ID: 1198672712

View in Genome Browser
Species Human (GRCh38)
Location X:139098692-139098714
Sequence AACACAGAGATGGGAACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 1, 2: 9, 3: 115, 4: 499}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198672706_1198672712 30 Left 1198672706 X:139098639-139098661 CCAATACTGCATGTTGTCACTTG 0: 1
1: 5
2: 42
3: 96
4: 424
Right 1198672712 X:139098692-139098714 AACACAGAGATGGGAACAATAGG 0: 1
1: 1
2: 9
3: 115
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198672712 Original CRISPR AACACAGAGATGGGAACAAT AGG Intronic
900005773 1:49317-49339 AACACAAAGAAGGAAACAACAGG + Intergenic
902573570 1:17362498-17362520 GACACAGAGATGGAAATAATAGG + Intronic
903005446 1:20295161-20295183 AACACAGAGATGGGATCACAGGG + Intronic
903372224 1:22843839-22843861 GACACAAAGAAGGGAACAAGAGG - Intronic
905712148 1:40114572-40114594 GACATAAAGATGGGAACAATGGG + Intergenic
906554798 1:46701025-46701047 AACACAGAGATGGGAATTGAAGG + Intronic
906888867 1:49685088-49685110 GACACAAAGAAAGGAACAATAGG - Intronic
906923213 1:50086974-50086996 GAAAAATAGATGGGAACAATGGG - Intronic
906957189 1:50384139-50384161 GACACAAAGATGGGAACAATAGG - Intergenic
907189665 1:52638094-52638116 AGGACAGAGTTGGGAACAACAGG - Intronic
907287408 1:53390649-53390671 AACACATAGATTGGAACATTAGG - Intergenic
907600750 1:55766898-55766920 GACGCAGTGATGGGAACAGTAGG + Intergenic
907612910 1:55890391-55890413 GGCACAAAGAGGGGAACAATAGG - Intergenic
907784890 1:57601938-57601960 AAGACAGACATGAGAACAAATGG + Intronic
908939337 1:69412391-69412413 GACACAGAGATGTAAACCATTGG - Intergenic
909268123 1:73588446-73588468 GACACAGGGAGGGGAACAATAGG - Intergenic
909402538 1:75250181-75250203 GACACAAAGAGGGGAACAACAGG - Intronic
909559450 1:76993222-76993244 AACACAGAGATAGACAAAATAGG - Intronic
910003888 1:82371159-82371181 AACACAGAGATTGTAATGATAGG - Intergenic
910108403 1:83655834-83655856 GACACAGAGATAGGAAGAACAGG - Intergenic
910376579 1:86578484-86578506 GACACAAAGAGGGTAACAATAGG - Intronic
910447250 1:87311110-87311132 AACACAGAGGTTGAAGCAATGGG + Intergenic
911477745 1:98394319-98394341 GGCACAGAATTGGGAACAATTGG + Intergenic
911481007 1:98440202-98440224 AAGACAGAGATTGGCAGAATGGG + Intergenic
911639734 1:100275200-100275222 GACATAAAGATGGGAACACTGGG + Intronic
911945252 1:104099175-104099197 GACACACAGAGGGGAACAACAGG + Intergenic
912170814 1:107097218-107097240 AACATAAACATGGGAACAATAGG - Intergenic
912234855 1:107838909-107838931 GACATAAAGATGGGAACAATAGG + Intronic
912280878 1:108312113-108312135 AACACAGGAATGGGACCAAGAGG + Intergenic
912571624 1:110628554-110628576 AGTACAGAGATGGACACAATGGG - Intronic
912716482 1:111987483-111987505 CACACAGAGAAAGTAACAATGGG - Intronic
912973024 1:114301840-114301862 TACACAGAAATGCCAACAATGGG + Intergenic
913130262 1:115832687-115832709 AACACAGAGATGGGAGAAACAGG + Intergenic
914398977 1:147298314-147298336 AATACACTGATGAGAACAATAGG - Intergenic
914940120 1:152015045-152015067 AACACAGAGATGAGTAAAATAGG + Intergenic
915008570 1:152663622-152663644 AAGACAGAGTTGGGAAAGATGGG - Intronic
915252851 1:154602814-154602836 AACACAGAGAGGGGAGCAGGAGG + Intronic
915696174 1:157744796-157744818 CACGCAGCGAAGGGAACAATAGG + Intergenic
916230374 1:162535566-162535588 AAAACAGATATTGGAACACTCGG - Intergenic
916435525 1:164774510-164774532 ACCACAGTGATGGGCACACTTGG - Intronic
916442768 1:164843682-164843704 AACCCACAGATGGGAGAAATAGG - Intronic
916448848 1:164899884-164899906 AACACAAAGAAGGGAACAACAGG + Intergenic
916608566 1:166367217-166367239 GACACAGTGTTGGGGACAATAGG - Intergenic
916789610 1:168113787-168113809 AACACAAAGAGAGGAACAACAGG + Intronic
917137640 1:171802998-171803020 AACACACAGATGAGAGCAGTGGG - Intronic
917296583 1:173525852-173525874 AACATATAAATGGCAACAATGGG + Intronic
918391259 1:184065299-184065321 AACACAAAGATGTTAATAATAGG - Intronic
918685156 1:187405655-187405677 AGGAAAGAGATGAGAACAATTGG + Intergenic
918966206 1:191352445-191352467 GACATAAAGATGGCAACAATAGG - Intergenic
919009225 1:191938162-191938184 GACATAAACATGGGAACAATAGG - Intergenic
919035582 1:192304329-192304351 GGCATAAAGATGGGAACAATAGG - Intergenic
919203804 1:194394112-194394134 GACACAAAGAGGGGAACAACAGG + Intergenic
919535374 1:198780592-198780614 AAACCAAAGTTGGGAACAATTGG - Intergenic
920945742 1:210526919-210526941 AACACTTAGATGGGGACACTAGG + Intronic
921114772 1:212079014-212079036 AAAAAACAGATGGGAACAATAGG - Intronic
921146770 1:212365919-212365941 AACTATGAGATGGGAACAAGAGG - Intronic
1063526831 10:6795066-6795088 AACACAAAGAGGGAAACAACCGG + Intergenic
1063750481 10:8939917-8939939 AATATAAAGATGGGAAAAATAGG - Intergenic
1064153335 10:12883740-12883762 GATACACAGAGGGGAACAATAGG - Intergenic
1064598929 10:16973670-16973692 GACACAAAGAAGGGAACAACAGG - Intronic
1065083800 10:22154175-22154197 GACATAAAGATGGGAACAATAGG + Intergenic
1065384538 10:25121473-25121495 GACATAGAGATGGAAACAGTAGG + Intergenic
1067899079 10:50219059-50219081 AAGACACAGATGTGAACAAATGG + Intronic
1068089693 10:52417825-52417847 AATACAGTGATGGCAAAAATTGG + Intergenic
1068161357 10:53269261-53269283 GACATAAAGATGGGAAAAATAGG + Intergenic
1068498356 10:57813989-57814011 GCCACAAGGATGGGAACAATAGG - Intergenic
1069583442 10:69580484-69580506 GACACAAGGAAGGGAACAATAGG - Intergenic
