ID: 1198671710

View in Genome Browser
Species Human (GRCh38)
Location X:139088206-139088228
Sequence TGGGTAAACCCCCAGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198671710 Original CRISPR TGGGTAAACCCCCAGAGGCT GGG (reversed) Intronic
900432077 1:2607202-2607224 GGTGTAAAGGCCCAGAGGCTGGG - Intronic
901179365 1:7330539-7330561 TGGGTGAACCCCAACAGGATTGG + Intronic
902586797 1:17444378-17444400 TGGGAAAATCGCCAGAGCCTGGG + Intergenic
902827871 1:18989507-18989529 TGGGTAACAGCCCAAAGGCTAGG - Intergenic
904119952 1:28191343-28191365 TGGGAAAGCCCACAGAGCCTGGG + Intronic
905743694 1:40394640-40394662 TAGGGAAACCCCCAAAGACTTGG + Intronic
906315289 1:44783180-44783202 TGGGCAGATCCCCAGAGGCCAGG - Intergenic
907663848 1:56417190-56417212 TGGGAAAACCACTAGAGCCTGGG + Intergenic
910499499 1:87873289-87873311 TGGGTCATTCCCCAGAGACTGGG + Intergenic
912588478 1:110788584-110788606 TGAGGAAACCCCTAGAAGCTTGG - Intergenic
913280356 1:117179594-117179616 TGGGTAAACACACAGGGGGTGGG + Intronic
915019345 1:152764747-152764769 TGGCAAATCCCCCAGGGGCTTGG + Intronic
918240446 1:182615784-182615806 TGGTTAAGCCCACAGAGGCTGGG - Intergenic
920614954 1:207482818-207482840 TGAATAAAGGCCCAGAGGCTTGG + Intronic
921784653 1:219215498-219215520 TGAGTAAACACCCTCAGGCTGGG - Intergenic
1063690540 10:8282899-8282921 TGGCTAAAGCCAAAGAGGCTGGG - Intergenic
1064285063 10:13984860-13984882 TGGGTAAATCCCCAAAGGAATGG - Intronic
1066706138 10:38180541-38180563 TGGGTAAAGCAACATAGGCTAGG - Intergenic
1067316039 10:45163763-45163785 TGGGTAAGACATCAGAGGCTTGG - Intergenic
1068500717 10:57837965-57837987 TGGGTATTCCCCTAGAGGTTGGG - Intergenic
1069111340 10:64451102-64451124 TAGCTAATCCCTCAGAGGCTTGG + Intergenic
1069474622 10:68721570-68721592 AGGGTAAAACCGCAGCGGCTCGG - Intronic
1069482170 10:68793635-68793657 TGGGTAGACCACTTGAGGCTAGG - Intergenic
1069533908 10:69239309-69239331 TGGATGAACCCACAGAGCCTTGG + Intronic
1069704697 10:70451067-70451089 TGGCTCCACCCCAAGAGGCTGGG - Intergenic
1069801474 10:71084495-71084517 TGGATAGATCCCCAGAGCCTGGG + Intergenic
1071534208 10:86414277-86414299 TGTCTAAAATCCCAGAGGCTAGG - Intergenic
1072189735 10:93069696-93069718 TGAGTATAACCCCAGAAGCTGGG + Intergenic
1074159932 10:110829081-110829103 TGGTTCATCCTCCAGAGGCTGGG + Intronic
1074780749 10:116800330-116800352 TGGGGAAGCTCACAGAGGCTTGG + Intergenic
1077231258 11:1459064-1459086 TGGGTAGGGCCCCAGAGGCATGG - Intronic
1080045014 11:27799315-27799337 GGGGTAGGCTCCCAGAGGCTTGG - Intergenic
1080409884 11:32013662-32013684 TGGGTAAATCTTCAGAGGGTCGG - Intronic
1080656918 11:34265431-34265453 TGGGCAAATCACCTGAGGCTGGG + Intronic
1084258183 11:67956530-67956552 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1084738586 11:71122763-71122785 CTGGTAAGCCCCCAGAAGCTGGG + Intronic
1084752488 11:71213441-71213463 TGGATAAATCCCCAGGGGCAAGG + Intronic
1084814563 11:71638684-71638706 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
1087273631 11:96138648-96138670 CGGGTAAACCACCAGGGACTGGG + Intronic
1088035900 11:105315434-105315456 TGGGGAAACTCTCTGAGGCTAGG - Intergenic
1088741014 11:112766761-112766783 TAGGCAATCCCCCTGAGGCTGGG + Intergenic
