAGAATCACTGG + Intronic
1018567726 6:165173458-165173480 GGAGAAATTCTGTGAAACAATGG + Intergenic
1018854483 6:167665878-167665900 TGAGAAATTCTTTAAATTACAGG - Intergenic
1020483363 7:8690294-8690316 GCAGAAAGTCTATTAATAAATGG + Intronic
1021855854 7:24855055-24855077 GTAGAAATTCTAGGAATGAGGGG + Intronic
1023378094 7:39578118-39578140 GGAGAACTTCTATGTCTAGCTGG + Intronic
1027423362 7:78038786-78038808 TGAGAAATTCTATGCTTCACAGG + Intronic
1029215622 7:98947161-98947183 GGAGAATTCCTTTGAATGACAGG + Intronic
1030873369 7:114784635-114784657 GGAGAAATACTAAGATTACCTGG + Intergenic
1032106626 7:129036762-129036784 GGAGAATTTCCATTAATAAATGG + Intronic
1032730628 7:134638715-134638737 GGAGGAATTCAATGAATAATTGG + Intergenic
1034906633 7:154953780-154953802 AGAGAAATTCTTTTACTAACAGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1038268682 8:26057087-26057109 GGAAAAATGCTATCAATAAGTGG - Intergenic
1039276413 8:35937757-35937779 GGAGAAATTCTCTTCAGAACAGG + Intergenic
1039448989 8:37656441-37656463 GTAGAAATTCTATAAATATTTGG - Intergenic
1040049068 8:42993807-42993829 GGAGAAATTCAAAGGATTACTGG - Intronic
1040840943 8:51783721-51783743 GGAGAAATTCCATGTGTAACAGG + Intronic
1041052247 8:53946554-53946576 GAAGAAATTCTATTAATACTTGG + Intronic
1042121823 8:65496667-65496689 GTAAAAATTCAATGAATGACAGG + Intergenic
1042519003 8:69690299-69690321 GAAGAAATTCAATGAAGCACAGG - Intronic
1048591814 8:135827360-135827382 GGAAAAATCTTATCAATAACTGG - Intergenic
1048753782 8:137711545-137711567 GGAGTAGCTATATGAATAACAGG - Intergenic
1051887246 9:21905992-21906014 TGAGAAATTAACTGAATAACTGG + Intronic
1052501927 9:29302998-29303020 GGAGAATATCTAAGAATAAAGGG - Intergenic
1052609390 9:30752290-30752312 GCAGATAGTCTATGAATAAGTGG - Intergenic
1052962431 9:34310766-34310788 TGAGAGATTCTTTGAATAATGGG + Exonic
1056464680 9:86842196-86842218 GGAGAACATCTATGTATAAGTGG - Intergenic
1059712083 9:116877815-116877837 GGAGAATTTCTATGACTAAATGG - Intronic
1203521513 Un_GL000213v1:51209-51231 GGGGAATTTCTATGAACAAGAGG + Intergenic
1185528191 X:795849-795871 GGAAAAATTTGATCAATAACTGG + Intergenic
1186393508 X:9184508-9184530 AGAGAAATTTTCTTAATAACTGG - Intergenic
1186749739 X:12609255-12609277 GAAGAAAATCTATGTATAAGTGG + Intronic
1186920384 X:14272077-14272099 CTAAAAATTCTATGAATCACAGG - Intergenic
1188649125 X:32609358-32609380 GTAGTAGTTCTATGAGTAACAGG - Intronic
1188751982 X:33915444-33915466 GGAGAAATTCCAGGTATCACTGG - Intergenic
1188985886 X:36768011-36768033 GGAGAAATTACATGAATTAATGG - Intergenic
1189247951 X:39578104-39578126 GGAGAAATTCTCAGAGTATCAGG + Intergenic
1191102482 X:56746827-56746849 GGAGAAATTCTAAGTATGAGAGG - Intergenic
1192046679 X:67682680-67682702 GGAGAAATTGAATAAATAATAGG + Intronic
1193455473 X:81726304-81726326 AGATCAATTCTATGAATCACTGG + Intergenic
1194337301 X:92664297-92664319 GGAAAAATTGTATGCAAAACAGG + Intergenic
1194495489 X:94612583-94612605 GGAAGAATTCTCTGAATTACCGG + Intergenic
1195090913 X:101458061-101458083 GGAAAATTTCTCTCAATAACTGG + Intronic
1195940270 X:110161941-110161963 TGAGAATTTTTATTAATAACAGG - Intronic
1197037641 X:121895741-121895763 GGAGAAAATCCATGTATAAGTGG - Intergenic
1198483245 X:137060447-137060469 GAAGAAAATCTATGTATAAGTGG - Intergenic
1198522973 X:137471459-137471481 GGAGAAATTCTGAGAATAGTTGG - Intergenic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1199599581 X:149534034-149534056 GGAGAAGGTCTCTGAATATCTGG + Intergenic
1201180793 Y:11343187-11343209 GGAGAATATCCTTGAATAACAGG + Intergenic