1070209870 10:74305575-74305597 AACACAGAGAGTGGAACCAAGGG - Intronic
1070427184 10:76300475-76300497 AACACAGAGACGGAAATAAAGGG - Intronic
1070844539 10:79511448-79511470 AACACAGAAATGGAAACAAATGG - Intergenic
1070917087 10:80161850-80161872 AACAAAGCTATGGGAACACTTGG - Intronic
1070929259 10:80248860-80248882 AACACAGAAATGGAAACAAATGG + Intergenic
1071498990 10:86190306-86190328 AACACAGAGTTGGGAAGAGGTGG + Intronic
1071710765 10:88046918-88046940 AACATAAAGATGGCAGCAATAGG + Intergenic
1071989469 10:91087155-91087177 AAAACAGAGATGAAAACATTTGG - Intergenic
1072254369 10:93607086-93607108 GACACAATGATGGGAACAATAGG + Intergenic
1072347381 10:94521394-94521416 GACACAAAAATGGGAACAATAGG - Intronic
1072367856 10:94732764-94732786 GACATAAAGATGGCAACAATAGG + Intronic
1072653111 10:97310873-97310895 AACAAAGAGATGGGAAGACAAGG - Intergenic
1073673111 10:105614584-105614606 AATATAAAGATGGGAACAATAGG + Intergenic
1073745497 10:106463873-106463895 AGCACAAAGATGGTAAAAATGGG + Intergenic
1074614217 10:115050474-115050496 CACAGAGAGATGGGAACAGAAGG + Intergenic
1075342461 10:121658401-121658423 GACACAAAGAGGGGAACAGTAGG + Intergenic
1076386815 10:130062980-130063002 ACCACACAGATGGGAACCAGAGG + Intergenic
1077802262 11:5551860-5551882 AACACAGACATGGGAACCACAGG + Intronic
1077819923 11:5727223-5727245 GACACAGACATGGGAACCACAGG - Intronic
1077832156 11:5885014-5885036 AACACAGACATGAGAACCACAGG - Exonic
1078198524 11:9157512-9157534 GACACAAAGAAGGGAACAACAGG - Intronic
1079177523 11:18156784-18156806 AACACTGAGATTGGAGCAAAGGG + Intronic
1079646343 11:22868009-22868031 AATACAGAGCTTGGAATAATAGG - Intergenic
1079740245 11:24049890-24049912 AACATAAAGATGGGAACAAGAGG + Intergenic
1080185969 11:29486780-29486802 AACAGAGAGATGGCCACATTTGG - Intergenic
1080417863 11:32086389-32086411 AACACAGCGAGGAGAATAATCGG - Intronic
1081046662 11:38281897-38281919 CACACAAAGAAGGGAGCAATAGG + Intergenic
1081095649 11:38930903-38930925 AACATAAAGGTGAGAACAATAGG - Intergenic
1081281412 11:41212994-41213016 TACACAGAGAAGGAAACAAAAGG - Intronic
1081283296 11:41237798-41237820 AACACAGAGAAGTGATAAATAGG - Intronic
1082680504 11:56162710-56162732 AACACAGGGAGGGGAACACCGGG + Intergenic
1083114740 11:60449730-60449752 GACACAAAGAAGGGAACAACAGG + Intronic
1084671621 11:70610222-70610244 AAAACAGTTATGGGACCAATGGG + Intronic
1085000075 11:73025451-73025473 CACACATAGAGGGGAACAACAGG + Intronic
1085335753 11:75693291-75693313 GACATAAAGATAGGAACAATAGG - Intergenic
1086814096 11:91347069-91347091 AACACAGAGGAGGTAACCATTGG + Intergenic
1087735751 11:101831214-101831236 AACATAAAGATGCCAACAATAGG + Intronic
1088510976 11:110574463-110574485 TAAACAGAGAAGGGAAAAATTGG - Intergenic
1090132394 11:124158624-124158646 AACTCACAGAAGGGAAAAATAGG - Intergenic
1090267251 11:125360974-125360996 AGCCCAGAGCTGGAAACAATGGG - Intronic
1090591440 11:128274390-128274412 GACACAAAGAGGGGAACAACAGG - Intergenic
1090742662 11:129679699-129679721 GACATAAAGAAGGGAACAATAGG + Intergenic
1090814704 11:130282300-130282322 AACATGGGGATGGGAAGAATGGG - Intronic
1090994896 11:131857229-131857251 AAGACAGAGATGGCAACATTGGG - Intronic
1091348959 11:134877514-134877536 AACAAATAGATGAGAGCAATAGG + Intergenic
1091599641 12:1909978-1910000 AACACAGAGGTAGGGAGAATGGG + Intronic
1092730526 12:11529274-11529296 AAGACAGAGATGGGAGGAGTAGG - Intergenic
1092889848 12:12959019-12959041 AACACGAAGAAGGGAACAACAGG - Intergenic
1093081828 12:14821475-14821497 AAAACAGAGCAGGAAACAATGGG - Intronic
1093424181 12:19009710-19009732 AACCCAGAGATAGGAAAAATGGG + Intergenic
1093517809 12:20011337-20011359 AACACACAAATGTGAACAACAGG + Intergenic
1093936466 12:25006684-25006706 GAAACAAAGATGGGAACAATAGG + Intergenic
1094754185 12:33447381-33447403 GACATAAAGATGGCAACAATAGG + Intergenic
1094790425 12:33906928-33906950 AACAAAGAGAAAAGAACAATGGG + Intergenic
1095136013 12:38604287-38604309 AAGACAGAGATTGGCAGAATGGG + Intergenic
1096345222 12:50840524-50840546 AAAACAAAGATGGGAATAAAAGG + Intergenic
1096561940 12:52441868-52441890 GAAACAGAGGTGGGAACAAAGGG + Intergenic
1096960435 12:55571513-55571535 GACACAAAGAGGGGACCAATAGG + Intergenic
1097997211 12:65901059-65901081 AACACAGAGCTGGAAAGAAATGG - Intronic
1099721909 12:86373736-86373758 AACACAGTGAAGGGGTCAATAGG + Intronic
1101121072 12:101580433-101580455 AACACAAAGAAGGGAACAACAGG - Intronic
1102735435 12:115154933-115154955 GACACAAAGAAGGAAACAATAGG - Intergenic
1102930982 12:116862006-116862028 AACAGGGAGATGGGAAGAAGTGG + Intronic
1104093772 12:125537761-125537783 AGCACAGAGTTAGGAACATTGGG + Intronic
1104173752 12:126308721-126308743 GACATAAAGATGGGAACAATAGG + Intergenic
1105577112 13:21664010-21664032 AACAGAGAGATGGAAACTAAAGG - Intergenic
1106215444 13:27693705-27693727 GACATAAAGATGGCAACAATAGG - Intergenic
1106828262 13:33548242-33548264 AAAACAGAAATGAGAACAAGAGG + Intergenic
1106970678 13:35138045-35138067 AACACACAGAAGGAAAAAATGGG + Intronic
1107058739 13:36132414-36132436 AACACATAACTGGGATCAATGGG - Intergenic
1108231672 13:48350759-48350781 AACACAAAGATGGAAACAACAGG - Intronic
1108613727 13:52109810-52109832 AACTCAAAGCTGGGAAGAATGGG - Intronic
1108717819 13:53099302-53099324 AACACAGAGTTAGGAAAAAAAGG - Intergenic