1090287008 11:125508369-125508391 TGGGAAAAGCTCCACAGGCTAGG + Intergenic
1091287853 11:134418293-134418315 TGGGTGCAGCCACAGAGGCTTGG - Intergenic
1091725996 12:2846676-2846698 TGGGTAAATTCCCAGAGCCCTGG + Intronic
1091758700 12:3073052-3073074 TGGGTGAATCCCCTGAGGTTAGG - Intergenic
1092428431 12:8391331-8391353 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1092429512 12:8397483-8397505 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1092996892 12:13959283-13959305 TAGGTGAACGCCCAGAGACTGGG + Intronic
1094082792 12:26555786-26555808 TGCATAAACACCCAGAGACTGGG - Intronic
1095408950 12:41901202-41901224 TGGGTAAATACCCAGAGGTAGGG - Intergenic
1097122478 12:56745709-56745731 TGGGTGAATCACCTGAGGCTAGG + Intronic
1097248841 12:57621371-57621393 AGGGACAACCCCAAGAGGCTCGG - Exonic
1098626530 12:72678001-72678023 TGGCTAAAGCAGCAGAGGCTGGG - Intergenic
1100213009 12:92417602-92417624 TGGGTAAATTCCCAGTGGTTGGG - Intergenic
1102997961 12:117364284-117364306 TGGGGAAACCACCAGAGGGAGGG - Intronic
1103477277 12:121228000-121228022 TGGGAGAACCCCCTGAGCCTGGG + Intronic
1103647293 12:122404367-122404389 TGGGTAAATCACTTGAGGCTAGG + Intronic
1104284872 12:127415838-127415860 TGCTTTAACCCCCAGAGCCTGGG - Intergenic
1107014009 13:35694775-35694797 TGGGGAAACCCCCAGAGGCTGGG + Intergenic
1107454012 13:40537588-40537610 TGGGTAAATCCCCTGCTGCTCGG + Intergenic
1112241721 13:97688325-97688347 TAAGGAAACCCCCTGAGGCTGGG + Intergenic
1113334851 13:109367866-109367888 CCGGCAGACCCCCAGAGGCTGGG + Intergenic
1113567462 13:111327409-111327431 AGGGAAGACCCCCAGTGGCTTGG + Intronic
1114787559 14:25618546-25618568 TGAGTAAACTACCTGAGGCTAGG - Intergenic
1119734828 14:76975138-76975160 GGGGTAAATGCCCAGAGGCTCGG + Intergenic
1120040337 14:79745789-79745811 TGGGCAAACCACCAGACACTAGG - Intronic
1120387995 14:83869369-83869391 TGGGTAAATCACCTGAGGTTGGG + Intergenic
1122169268 14:99858410-99858432 TGGGTGAATCACCTGAGGCTGGG - Intronic
1126109896 15:45168977-45168999 TGTCTAAACCACCACAGGCTTGG + Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1128527551 15:68422730-68422752 TGGGTAAACTGCCTGAGGTTTGG - Intronic
1129051700 15:72786407-72786429 TGGATGAAACCCCAGAGGCCTGG - Intergenic
1129806036 15:78458889-78458911 TGGGAGAACCACCTGAGGCTGGG - Intronic
1130351294 15:83094053-83094075 AGGTAAAAGCCCCAGAGGCTAGG + Intergenic
1133369788 16:5239038-5239060 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
1134568962 16:15275129-15275151 TGGGTAAACCTCCTGAGACTTGG - Intergenic
1135627525 16:24009200-24009222 TGGGTAAATACCCAGAGGTGAGG + Intronic
1136599958 16:31278468-31278490 TGGGGAAGCCCACAGAGACTGGG - Intronic
1137864085 16:51875821-51875843 TGGCAAAATCCCCAGAGGCCCGG - Intergenic
1139196335 16:64922335-64922357 TTGATAAACTCCTAGAGGCTGGG - Intergenic
1140263400 16:73399877-73399899 AGGGTACACCCCCAGAGGCTGGG + Intergenic
1141763368 16:86043509-86043531 TGGCCAAACCTCCAGAAGCTTGG + Intergenic
1141797586 16:86285585-86285607 TGGGTGGACACCCAGATGCTAGG + Intergenic
1142467583 17:145082-145104 TGCCTCAGCCCCCAGAGGCTAGG + Intergenic
1144614601 17:16757475-16757497 TGGGTAAAGGCACAGAGGCCTGG + Intronic
