ID: 1198671394

View in Genome Browser
Species Human (GRCh38)
Location X:139084532-139084554
Sequence AGTGGAGCCGCGAAGCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198671391_1198671394 2 Left 1198671391 X:139084507-139084529 CCTGTTTAGCTCTGTGATCTGGG 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1198671394 X:139084532-139084554 AGTGGAGCCGCGAAGCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 168
1198671389_1198671394 20 Left 1198671389 X:139084489-139084511 CCATAATCTTTGCATTCGCCTGT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1198671394 X:139084532-139084554 AGTGGAGCCGCGAAGCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198671394 Original CRISPR AGTGGAGCCGCGAAGCATCA AGG Intronic
900086087 1:898054-898076 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
900459786 1:2797383-2797405 AGTGGGGCCACGAGGCATCCTGG - Intronic
901385823 1:8908485-8908507 AGAGGAGCTCAGAAGCATCAGGG - Intergenic
902391224 1:16108158-16108180 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
902965486 1:19998046-19998068 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
903043974 1:20552526-20552548 GGTGGAGCCGCGACGCCTGAAGG + Exonic
911136398 1:94445420-94445442 AGGGGAGCTCGGAAGCATCAGGG + Intronic
914318551 1:146537158-146537180 AGAGGAGCTGCGCAGCATCCTGG - Intergenic
914495809 1:148196199-148196221 AGAGGAGCTGCGCAGCATCCTGG + Intergenic
914982094 1:152424023-152424045 AGGGGAGCTAGGAAGCATCAGGG - Intergenic
915179748 1:154047975-154047997 AGGGGAGCTTGGAAGCATCAGGG + Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
918113499 1:181478432-181478454 AGTGGAGCAGAGGAGCATTATGG - Intronic
919288661 1:195600048-195600070 AGTGGAGAAGGGAAGCAACAGGG - Intergenic
920427701 1:205891320-205891342 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
924708692 1:246517805-246517827 AGTGGAGCCGCCATGCTTCCCGG + Intergenic
924765140 1:247025272-247025294 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1066068240 10:31778216-31778238 AGCAGAACCTCGAAGCATCAGGG + Intergenic
1066802954 10:39210214-39210236 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1066990652 10:42510107-42510129 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1069491880 10:68867980-68868002 AGGGGAGCTTAGAAGCATCAGGG - Intronic
1070894910 10:79975429-79975451 AGGGGAGCTTGGAAGCATCAGGG - Intronic
1076108249 10:127841681-127841703 AGTGGAGTGGGGAAGCATCCAGG - Intergenic
1080407185 11:31989903-31989925 AGAGGAGCAGAGAAGCATGATGG + Intronic
1085017655 11:73185822-73185844 GGTGGAGCTGTGAGGCATCATGG - Intergenic
1088491929 11:110396849-110396871 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1093653740 12:21673276-21673298 AATGAAGCCGCGAACCCTCACGG + Intronic
1094492158 12:30967500-30967522 AGTGGAGCTGAGAAGAAGCAGGG - Intronic
1095913029 12:47448110-47448132 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1100335719 12:93627071-93627093 AGTGCAGCCGCAAACCATGAGGG - Intergenic
1100414340 12:94356196-94356218 AGGGGAGCTCTGAAGCATCAGGG + Intronic
1105352323 13:19626958-19626980 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1105469968 13:20684761-20684783 AGGGGAGCTCGGAAGCATCAGGG - Intronic
1108865683 13:54919749-54919771 AGGGGAGCTCAGAAGCATCAAGG - Intergenic
1122652763 14:103234634-103234656 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1202843835 14_GL000009v2_random:148778-148800 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1202913237 14_GL000194v1_random:139022-139044 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1202879414 14_KI270722v1_random:43663-43685 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1123789055 15:23701328-23701350 AGGGGAGCTTGGAAGCATCAGGG - Intergenic
1123984911 15:25636695-25636717 AGGGGAGCTTGGAAGCATCAGGG + Intergenic
1127921294 15:63496359-63496381 AATGGAGCCCAGAAGCAGCAAGG - Intergenic
1128549071 15:68586020-68586042 AGTGGAACCCCAAATCATCAGGG - Intronic
1133044639 16:3080931-3080953 AGGGGAGCTCGGAAGCATCAGGG - Intronic
1133953992 16:10423825-10423847 AGGGGAGCTCGGAAGCATCAGGG - Intronic
1134635730 16:15790442-15790464 AGTGGAGCCCAGCAGCAACATGG - Intronic
1136982952 16:35074854-35074876 AGGGGAGCTTGGAAGCATCAGGG - Intergenic
1139695088 16:68668441-68668463 AGTGGTGCCAGGAAGCATCTGGG + Intronic
1141086741 16:81101188-81101210 AGAGGAGCCTGGAAGCAGCAGGG - Intergenic
1143933804 17:10460975-10460997 ACTGGAGCCGTGATGCATTATGG - Exonic
1145100398 17:20072009-20072031 AGTGGAGCTGCCAATCATCCAGG + Intronic
1145801025 17:27684859-27684881 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1146101901 17:29991112-29991134 AGGGGAGCTCGGAAGCATCAGGG - Intronic