1108839778 13:54598186-54598208 GACACAAAGAAGGGAACAACAGG + Intergenic
1109186340 13:59273230-59273252 GACATAAAGATGGGAACAACTGG + Intergenic
1109403991 13:61874095-61874117 AACACAAGGATGTGAACAATAGG + Intergenic
1109476006 13:62881270-62881292 AACATAAATATGGGAACAATAGG + Intergenic
1109637703 13:65144427-65144449 GACATAAAAATGGGAACAATAGG - Intergenic
1110251643 13:73387198-73387220 GACACATAGAAGGGAACAATAGG + Intergenic
1110262420 13:73500526-73500548 AACACAGAGATGAACACGATAGG - Intergenic
1110687941 13:78397198-78397220 GACACAAATACGGGAACAATAGG + Intergenic
1111065590 13:83087951-83087973 GACATAAACATGGGAACAATAGG - Intergenic
1111927298 13:94477450-94477472 GACATAAAGATGGCAACAATAGG + Intronic
1113164171 13:107418732-107418754 GTCACAAAGATGGAAACAATAGG - Intronic
1113234210 13:108251643-108251665 GACACAAAGAAGGGAACAACAGG - Intronic
1113511883 13:110863043-110863065 AACACAAAGAAGGGAAGAACAGG + Intergenic
1113530712 13:111023630-111023652 GACACATAGAGGGGAACACTGGG - Intergenic
1113538522 13:111086950-111086972 AACACAAAGAAAGGAACAATGGG - Intergenic
1113710247 13:112458693-112458715 AACAGAAAGAGGGGAACAAAAGG - Intergenic
1114033803 14:18601636-18601658 ATCTGAGAGATGAGAACAATGGG - Exonic
1114071870 14:19116847-19116869 ATCACAGAGATAGGGAAAATGGG + Intergenic
1114090388 14:19283117-19283139 ATCACAGAGATAGGGAAAATGGG - Intergenic
1114873066 14:26681318-26681340 GACACATAGAGGGGAACAATGGG - Intergenic
1115534686 14:34362139-34362161 AATGCACAGATGGGCACAATAGG - Intronic
1115998419 14:39217308-39217330 AACATAAAGGTGGCAACAATAGG + Intergenic
1116555035 14:46291897-46291919 GACACATAGAGGGGAACAACAGG - Intergenic
1116851180 14:49911003-49911025 GACACAAAGATGGGAACAGTAGG + Intergenic
1117191013 14:53291903-53291925 AACATAGAGATGTGGACAAAGGG + Intergenic
1117409492 14:55438430-55438452 AAAAGTGAGATGGGGACAATGGG + Intronic
1117654693 14:57943031-57943053 AACAAAGAGATTGGAAGCATTGG - Intronic
1118021853 14:61725031-61725053 AGCACAGAGGTAGGAAAAATAGG - Intronic
1118886295 14:69869103-69869125 GACATAAAGACGGGAACAATAGG - Intronic
1119119476 14:72060891-72060913 AACACATAGATGGCAACCAATGG - Intronic
1119368180 14:74113430-74113452 AACACAAAGATGGGTAGAAATGG + Intronic
1120731737 14:88010899-88010921 ATCACAAAGATGTAAACAATGGG - Exonic
1121499875 14:94426359-94426381 ATCACAGAGATGGGAAGAGTTGG - Intergenic
1122663571 14:103313776-103313798 CACACAGAGGTGGAAACAAAAGG + Intergenic
1124390892 15:29256148-29256170 GACACAAAGATGGGGACAACAGG + Intronic
1125427998 15:39568847-39568869 GACATAGAGATGGCAACAATAGG - Intergenic
1126008804 15:44283389-44283411 AACACAGTAATGGGTACAAGGGG + Intergenic
1126231901 15:46337006-46337028 GACATAAAGATGGCAACAATAGG + Intergenic
1126992633 15:54399703-54399725 AACCCCGAGAGGGGAAAAATAGG - Intronic
1127500358 15:59548989-59549011 AACCCCAAGATGGGAACATTAGG - Intergenic
1128363510 15:66979891-66979913 GACATAAAGATGGGAGCAATAGG - Intergenic
1128712782 15:69884699-69884721 AAAAAGGAGATGGGAAAAATAGG + Intergenic
1129968351 15:79756598-79756620 AGCAAAGAGCTGGGAACAACAGG + Intergenic
1130724764 15:86427801-86427823 AAGACACAGCTGGGAAGAATAGG - Intronic
1131704678 15:94980339-94980361 AACACAAACAAGGGAACAATAGG + Intergenic
1131855235 15:96586440-96586462 AAAAAAGAGATGGGAAAAAAAGG - Intergenic
1132037911 15:98501851-98501873 CACATAGAGAATGGAACAATGGG - Intronic
1132447742 15:101941605-101941627 AACACAAAGAAGGAAACAACAGG - Intergenic
1132944163 16:2523359-2523381 GAGCCAGAGCTGGGAACAATGGG + Intronic
1133916162 16:10111811-10111833 ATCACTGAGATGGGCACCATGGG + Intronic
1135122074 16:19774898-19774920 AAGACAGAGAAGGGAAGAAAGGG + Intronic
1135266008 16:21026401-21026423 GACACAAAGAAGGGAACGATTGG + Intronic
1136079807 16:27844532-27844554 AACACTGAGATGGCAGCACTGGG - Intronic
1136501791 16:30674379-30674401 GACACAGAGATGGAAACCTTGGG - Intergenic
1136657554 16:31719530-31719552 AACATAGAGATGGGAAGCCTAGG + Intronic
1137612644 16:49829181-49829203 AACACAGAGGTGGAAAGAGTTGG - Intronic
1138834420 16:60416267-60416289 AACTGAGAAATTGGAACAATCGG + Intergenic
1138954159 16:61950854-61950876 AACATAAAGAAGGGAACAAAAGG + Intronic
1140117519 16:72055722-72055744 AACTCAGAGATGGGAACTTTGGG - Intronic
1140119758 16:72073442-72073464 AACTCAAAGATGGGAACAGAGGG - Intronic
1140352301 16:74273685-74273707 GCCACATAGATGGGAACAGTGGG - Intergenic
1140775305 16:78243845-78243867 CACATAAAGAAGGGAACAATAGG - Intronic
1141398093 16:83722414-83722436 TACAAAGAGATGGTAACAACTGG - Intronic
1141868362 16:86766745-86766767 AACATAAAGATGGCAACAATAGG - Intergenic
1143542915 17:7580248-7580270 GACACAGGGCTGGGAACCATTGG - Exonic
1144000521 17:11049933-11049955 AACACAAAGATGTGAGCACTAGG + Intergenic
1144002822 17:11071548-11071570 ATCCCAGAGATGGGCACATTGGG + Intergenic
1144232274 17:13219941-13219963 GACACAAAGAGGGGAACAACAGG - Intergenic
1145188830 17:20820869-20820891 GACAGAAAGATGTGAACAATAGG + Intergenic
1145973052 17:28968193-28968215 ATCCCAGAGATGGGAACAGGAGG - Intronic
1146211083 17:30944334-30944356 GACACAAAGAAGGGAACGATAGG + Intronic
1146822541 17:35996019-35996041 GACATAAAGATGGCAACAATAGG + Intronic
1147516472 17:41122607-41122629 GACACAAAGATGAGAACAATTGG + Intergenic
1148630705 17:49106180-49106202 CACACAGAGCTGGGCACAGTTGG + Intergenic