1144898105 17:18558199-18558221 TGGGTAAAGGCACAGAGGCCTGG - Intergenic
1145134266 17:20387515-20387537 TGGGTAAAGGCACAGAGGCCTGG + Intergenic
1145236262 17:21210377-21210399 TGGCTAAACCCCCACACACTTGG + Intronic
1146279357 17:31535374-31535396 GGGCTGAACCCCCAGAGGTTCGG + Exonic
1152329912 17:79666657-79666679 TGGGTAAATCACCTGAGGTTGGG + Intergenic
1152749392 17:82055681-82055703 GGGGTAAGACCCCAGAGCCTGGG - Intronic
1155140458 18:23039853-23039875 TGGGAAAATCACCAGAGCCTGGG + Intergenic
1155229613 18:23759632-23759654 TGGGTGGATCCCAAGAGGCTAGG - Intronic
1160327746 18:77966569-77966591 GGGGTCAACTCTCAGAGGCTAGG + Intergenic
1161380028 19:3959945-3959967 TGTGACAACCCCCAGTGGCTGGG - Intronic
1162048971 19:8020722-8020744 TGGGTAGACCACCTGAGGTTGGG - Intronic
1162838904 19:13341228-13341250 TTGGCAAACCACCAGAAGCTAGG + Intronic
1163784774 19:19269440-19269462 TGGGTCAAACCCCTGGGGCTGGG + Intronic
925937404 2:8778157-8778179 TGGAGAAACCCCCAGTGGCTGGG + Intronic
926665983 2:15523684-15523706 TGGGCAAATCACCAGAGGTTAGG + Intronic
928215381 2:29356964-29356986 TGGCTGAAGCCCCAGAGGGTGGG - Intronic
931175337 2:59848659-59848681 TGGGAAAATCACTAGAGGCTAGG + Intergenic
931519498 2:63080123-63080145 TTGGGAAACACCCACAGGCTAGG - Intergenic
934736327 2:96691610-96691632 TTGGTAAAGCCTCACAGGCTGGG + Intergenic
937217594 2:120322466-120322488 TGGGTCAGGCCCCTGAGGCTTGG + Intergenic
937550503 2:123083333-123083355 AGTGTAAACTCCCAGAGGATGGG - Intergenic
938134919 2:128748888-128748910 TGGGAAAGACCCCAGAGGGTGGG + Intergenic
940074979 2:149731632-149731654 CTGGTAAACCCCCAGAAGCTAGG - Intergenic
943634095 2:190286067-190286089 TGGGTAAATCGCTTGAGGCTAGG - Intronic
944626419 2:201573882-201573904 TGGGTGAATCACCTGAGGCTGGG - Intronic
1169232372 20:3899396-3899418 TGGGTGGACCACCAGAGGTTAGG - Intronic
1169641000 20:7752106-7752128 CTGGTAAACTCACAGAGGCTGGG - Intergenic
1172574579 20:35997982-35998004 TGGATAATCCCCCAAATGCTTGG - Intronic
1174406198 20:50304872-50304894 TGAGGAAAGCCCCACAGGCTTGG - Intergenic
1174658773 20:52192585-52192607 TGGGCAAATCCCTCGAGGCTGGG - Intronic
1175368129 20:58469412-58469434 TGGGAAAGGCCCCAGAGCCTGGG - Intronic
1176376371 21:6088725-6088747 TGGGTGGACCCCCATAGGATAGG - Intergenic
1178317972 21:31582863-31582885 GGGGTAAATCCCCAGAGGTGAGG + Intergenic
1179747104 21:43449519-43449541 TGGGTGGACCCCCATAGGATAGG + Intergenic
1180861688 22:19086632-19086654 TGTGCAAGCCCCCTGAGGCTTGG - Intronic
1181648758 22:24247542-24247564 TTGGAAACCCCCCAGGGGCTTGG + Intergenic
1182748580 22:32624280-32624302 TGGGGAAGTCCCCAGAGGCTGGG + Intronic
1185379957 22:50503742-50503764 TGGGTTTACCCCGGGAGGCTGGG + Intronic
950050605 3:9986194-9986216 TAGGTAAACCCACCGAGGGTCGG + Intronic
950056045 3:10025718-10025740 TAGGTAAACCCACCGAGGGTTGG + Intergenic
950462281 3:13132399-13132421 TGAGAAAACTACCAGAGGCTGGG - Intergenic
951020897 3:17779716-17779738 TGGGGATTCCCCCAGAGGTTAGG - Intronic
952697025 3:36277638-36277660 TGAGGAAACTACCAGAGGCTGGG + Intergenic
953750720 3:45606557-45606579 TGGACAGAGCCCCAGAGGCTCGG + Intronic
957073132 3:75581046-75581068 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
960217489 3:115059541-115059563 TGGGTAAACCTCCAGAAGGCCGG - Intronic