1146293963 17:31633731-31633753 AGGGGAGCTAGGAAGCATCAGGG + Intergenic
1148875927 17:50687216-50687238 AGTGAAGCAGAGAAACATCACGG + Intronic
1162252127 19:9454515-9454537 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1162283236 19:9717311-9717333 AGGGGAGCTTGGAAGCATCAGGG - Intergenic
1162642491 19:12022630-12022652 AGGGGAGCTTGGAAGCATCAGGG + Intronic
1164032267 19:21418387-21418409 AGGGGAGCTTGGAAGCATCAGGG - Intronic
1164262060 19:23576664-23576686 AGGGGAGCTCAGAAGCATCAGGG - Intronic
1165442228 19:35835668-35835690 AGGGGAGCCGGGAGGGATCAGGG + Intronic
1165866244 19:38941181-38941203 AGGGGAGCTCGGAAGCATCAGGG - Intronic
1165965088 19:39570668-39570690 TGTGGAGCCTGGAAGCATTAAGG - Intergenic
1167863769 19:52307359-52307381 AGGGGAGCTCAGAAGCATCAGGG - Intronic
1202655032 1_KI270708v1_random:12672-12694 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
927117918 2:19923382-19923404 AGGGGAGCTCGGAAGCATCAGGG + Intronic
927262015 2:21101515-21101537 AGTGAAGCCGCGGAGCCTCGCGG + Intergenic
930183169 2:48385143-48385165 AGGGGAGCTCGGAAGCATCAAGG + Intergenic
930183174 2:48385163-48385185 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
935026040 2:99277947-99277969 AGGGGAGCTCAGAAGCATCAAGG - Intronic
935743996 2:106175066-106175088 AGTGGGGCAGCGAAGCCTCCTGG + Intronic
935915792 2:107948011-107948033 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
936164386 2:110107189-110107211 AGTGGAGCCCCCAAGTACCAAGG + Intronic
936799650 2:116251989-116252011 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
940311010 2:152279107-152279129 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
944058324 2:195546542-195546564 AATGAAGCCGCGGAGCCTCACGG + Intergenic
946206534 2:218112889-218112911 AGAGGAGCTCAGAAGCATCAGGG + Intergenic
946500098 2:220238152-220238174 GGTGGTGCCTCTAAGCATCATGG - Intergenic
948966328 2:241383507-241383529 AGTGGAGCAGAGAGGCATCTAGG + Intronic
1169928300 20:10805948-10805970 AGTCGAGCCGCTGAGCCTCAAGG - Intergenic
1171229049 20:23467557-23467579 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1173066882 20:39721653-39721675 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1173168139 20:40700561-40700583 AGTGGGGCAGGGAAGCAGCAAGG + Intergenic
1176632587 21:9153692-9153714 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1176640718 21:9301127-9301149 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1178462250 21:32813606-32813628 AGTGGAGAGGCGAGGCCTCACGG - Intronic
1180349742 22:11790510-11790532 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1180374030 22:12073960-12073982 AGGGGAGCTCTGAAGCATCAGGG + Intergenic
1180388461 22:12201729-12201751 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1185006220 22:48278373-48278395 ACTGGAGCCTCCAAGCCTCAGGG + Intergenic
952938517 3:38421378-38421400 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
954231295 3:49219772-49219794 AGGGGAGCTCGGAAGCATCAGGG + Intronic
954578421 3:51689793-51689815 AGTGGAGCTGGGAGGCACCAGGG + Intronic
954622077 3:52002116-52002138 AGTGGAGGCGAGTAGCACCAGGG + Intergenic
955090863 3:55749306-55749328 AGTGGAGCTGGGAAGCCTCAAGG - Intronic
959197892 3:103209569-103209591 AGGGGAGCTTGGAAGCATCAGGG + Intergenic
960788370 3:121399223-121399245 AGGGGAGCTCAGAAGCATCAGGG - Intronic
961323216 3:126092732-126092754 AGGGGAGCTCAGAAGCATCAGGG + Intronic
961859299 3:129901871-129901893 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
962177443 3:133168824-133168846 AGTGAAGCCGCAAACCTTCACGG - Intronic
963995316 3:151701909-151701931 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
966009405 3:175056359-175056381 AGGGGAGCTCAGAAGCATCAGGG - Intronic
1202746175 3_GL000221v1_random:103897-103919 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
969895738 4:10302843-10302865 AGGCGAGCCTAGAAGCATCAGGG - Intergenic
972080192 4:35140376-35140398 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
974635824 4:64563228-64563250 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
975352052 4:73357775-73357797 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
976557009 4:86461537-86461559 AGGGGAGCTTGGAAGCATCAGGG + Intronic
977016812 4:91701350-91701372 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
977626060 4:99190883-99190905 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
977641977 4:99367685-99367707 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
977653044 4:99491636-99491658 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