1149101551 17:52912438-52912460 AACACAAAGAAGGAAACAATAGG + Intergenic
1149275275 17:55026934-55026956 CACATAGAGATGGGAACCCTAGG - Intronic
1150077847 17:62208354-62208376 GACATAAAGATGGGAACAATAGG - Intergenic
1150178219 17:63085260-63085282 AAGTCAGAGATTGTAACAATGGG - Intronic
1151531198 17:74706055-74706077 GACATAAAGATGGGAACAACAGG + Intronic
1153220567 18:2857278-2857300 TGCACAGAGATGGGAAAAGTTGG - Intronic
1153973959 18:10250324-10250346 AACACAAAGAAGGGAACAACAGG - Intergenic
1155131290 18:22937239-22937261 GACACAAAGAGGGGAACAACAGG - Intronic
1155614592 18:27706457-27706479 GACAGAAAGATGAGAACAATAGG - Intergenic
1156221165 18:35053747-35053769 AACACAAAGAAGAGAACAACAGG + Intronic
1156530447 18:37809997-37810019 AACACAGAAAGGAGAAAAATAGG - Intergenic
1156572567 18:38274981-38275003 GACACAAAGAAGGGAACAATGGG + Intergenic
1157371887 18:47121327-47121349 ATTACAGAGATGGGAAAGATTGG - Intronic
1159217009 18:65405591-65405613 GACATAAACATGGGAACAATGGG + Intergenic
1159768648 18:72521984-72522006 AACACAAAGAGGAGAACAACAGG - Intergenic
1160637532 19:90928-90950 AACACAAAGAAGGAAACAACAGG + Intergenic
1161536829 19:4824629-4824651 GACACAAAGAAGGGAACAACAGG + Intronic
1162199913 19:9012343-9012365 ACCTCAGAGATGGGAAAACTGGG + Intergenic
1162200168 19:9014311-9014333 GACACAAAGATGGAAATAATAGG + Intergenic
1164151216 19:22553440-22553462 AACACAGGGATGGGATCACTTGG - Intergenic
1165294155 19:34912658-34912680 AACTTAGAGATGGGAATGATTGG + Intergenic
1167190396 19:47984709-47984731 GACACAAAGATGGGAACAATAGG + Intronic
1167804066 19:51767104-51767126 GACACAAAGAGGGGAACACTGGG - Intronic
925211742 2:2054507-2054529 GACACAGAGATGAGATCCATGGG + Intronic
925528334 2:4830074-4830096 AACACTAAGAGGGGAACAACAGG - Intergenic
925570364 2:5304085-5304107 AACACAAAAATGGGTACAAGTGG + Intergenic
926836179 2:17023857-17023879 AAATCAGAGATGGAAACAAATGG - Intergenic
926941277 2:18139602-18139624 TACACAGTGATGGGATCACTGGG + Intronic
927808032 2:26165418-26165440 GACACAGAGCTGGGAAGAAATGG + Intergenic
928561742 2:32495824-32495846 AACAAAGATATAGGAACAGTTGG - Intronic
928674587 2:33637945-33637967 AACAGAAAGATGGAAATAATTGG + Intergenic
929083791 2:38148067-38148089 ATCACGAAGATGGGAACAATAGG + Intergenic
930504458 2:52264613-52264635 AGCCCAGAGAGGGAAACAATAGG - Intergenic
930568688 2:53056665-53056687 GACATAAAGATGGGAACAATAGG + Intergenic
931054788 2:58457246-58457268 AACACAGAGTTGAGAAGAGTTGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932417537 2:71582771-71582793 AACACAGAGCTGGGAAGAGACGG + Intronic
932507809 2:72253658-72253680 GACACAAAGAAGGGAACAAGAGG + Intronic
933032669 2:77351100-77351122 AGCACATAGAGAGGAACAATAGG - Intronic
935623680 2:105150661-105150683 AACACTCAGATGAGATCAATAGG - Intergenic
936459102 2:112698393-112698415 GACACAAAAATGGCAACAATAGG - Intergenic
937099579 2:119258539-119258561 AAAACAGATTTGGGAACAAAAGG - Intronic
937444330 2:121944186-121944208 AACACAGATTTGGGAACACATGG + Intergenic
937876733 2:126831581-126831603 AAAACAGAGAAAAGAACAATGGG + Intergenic
938486117 2:131710299-131710321 ATCACAGAGATAGGGAAAATGGG + Intergenic
938788695 2:134657500-134657522 AACATAAAGATGGGAACAACAGG + Intronic
939571122 2:143840927-143840949 AGCAAAGAGAAAGGAACAATTGG + Intergenic
939901654 2:147857992-147858014 GACACATAGAGGGGAACACTGGG - Intronic
939987265 2:148842301-148842323 GACGTAAAGATGGGAACAATAGG - Intergenic
940068307 2:149654421-149654443 ATCACAGAAATGTGCACAATAGG - Intergenic
940170390 2:150823893-150823915 AACATAAAGAAGGGAACAATAGG + Intergenic
940268445 2:151865221-151865243 TAAAAAGAAATGGGAACAATTGG - Intronic
940335630 2:152524478-152524500 AACACAGAAATGGGTACGCTGGG - Intronic
940457641 2:153921425-153921447 GACACAAAGAGGGGAACAACAGG + Intronic
940686156 2:156853640-156853662 AACACAAAGAGGGGAACAACAGG + Intergenic
941143038 2:161808597-161808619 TACATTAAGATGGGAACAATAGG - Intronic
941143317 2:161812547-161812569 GACATAAAGATGGGAACAATAGG - Intronic
941153477 2:161944332-161944354 AACTTAGAGATGGGATCATTTGG - Intronic
941262757 2:163317982-163318004 AACACAGAGATAGTAACAGGAGG - Intergenic
941287261 2:163629890-163629912 AACAAAGAGATGGCATCAAGAGG + Intronic
941380293 2:164784536-164784558 AACACAGTGCTGTGGACAATGGG - Intronic
941418986 2:165258895-165258917 GACACAAAGAGGGGAACAATAGG + Intronic
941436704 2:165481891-165481913 GACACAAAGACGGGAACAATAGG + Intronic
941701587 2:168609644-168609666 AACACAGAGCAGGGAAAAATGGG - Intronic
941739248 2:169015506-169015528 CACCCAGAGGTGGGAACAGTTGG - Intronic
942288632 2:174447757-174447779 GACATAAAGATGGCAACAATAGG + Intronic
942865361 2:180667122-180667144 GACATAAAGATGGGAACAATAGG + Intergenic
943221249 2:185109217-185109239 AAAACATGGATGGGAAGAATTGG + Intergenic
943244835 2:185433495-185433517 GACATAAAGATGGGAACATTTGG - Intergenic
943316318 2:186392755-186392777 GACACAACTATGGGAACAATAGG + Intergenic
943508059 2:188786720-188786742 TACACAGAGATGGAAGCAAATGG - Intronic
943879386 2:193120311-193120333 AAGAAAGAGATGTGCACAATTGG + Intergenic
944286839 2:197960091-197960113 AACCCAGAGAAGGGAACTCTGGG - Intronic
945023477 2:205597207-205597229 CAAACAAAGATGAGAACAATAGG - Intronic
945203246 2:207305984-207306006 GACACAGAGATAGGAAATATTGG + Intergenic