961157865 3:124696057-124696079 TGGGTAAAATCCCATAGGGTTGG - Intronic
961280950 3:125765734-125765756 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
961873443 3:130003851-130003873 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
963836237 3:150060621-150060643 TGGGAGAACCCACAGAGGGTAGG + Intergenic
966140819 3:176753432-176753454 TGGGTAAAACACCAGAGGTTAGG - Intergenic
966890059 3:184400729-184400751 TGGATGAAGACCCAGAGGCTGGG + Intronic
969016739 4:4108340-4108362 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
969737228 4:8999975-8999997 TGTGCAAAAGCCCAGAGGCTAGG - Intergenic
969796422 4:9531563-9531585 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
971128508 4:23780131-23780153 TGGGGAAACCTCCAAAAGCTAGG + Intronic
972751831 4:41996648-41996670 TGGGAAAACCACCTGAGGCTGGG + Intronic
984011396 4:174375877-174375899 TGGGCAAACCACCAGAAGCTAGG - Intergenic
984612612 4:181857663-181857685 TGGGAAAACCCCTTGAGCCTGGG + Intergenic
984818227 4:183857828-183857850 TGGGGATACCCTCAGAGGCATGG - Intronic
986066688 5:4241000-4241022 TGTGTAGAGCCCCTGAGGCTTGG + Intergenic
986610283 5:9560242-9560264 TGGGTAAACAGCCAGATGCAAGG + Intergenic
989195126 5:38708931-38708953 TGGGTGAACCCCCAGCTTCTAGG - Intergenic
990063114 5:51676477-51676499 TGGGCAGATCCCCTGAGGCTGGG - Intergenic
992235313 5:74703178-74703200 TGGGTGGACCACCTGAGGCTAGG - Intronic
992796841 5:80260965-80260987 TGGGTAAATCACCTGAGGTTGGG + Intergenic
995271762 5:110227921-110227943 TGGGCAATCCCCAAGACGCTGGG - Intergenic
997330672 5:133058898-133058920 TGGGCAAATCCCCTGAGGCCAGG + Intronic
997736599 5:136216842-136216864 TCTGTAAAACCCCAGAGGCCCGG - Intronic
1000530093 5:162408888-162408910 TGGGTGAATCACCTGAGGCTGGG - Intergenic
1001642714 5:173256490-173256512 TGGGGTAGCCCCCTGAGGCTGGG + Intergenic
1002352706 5:178594334-178594356 TGGGGAAACTACCAGAGGCCAGG + Intergenic
1004147141 6:13078209-13078231 TGAGCAAACCACCAGAAGCTAGG - Intronic
1007230638 6:40345468-40345490 TGGGAAAACCCGCAGAGGGCAGG + Intergenic
1007294556 6:40812106-40812128 CAGGTAAAGCCACAGAGGCTTGG - Intergenic
1013018555 6:106185404-106185426 CTGGTAAAATCCCAGAGGCTTGG + Exonic
1013201349 6:107899486-107899508 TGGGTGAATCACCTGAGGCTGGG + Intronic
1020113956 7:5464834-5464856 TGGGCAAATCACCAGAGGTTAGG + Intronic
1021542428 7:21774973-21774995 TGGGTAACCCACCTGTGGCTAGG + Intronic
1024317251 7:48032894-48032916 TGGGTAAACCAACAGAGACCAGG + Intergenic
1024460675 7:49656250-49656272 GGGGTTAACCCAAAGAGGCTGGG + Intergenic
1024851721 7:53725743-53725765 TCGTTAAACCCCAAGAGGCCTGG + Intergenic
1025147627 7:56518492-56518514 TGGGTAAATCACCTGAGGCCAGG - Intergenic
1027664768 7:81031796-81031818 TGGCTAAACCCTCAGAATCTGGG + Intergenic
1029075208 7:97929140-97929162 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1029171440 7:98631851-98631873 TGTCAAAGCCCCCAGAGGCTGGG - Intergenic
1029699138 7:102235056-102235078 AGGCCAAATCCCCAGAGGCTGGG - Intronic
1032542817 7:132717835-132717857 TGGGGAAACCCAAAGAGACTGGG + Intronic
1032567900 7:132967363-132967385 TGGATAGGCCCCCAGAGTCTTGG + Intronic
1033587602 7:142786152-142786174 TGGGTCCGCCCCCAGAGCCTGGG - Intergenic
