ID: 1198670262

View in Genome Browser
Species Human (GRCh38)
Location X:139072385-139072407
Sequence CTCTGATGGCACCTTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5019
Summary {0: 3, 1: 33, 2: 412, 3: 1410, 4: 3161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198670257_1198670262 17 Left 1198670257 X:139072345-139072367 CCTTCTGCAAGTCAGAAAGGGAG 0: 1
1: 5
2: 71
3: 363
4: 1031
Right 1198670262 X:139072385-139072407 CTCTGATGGCACCTTGATCTTGG 0: 3
1: 33
2: 412
3: 1410
4: 3161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198670262 Original CRISPR CTCTGATGGCACCTTGATCT TGG Intronic
Too many off-targets to display for this crispr