945359589 2:208880700-208880722 AGCAGAGAGATTGGAACTATAGG + Intergenic
945528102 2:210913996-210914018 AACATAAAGATGGGAATAATAGG - Intergenic
946075185 2:217068120-217068142 GACATAAAGATGGCAACAATAGG + Intergenic
946876264 2:224132793-224132815 AACACAGGGATGGGAACACATGG + Intergenic
946887029 2:224231480-224231502 GGCACAAAGATGGGAACAATAGG - Intergenic
946896286 2:224327764-224327786 AACACCAAGATGTAAACAATGGG - Intergenic
947601082 2:231450773-231450795 AATTCATAGATGGGAACAAATGG - Intergenic
947759025 2:232589786-232589808 AACTCAGAGATGGTGCCAATGGG + Intergenic
947998732 2:234549747-234549769 AATATAAAGATGAGAACAATAGG - Intergenic
948773443 2:240265464-240265486 GACACAAAGATGAGAACAATAGG - Intergenic
948909226 2:240994620-240994642 AACACAGGGAGGGGACAAATGGG + Intergenic
1168799372 20:634495-634517 AAGGCAGAGATGGGAAAATTGGG + Intergenic
1168824686 20:801938-801960 TCCACAGAGATGGAAAAAATAGG - Intergenic
1168904113 20:1390498-1390520 AAAACAGAGATGAGAACTAGAGG + Intronic
1169621243 20:7508825-7508847 GACACAAAGATGGGAACAATAGG + Intergenic
1169670942 20:8101745-8101767 AGCACAAAGCTGGAAACAATCGG + Intergenic
1170631032 20:18065686-18065708 AACACATAAAAGTGAACAATAGG + Intergenic
1172589398 20:36106555-36106577 CACACAGTGATGGTGACAATGGG - Intronic
1173296234 20:41760916-41760938 CACACACATATGGGAACAGTGGG + Intergenic
1173413114 20:42832321-42832343 GACACAAAGAGGGGAACAACAGG + Intronic
1173587228 20:44191971-44191993 GACACAGACAGGGGAACAATGGG + Intergenic
1173612147 20:44377247-44377269 GACATAAAGATGGGAACAATAGG + Intronic
1173721583 20:45262971-45262993 GACACAAAGAAGAGAACAATAGG - Intergenic
1174182272 20:48682339-48682361 AACACAGAGATGTGATGGATTGG - Intronic
1177343723 21:19840237-19840259 AATACAGAGATTGGCAGAATCGG + Intergenic
1177425292 21:20915046-20915068 GGCACAAAGATGGGAACAATTGG - Intergenic
1177667693 21:24182396-24182418 AACACAGATAAGGGAATAATGGG - Intergenic
1177807425 21:25887975-25887997 ATCACAGAGATAGGAACCCTAGG - Intronic
1177973750 21:27822709-27822731 GACATAAAGATGGCAACAATAGG + Intergenic
1178547905 21:33508814-33508836 GACATAAAGATGGAAACAATAGG - Intronic
1178880974 21:36449897-36449919 AGCACAGAGATGAGGGCAATGGG - Intergenic
1178935922 21:36861573-36861595 AGCACAAAGAGGGGAACAATGGG - Intronic
1179360615 21:40704874-40704896 AACACAGTGAGGGGAGCAGTGGG + Intronic
1179936458 21:44608339-44608361 AACACAGAGATGGGAAGAGAGGG - Intronic
1180457920 22:15528678-15528700 ATCTGAGAGATGAGAACAATGGG - Exonic
1180490311 22:15839202-15839224 ATCACAGAGATAGGGAAAATGGG + Intergenic
1184307237 22:43613572-43613594 GACACAAAGAAGGGAACAACAGG + Intronic
1184441994 22:44522758-44522780 AGCACAGAGGTGGGGACATTTGG - Intergenic
1184896844 22:47413461-47413483 CACACAAATATGTGAACAATTGG + Intergenic
949229825 3:1737374-1737396 AACACAAAGAAGTGAACAACAGG - Intergenic
949265811 3:2155185-2155207 GAGACAGAGATGGGAAAATTAGG - Intronic
949297763 3:2546457-2546479 GACACAAAGAGGGGAAGAATAGG + Intronic
949950148 3:9222204-9222226 AACACACAGCTGGGAGCAATGGG + Intronic
950608177 3:14103325-14103347 GACATAAAGATGGGAACAATAGG + Intergenic
951424665 3:22530092-22530114 AACATAAATATGGGAACAATAGG + Intergenic
952115294 3:30171920-30171942 AACACAGAGCTGTGAAAATTGGG - Intergenic
952280600 3:31919494-31919516 AAAACAGAGATTGGAACCAGAGG - Intronic
952372646 3:32738143-32738165 GACACAAAGAGGGGAACAACGGG + Intronic
953966975 3:47315732-47315754 AAGACAGAGATCAAAACAATTGG + Intronic
954083318 3:48225028-48225050 AACACTGAGATGGGAACACAGGG - Intronic
954374787 3:50188571-50188593 CACACAGAGAAGGGAAGAAGGGG + Exonic
956925451 3:73982288-73982310 AACACAGTGATGTGATAAATGGG - Intergenic
957594780 3:82248804-82248826 AACTCTTAAATGGGAACAATAGG - Intergenic
957595772 3:82263780-82263802 GACACAAAGATGGGAACAATGGG + Intergenic
958704067 3:97631325-97631347 AACACAAAAATGGGAACGAGAGG + Intronic
959111763 3:102131231-102131253 GACACAAAGAAGAGAACAATAGG + Intronic
959605349 3:108236036-108236058 AACACAAAGAAGGGGACAACAGG - Intergenic
960010865 3:112833603-112833625 AAAACAGAAATGGCTACAATGGG + Intronic
960080544 3:113535652-113535674 AATACAAAGTTGGGAACCATGGG + Intronic
960717636 3:120593481-120593503 AAAACAGAGATGAGTACAAAAGG - Intergenic
961821365 3:129577313-129577335 ACCACACAGCTGGGAAGAATCGG + Intronic
961911701 3:130323984-130324006 GACTCTGAGAGGGGAACAATTGG - Intergenic
961938523 3:130611962-130611984 GACACAAAGAGGGGAACAACAGG - Intronic
962637111 3:137342627-137342649 AACACAAACATGGGAAGTATGGG + Intergenic
963003388 3:140704170-140704192 AACACAGAGATGGGAACTGCAGG + Intergenic
963026100 3:140920762-140920784 GAGACAAAGATGGGAACAATAGG + Intergenic
963207479 3:142651495-142651517 AACAAAGAGATGGAGACAAGGGG + Intronic
963360949 3:144271318-144271340 AACACTGAGATGGAAACAGAAGG + Intergenic
963383041 3:144556112-144556134 AACACTGTTATGGGTACAATGGG + Intergenic
963475354 3:145796884-145796906 GACATAAACATGGGAACAATAGG + Intergenic
963813164 3:149800016-149800038 GACACAGGGAGGGGAACATTAGG + Intronic
964134048 3:153324276-153324298 GACACAAAGAGGGGAACAACTGG - Intergenic
964158829 3:153621247-153621269 AACACAAAGAAGGGAACAACAGG + Intergenic
964466930 3:157003928-157003950 AAAAAACAGATGGGAAAAATAGG + Intronic
964575046 3:158156702-158156724 GAAACAGAGATGGGAACAGTTGG + Intronic