977857006 4:101906713-101906735 AGGGGAGCTCAGAAGCATCAGGG - Intronic
980667696 4:135960387-135960409 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
981197755 4:141940966-141940988 AGGGGAGCTTGGAAGCATCAGGG - Intergenic
982282075 4:153693774-153693796 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1202755613 4_GL000008v2_random:59399-59421 AGGGGAGCTCTGAAGCATCAGGG + Intergenic
985736166 5:1584744-1584766 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
985736204 5:1584951-1584973 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
987574037 5:19703316-19703338 AGGGGAGCTTGGAAGCATCAGGG + Intronic
988811167 5:34786599-34786621 AGGGGAGCTCGGAAGCATCAGGG - Intronic
989742469 5:44789213-44789235 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
989758690 5:44986865-44986887 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
990109395 5:52305126-52305148 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
994043673 5:95284878-95284900 ACTGGAGCCGCGGAGCTTCGAGG - Intergenic
995032459 5:107495220-107495242 AGTGGAGCCGCAGATCTTCATGG - Intronic
996291806 5:121860307-121860329 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1002901083 6:1410252-1410274 AGCGGAGCCCCGAGTCATCACGG + Intergenic
1005944515 6:30585642-30585664 AGTGGAGCCGCTGGGCATCGAGG - Exonic
1007886526 6:45236357-45236379 AGGGGAGCTCAGAAGCATCAGGG + Intronic
1009955548 6:70448405-70448427 AGGGGAGCTCAGAAGCATCAGGG - Intronic
1014863943 6:126505472-126505494 AGGGGAGCTTGGAAGCATCAGGG + Intergenic
1017328661 6:153170577-153170599 AGTGGAGCAACGAGGCAGCAAGG - Intergenic
1023804703 7:43864347-43864369 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1023861826 7:44221307-44221329 AGTGGGGCCGGGAAGCTGCAGGG - Intronic
1024911221 7:54449478-54449500 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1025122561 7:56317568-56317590 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1026549788 7:71358143-71358165 AATGGAGCCGCGGATCTTCATGG - Intronic
1034581183 7:152043904-152043926 AGGGGAGCTTGGAAGCATCAGGG - Intronic
1034942911 7:155243532-155243554 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1038733808 8:30151242-30151264 AGGGGAGCTCAGAAGCATCAGGG - Intronic
1039234337 8:35485584-35485606 AGTTGTGCCACGAAGCAGCAAGG - Intronic
1039691661 8:39871019-39871041 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1040318766 8:46278669-46278691 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1040466956 8:47704466-47704488 CGTGGAGCCAGGAAGCACCAGGG - Intronic
1040528954 8:48249860-48249882 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1042169312 8:65976803-65976825 AATGGAGCCGCGGACCCTCACGG + Intergenic
1044442345 8:92237178-92237200 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1049857449 8:144871680-144871702 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1053126184 9:35582593-35582615 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1057094403 9:92292681-92292703 TGTGGAGCAGCGAAGAGTCAAGG - Intronic
1060326446 9:122620774-122620796 AGGGGAGCTTGGAAGCATCAGGG - Intergenic
1061428339 9:130515390-130515412 AGTGGAGCCGAGGATCCTCAAGG + Intergenic
1061589841 9:131591258-131591280 AGTGGAGCAGTGAAGGCTCAGGG + Intronic
1061602565 9:131681007-131681029 AGGGGAGCTCAGAAGCATCAGGG + Intronic
1062703594 9:137921477-137921499 ACTGCAGCCGCGCAGCATCCTGG + Intronic
1062703636 9:137921876-137921898 ACTGCAGCCGCGCAGCATCCTGG + Intronic
1203755419 Un_GL000218v1:121316-121338 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1203714795 Un_KI270742v1:133856-133878 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1203536416 Un_KI270743v1:44235-44257 AGGGGAGCTCTGAAGCATCAGGG + Intergenic
1191580843 X:62759069-62759091 AGGGGAGCTTGGAAGCATCATGG - Intergenic
1192687721 X:73324482-73324504 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1193048639 X:77078537-77078559 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1193314033 X:80043280-80043302 AGGGGAGCTCGGAAGCATCAGGG + Intergenic
1194536270 X:95108609-95108631 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1195940169 X:110161349-110161371 AGTGGAGCAGGGAAGCCTCATGG - Intronic
1196471683 X:116035842-116035864 AGGGGAGCTCAGAAGCATCAGGG + Intergenic
1198671394 X:139084532-139084554 AGTGGAGCCGCGAAGCATCAAGG + Intronic
1200970818 Y:9150671-9150693 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1201169036 Y:11238922-11238944 AGGGGAGCTCGGAAGCATCAGGG - Intergenic
1201363136 Y:13175191-13175213 AGGGGAGCTCAGAAGCATCAGGG - Intergenic
1202140212 Y:21713642-21713664 AGGGGAGCTCAGAAGCATCAGGG + Intergenic