1034389712 7:150776079-150776101 TGGGTAGATCACTAGAGGCTAGG - Intergenic
1034401088 7:150862013-150862035 GGGATAAACCCCCTGAGGTTGGG - Intergenic
1034907272 7:154961009-154961031 TGTGTCAACGCCCAGTGGCTTGG - Exonic
1036242316 8:7091238-7091260 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
1036258473 8:7222774-7222796 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1036259533 8:7228918-7228940 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1036307090 8:7610606-7610628 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
1036308147 8:7616734-7616756 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
1036310528 8:7681370-7681392 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1036311577 8:7687488-7687510 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1036357936 8:8058593-8058615 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
1036359003 8:8064735-8064757 TGTGCAAAAGCCCAGAGGCTGGG - Intergenic
1036830423 8:12015892-12015914 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1036891955 8:12602217-12602239 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1036893011 8:12608353-12608375 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1036899502 8:12660192-12660214 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1036900566 8:12666339-12666361 TGTGCAAAAGCCCAGAGGCTGGG + Intergenic
1038158890 8:25017799-25017821 TGAGCAAACCACCAGAAGCTAGG - Intergenic
1041145247 8:54869464-54869486 TGGCTAAACCCTCAGACTCTAGG - Intergenic
1049208021 8:141372334-141372356 TGGGTCAGACCCCAAAGGCTCGG - Intergenic
1049406408 8:142453552-142453574 TGGGTAAACACGCACAGGCCTGG + Intronic
1051935653 9:22439828-22439850 TGGGGATTCCCCCAGAGGTTAGG - Intergenic
1052906906 9:33843274-33843296 TGGGCAAACCACCTGAGGTTAGG - Intronic
1054323237 9:63695051-63695073 TGGTGCAACCCCCAGAAGCTGGG + Intergenic
1055396448 9:75880208-75880230 TGGGTGAATCACCTGAGGCTAGG + Intergenic
1055458030 9:76491408-76491430 TGGGTGTCCCCCCAGAGGTTAGG + Intronic
1059557431 9:115295401-115295423 TAGATAAATACCCAGAGGCTTGG + Intronic
1060941975 9:127547918-127547940 TGAATAAACCCACAGAGCCTGGG + Intronic
1061381915 9:130263970-130263992 TGTGATAACCCCCAGAGTCTGGG - Intergenic
1061861746 9:133471977-133471999 GGGCCAAACCCCCAGTGGCTGGG - Exonic
1185638117 X:1569979-1570001 TGGGTAAATCACCTGAGGTTGGG + Intergenic
1189947291 X:46192121-46192143 CCGGCAAACCACCAGAGGCTAGG + Intergenic
1190753275 X:53380457-53380479 TGGCTAAGCCTCCAGAGGCAGGG + Intronic
1190770091 X:53506901-53506923 TGGGCAGATCACCAGAGGCTAGG + Intergenic
1191854188 X:65609492-65609514 TGGGTCAAGCCCTAGAGACTAGG - Intronic
1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG + Intergenic
1193580382 X:83257235-83257257 TGGGTAACTCCCCTGTGGCTAGG - Intergenic
1195447915 X:104974990-104975012 TGGGTAACCCTGCAGAGGCAGGG + Intronic
1198671710 X:139088206-139088228 TGGGTAAACCCCCAGAGGCTGGG - Intronic
1201271820 Y:12263221-12263243 TGGGTCTTCCCCCAGAGGTTAGG + Intergenic
1201448332 Y:14082725-14082747 TGTGTAAGCTCCCAGAGGCAGGG + Intergenic
1201556113 Y:15265991-15266013 TGGGGGTTCCCCCAGAGGCTAGG - Intergenic