964868435 3:161287510-161287532 GACACAAAGAAGGGAACAATAGG + Intergenic
965075180 3:163966396-163966418 GACACAAAGATGGGAACAACAGG + Intergenic
965093972 3:164198609-164198631 GATATAGAGATGGAAACAATAGG + Intergenic
965117235 3:164506239-164506261 AACAGAGAGATGGGAATCAGAGG + Intergenic
965799259 3:172474841-172474863 AAAACAGAGATTGGAAGAAAAGG + Intergenic
965875842 3:173318686-173318708 TACACAATGATGGGAACAATTGG - Intergenic
967059905 3:185862855-185862877 GACATAAAGATGGAAACAATAGG + Intergenic
967114242 3:186322387-186322409 GACACAAAGAAGGGAACAATAGG + Intronic
967137340 3:186523575-186523597 CAGACAGAGGTGGGAACAAAGGG - Intergenic
967386187 3:188913420-188913442 GACATAAAGATGGGAACAATAGG + Intergenic
969257979 4:6015564-6015586 CACACAGACATGGGGAGAATGGG - Intergenic
970693832 4:18651744-18651766 AAGTCAGAGATTGGAAGAATAGG + Intergenic
970839119 4:20446032-20446054 TGCACAGAGATGGGAACAGCTGG - Intronic
970904705 4:21202390-21202412 GACATAAAGATGGAAACAATAGG + Intronic
972352163 4:38245805-38245827 GACACAGAGAAGGGCACAAAGGG + Intergenic
973084635 4:46041782-46041804 AGCTCAGACTTGGGAACAATTGG + Intronic
973190838 4:47383607-47383629 AACTGAGAGATGTGAAGAATGGG + Intronic
973225661 4:47781123-47781145 AAGACAGAGATTGGCAGAATGGG + Intronic
973711980 4:53639293-53639315 GACATAAAGATGGCAACAATAGG + Intronic
973747065 4:53974128-53974150 GACATAAAGATGGGAACAATAGG - Intronic
973790153 4:54370910-54370932 AACAGAGAAATGGGAACAAGAGG + Intergenic
973888723 4:55347793-55347815 AACACAGAGAAGGGAGAACTAGG + Intronic
974090420 4:57304695-57304717 GACATAAAGATGGCAACAATAGG - Intergenic
975335246 4:73168959-73168981 GACACTAAGAAGGGAACAATAGG - Intronic
976015527 4:80548343-80548365 GACCCAAAGATGGAAACAATAGG + Intronic
976059974 4:81116214-81116236 GACACAAAGAAGGGAATAATAGG - Intronic
976498636 4:85759918-85759940 AACTCAGAGATGGAGACAAGAGG + Intronic
977151632 4:93520189-93520211 AACAGAGACTTGGAAACAATAGG - Intronic
977442077 4:97080390-97080412 GACTCAAAGATGGGAACAATAGG - Intergenic
977656851 4:99532509-99532531 GACATAAAGATGAGAACAATAGG + Intronic
978280980 4:107013716-107013738 AACACAGAAAAAGAAACAATGGG + Intronic
978633681 4:110778145-110778167 GACATAAACATGGGAACAATAGG - Intergenic
978653580 4:111039045-111039067 AAGACAGACCTGTGAACAATGGG - Intergenic
978737198 4:112097461-112097483 GACATAAAGATGGGAACAATAGG + Intergenic
979072486 4:116226161-116226183 GACACAAAGAGGGTAACAATAGG + Intergenic
979101860 4:116627243-116627265 GACATAAAGATGGGAACAATAGG - Intergenic
979390692 4:120123848-120123870 GACATAAAGATGGCAACAATAGG - Intergenic
980224303 4:129961345-129961367 AACAACTAGATGGGAACAATGGG + Intergenic
980298318 4:130954598-130954620 GACATAAAGATGAGAACAATAGG + Intergenic
980694101 4:136333822-136333844 AACATAAAGATGGGAACAATAGG + Intergenic
980840243 4:138250743-138250765 GACATAAAGATGGGAACAACAGG + Intergenic
980956861 4:139437784-139437806 AAGACAGAGATTAGAAGAATGGG - Intergenic
981444794 4:144823169-144823191 GACACAGAGAAGGAAACAATAGG - Intergenic
982148209 4:152421790-152421812 AAAAGAGAGATGGGAACAGCTGG + Intronic
982394608 4:154902975-154902997 ATCACAAAGATAGGAATAATTGG - Intergenic
982825379 4:159998045-159998067 GACATAAAGATGGCAACAATAGG - Intergenic
982972347 4:162005130-162005152 AACACAGAGGAAGGAAAAATGGG - Intronic
982990321 4:162265551-162265573 AACATAAAGATGGCAATAATAGG + Intergenic
984449047 4:179875672-179875694 AACACATAGAGGGGAACAACAGG + Intergenic
984472247 4:180191113-180191135 GGCACAGAAATGGGAACAATTGG - Intergenic
985387335 4:189461552-189461574 AACACTGAGATGGTAAAAATGGG + Intergenic
986371970 5:7088718-7088740 AACATAAAGATGGAAACAATAGG - Intergenic
986605779 5:9521678-9521700 AAGAAAGAGCTGGGACCAATAGG - Intronic
987020270 5:13863455-13863477 ACCACAGAGATGGGGAACATGGG - Intronic
987880443 5:23737300-23737322 AACACAAAGAAGGAAACAACAGG - Intergenic
988514941 5:31896052-31896074 GACACAGACTTGGGAACAGTAGG + Intronic
988881911 5:35513357-35513379 AACACAAAGAAGGAAACAACAGG + Intergenic
988974483 5:36501486-36501508 AACACAAAGAAGGAAACAACAGG + Intergenic
989244653 5:39241129-39241151 GACTCAAAGAAGGGAACAATAGG + Intronic
990235383 5:53761798-53761820 AGCACAGAGATGGGTAGAAAGGG + Intergenic
992305348 5:75431524-75431546 AACACAGAGAAGGGATCAGGTGG - Intronic
992917725 5:81476404-81476426 TAGACATAGATAGGAACAATAGG - Intronic
993814008 5:92518256-92518278 AATCCAGGGATGGGAACACTTGG - Intergenic
994487030 5:100393283-100393305 AAAGCAGAGTTGGGAGCAATAGG - Intergenic
995074117 5:107961135-107961157 AGCACAGACATGGGAACTTTAGG + Intronic
996455321 5:123674779-123674801 CACTCATAGGTGGGAACAATGGG - Intergenic
996507470 5:124284541-124284563 AGAACAGAGATGGGAGCAGTAGG + Intergenic
998857905 5:146412394-146412416 AACACAAAGAAGGAAACAACAGG + Intergenic
998908174 5:146929106-146929128 GACACACAGATGGGAAGGATAGG - Intronic
999071095 5:148744950-148744972 GACACAAAGAAGGGAACAATAGG + Intergenic
999208265 5:149865751-149865773 AACAGAAAGTTGGGAGCAATGGG + Intronic
999350424 5:150864993-150865015 AACAGAGAGATGGGAGAGATGGG - Intronic
999400335 5:151259286-151259308 AACCCAGAGCCAGGAACAATGGG - Intronic
1000240587 5:159404782-159404804 AAGGCAGAGAAGGGAACAAGAGG + Intergenic
1001340930 5:170844821-170844843 AAAACACAGATGGTAACAAGAGG - Intergenic
1001544467 5:172562184-172562206 AACACAGGGAGGGGAGGAATTGG + Intergenic
1002584123 5:180230773-180230795 AACATAGAGAAGGGAAGACTTGG + Intergenic
1003415976 6:5908314-5908336 AACACAGGGATGGCATCAATTGG - Intergenic
1003689685 6:8341103-8341125 GACAAAAAGATGGCAACAATAGG + Intergenic
1003826214 6:9955123-9955145 TACATAAAGATGGGAACAATAGG - Intronic
1003898964 6:10635518-10635540 AACAAAAAGAGGTGAACAATTGG - Intergenic
1004500310 6:16203829-16203851 GACATAAAGATGGGAACAATAGG + Intergenic
1005154196 6:22784951-22784973 AACATACAGATGGTAACTATAGG + Intergenic
1005939505 6:30550339-30550361 AATACTGAGATGGGAAGACTGGG - Intronic
1007419564 6:41711636-41711658 AAGACAGACAGGGGAACAAAAGG + Intronic
1008079985 6:47183794-47183816 AACATAAAGATGGCAACAATAGG - Intergenic
1008315904 6:50040289-50040311 AACATAGAGATGAAAAAAATAGG - Intergenic
1009445138 6:63733468-63733490 GATATAAAGATGGGAACAATAGG - Intronic
1009598575 6:65768186-65768208 AACACATATATGGAAACAAGAGG + Intergenic
1009621198 6:66079953-66079975 GACACAAAGAAGGGAACAACAGG - Intergenic
1009820352 6:68792064-68792086 AACATAGAGATGGTAAAAAGAGG - Intronic
1011695884 6:89912342-89912364 AACACAGTGATGTGGACAAAGGG + Intergenic
1013160841 6:107543230-107543252 AATACAGAGATGGAAAGAAACGG - Intronic
1013850049 6:114503268-114503290 CACACAAAGAAGGAAACAATAGG - Intergenic
1014179563 6:118370368-118370390 GACACAAAGATGGGAAGAATAGG + Intergenic
1014244297 6:119050960-119050982 AACACAAAGAAGGGAACGCTGGG + Intronic
1014543864 6:122709460-122709482 TACAAAGAGATGGGATCAAGTGG + Intronic
1014578672 6:123107340-123107362 AAGACAGAGATTGGAACACTGGG - Intergenic
1014723636 6:124949924-124949946 AACACAGAGATAAGCACATTGGG + Intergenic
1014894862 6:126889572-126889594 AGCACAGATAAGAGAACAATAGG - Intergenic
1015184443 6:130398153-130398175 GACACAAATATGGGAACAACAGG - Intronic
1015307907 6:131730974-131730996 GACAAAGAGATGGGAAAAATAGG - Intronic
1015473970 6:133638301-133638323 AATGCAGGGATGGGAAGAATCGG + Intergenic
1015903555 6:138092616-138092638 AACACAAAGATGAAAAAAATAGG - Intronic
1016453129 6:144203914-144203936 AACACAAAGAAGGCAACAATAGG - Intergenic
1016918854 6:149271447-149271469 AACTAACAGATGAGAACAATAGG - Intronic
1017296535 6:152802276-152802298 AACATAAAGATGAGAACAGTAGG - Intergenic
1017357825 6:153530522-153530544 AACATTAATATGGGAACAATAGG - Intergenic
1017472711 6:154755781-154755803 GACACACAAATGGGAATAATGGG - Intronic
1018327080 6:162682564-162682586 GACACAAAGAGGGGAACAACAGG + Intronic
1019047764 6:169161539-169161561 AAAACAGTGATAGGATCAATGGG - Intergenic
1019825064 7:3277603-3277625 GACATAAAGATGGGAACAGTAGG - Intergenic
1020404645 7:7818163-7818185 GACACATAGAGGGGAACAACTGG - Intronic
1020807445 7:12808229-12808251 AACACAGAGATTAGGACCATGGG - Intergenic
1021154509 7:17193730-17193752 CACATGAAGATGGGAACAATAGG + Intergenic
1021437060 7:20630476-20630498 AAGACAGAGATGGAAGCAATGGG - Intronic
1022042304 7:26592507-26592529 AAGGAAGAGATGGGAATAATTGG + Intergenic
1022314801 7:29235846-29235868 GACACAAAGAAGGGAACAACAGG + Intronic
1022732780 7:33046208-33046230 TACATTGAGATGGGAACCATAGG - Intronic
1023743695 7:43302839-43302861 AACATTGAGAAGGGAAAAATGGG + Intronic
1024106266 7:46090017-46090039 GACACAAAGAAGGGAACAACAGG - Intergenic
1024126088 7:46296061-46296083 GACAGAGAGATGGGATAAATGGG - Intergenic
1024635930 7:51290530-51290552 AACACAGATATCAGAACAAAGGG + Intronic
1024913911 7:54477062-54477084 GACATAAAGATGGGAATAATAGG - Intergenic
1025232840 7:57214259-57214281 AAAGCAGAGATGGGAGCAAGCGG + Intergenic
1025760982 7:64391285-64391307 AACACAGAAATAGAAACAAATGG + Intergenic
1026072831 7:67137815-67137837 ACCACAGAGATGAGAAAACTAGG - Intronic
1026184295 7:68070019-68070041 GACACAGTGATGGGAAAAAATGG + Intergenic
1026466330 7:70658078-70658100 AAAGCAGATATGAGAACAATTGG + Intronic
1027168299 7:75851837-75851859 GACACAAAGATGGGAACGATAGG - Intronic
1027615195 7:80414456-80414478 ACCACAGATATGGGAACACAAGG + Intronic
1027887167 7:83923779-83923801 GACATAAAGATGGAAACAATAGG + Intergenic
1028260261 7:88655602-88655624 CTTACAGAGATGGGGACAATAGG - Intergenic
1028560150 7:92166267-92166289 AACACAGAGATAGTAAACATAGG - Intronic
1029865726 7:103626021-103626043 AAGACAAAGATGGGATGAATGGG + Intronic
1030454660 7:109758768-109758790 AAGACAGAGAGGGGAAAATTGGG - Intergenic
1030828369 7:114189466-114189488 AAAAGAGAGATGGGAAAAGTAGG - Intronic
1032288779 7:130567204-130567226 GTCACAAAGAAGGGAACAATAGG + Intronic
1032428003 7:131837437-131837459 GACACAGAGAGGGGAAAAACTGG + Intergenic
1032732690 7:134659524-134659546 AGAACAGAGAAGGGAACAAAAGG - Intronic
1033109930 7:138564707-138564729 ACCACAGATAGGGAAACAATTGG - Intronic
1033313179 7:140277275-140277297 AACAGAAAGAAGGGAACAACAGG + Intergenic
1033849820 7:145481795-145481817 AACACAAAGAAGGAAACAATAGG - Intergenic
1034479325 7:151307675-151307697 AACAGGGAGATGTGAACATTTGG - Intergenic
1035623845 8:1056392-1056414 GAAAAAGAGATGGGAAAAATGGG - Intergenic
1035995559 8:4542437-4542459 AACACAGTTCTGAGAACAATGGG + Intronic
1036189981 8:6661551-6661573 AACAGCGAGATGAGAACAACGGG + Intergenic
1037125259 8:15340574-15340596 GACATAAAGATGGCAACAATAGG - Intergenic
1037423071 8:18724886-18724908 AACAACTAGATGGGAACAATGGG + Intronic
1037464595 8:19148136-19148158 AACACAGAGATGAGGCTAATGGG - Intergenic
1037591526 8:20316182-20316204 TCCCCTGAGATGGGAACAATAGG - Intergenic
1037641935 8:20752789-20752811 AACACAGAGATGGGATTGAGAGG + Intergenic
1038068160 8:23984673-23984695 ATCCCAGAGATGGGTAGAATGGG + Intergenic
1038386327 8:27150805-27150827 GACACAAAGAGGGGAACACTGGG + Intergenic
1038982510 8:32775351-32775373 GACATAAAGATGGGAACAATAGG - Intergenic
1040425091 8:47277640-47277662 AACACAGGGTAGGGCACAATGGG - Intronic
1040617279 8:49049398-49049420 GACACAAAGATGGGAACAATAGG - Intergenic
1040779724 8:51093644-51093666 AATACAGAGATAAGAACAAATGG + Intergenic
1041211127 8:55552130-55552152 ATGACAGAGATGGGAAGAAATGG - Intergenic
1041328658 8:56698284-56698306 AACTCAAAGATGGGAACAAGTGG - Intergenic
1041359558 8:57038139-57038161 ACCAAACAGATGGGATCAATAGG - Intergenic
1042168241 8:65967429-65967451 ACAGTAGAGATGGGAACAATGGG + Intergenic
1042629060 8:70796241-70796263 AACAAAGAGAAGGGAATAACAGG - Intergenic
1042795250 8:72655257-72655279 GACACAAAGAAGAGAACAATAGG + Intronic
1042873367 8:73418154-73418176 AATACAGAAATGGGAACATGGGG + Intergenic
1043248579 8:78037965-78037987 AACACAAAGAAGGAAACAACAGG - Intergenic
1043488105 8:80718897-80718919 AACACAAAGATGAGGACAACGGG - Intronic
1044146308 8:88719003-88719025 AACATAAAGATGGGGACACTGGG + Intergenic
1044365227 8:91337189-91337211 ATCACAGAGAAGAGAACAACAGG + Intronic
1044695156 8:94915249-94915271 GACAGAAAGATGAGAACAATTGG - Intronic
1044768460 8:95603367-95603389 GACACAAAGATGGAAACAATAGG + Intergenic
1045898734 8:107248720-107248742 AATACAGAAAGGGGAAGAATAGG + Intergenic
1046236694 8:111433448-111433470 GACACAAAGAATGGAACAATAGG - Intergenic
1046673224 8:117080515-117080537 GACATAAAGATGGGAACAATAGG - Intronic
1046992819 8:120479113-120479135 AATATAAAGATGGGAACAGTAGG + Intronic
1047171107 8:122493001-122493023 AACACAAAGAAGGAAACAACAGG - Intergenic
1047553049 8:125897534-125897556 AACAAAAGGATGGCAACAATGGG - Intergenic
1047619906 8:126595766-126595788 AACACAGTCATGGGAACTTTGGG - Intergenic
1047870828 8:129079939-129079961 GACATAAAGATGGCAACAATAGG - Intergenic
1047906943 8:129482498-129482520 GACATAGAGATGGCAACAGTAGG - Intergenic
1048144740 8:131830221-131830243 AAAAGAGAGAGGGGAACAAGAGG + Intergenic
1048174002 8:132135100-132135122 AACACAAAGAAGGAAACAACAGG - Intronic
1050071090 9:1814943-1814965 AAAACAGAGATAGGAACAAAAGG + Intergenic
1050851684 9:10295526-10295548 ATCACAGAGAAGGGAGTAATCGG - Intronic
1050887701 9:10786405-10786427 AAAACAGGGATGGGATCATTTGG - Intergenic
1051182207 9:14423381-14423403 TACACAGAGATGTGGACAAGGGG + Intergenic
1051318962 9:15878934-15878956 GACACAAAGAGGGGAACAATTGG + Intronic
1051504741 9:17814550-17814572 GACACAGAGATGGGAACAATAGG + Intergenic
1052682097 9:31706362-31706384 TCCAGAGAGATGGAAACAATGGG - Intergenic
1053570259 9:39297086-39297108 GACACAAAGAAGGGAACAACAGG + Intergenic
1053836213 9:42138041-42138063 GACACAAAGAAGGGAACAACAGG + Intergenic
1054091881 9:60856096-60856118 GACACAAAGAAGGGAACAACAGG + Intergenic
1054113295 9:61131686-61131708 GACACAAAGAAGGGAACAACAGG + Intergenic
1054126890 9:61321920-61321942 GACACAAAGAAGGGAACAACAGG - Intergenic
1054594405 9:67050483-67050505 GACACAAAGAAGGGAACAACAGG - Intergenic
1054733967 9:68731884-68731906 AATACAGTGAAGTGAACAATAGG - Intronic
1055497817 9:76872994-76873016 AACACAGAGACGTGAACAGAGGG + Intronic
1055562670 9:77536150-77536172 AACAGAGAACTGGAAACAATTGG + Intronic
1055782763 9:79837226-79837248 GACACAAAGAAGGGAAAAATAGG - Intergenic
1056614926 9:88156909-88156931 TAAACAGAGATTGGAACAGTGGG - Intergenic
1056785068 9:89586111-89586133 GACATAAAGATGGGAAAAATAGG + Intergenic
1056906630 9:90656310-90656332 AAGAGAGAGATGGGAAGAAAGGG - Intergenic
1056987507 9:91377075-91377097 GACACAAAGAAGGGAACAACAGG - Intergenic
1057023348 9:91718161-91718183 AACACAGAGCTGGCACCAATGGG + Intronic
1058546843 9:106069618-106069640 AATAGAGACATGGGAACAACTGG + Intergenic
1059083986 9:111280292-111280314 GACACAAAGACGGGAACAACAGG - Intergenic
1059381270 9:113928271-113928293 AGCAAAGAGATGGAAACTATAGG - Intronic
1059510886 9:114845469-114845491 AACACAAAGAAGGGAACAATAGG + Intergenic
1059605307 9:115828274-115828296 GACACAAAGATGGTATCAATAGG + Intergenic
1060155856 9:121319209-121319231 TGCACAGAGATGGGAACCTTTGG + Intronic
1060495637 9:124116522-124116544 AATACATAGAAGGGAACAACAGG + Intergenic
1061856344 9:133443757-133443779 AGCTCAGAGAGGGAAACAATGGG - Intronic
1185634252 X:1539802-1539824 GACATAAAGATGGGAACAACAGG + Intergenic
1185690127 X:2147836-2147858 AACACACAGATGAAAATAATTGG - Intergenic
1185703860 X:2251935-2251957 AATAAAGAGATTGGAAGAATTGG + Intronic
1185927528 X:4163891-4163913 GACATAAAGATGGGAACAATAGG + Intergenic
1186111936 X:6266863-6266885 GACATAAAGATGGAAACAATAGG + Intergenic
1186125454 X:6409004-6409026 AACAAACAGATTGGAACACTTGG - Intergenic
1186366857 X:8904571-8904593 GAAACAGAGAAGGGAAGAATAGG - Intergenic
1186653259 X:11584960-11584982 GACACATAGAGGGGAACAACAGG - Intronic
1186785686 X:12954451-12954473 AACACACAGGTGGCAGCAATTGG + Intergenic
1187574150 X:20536557-20536579 AACAAAGTGATGGGCACATTGGG + Intergenic
1188194894 X:27221474-27221496 GACACAAAGAGGGGAATAATAGG - Intergenic
1188322878 X:28761552-28761574 AACATAAAGATGGGAACAGTAGG + Intronic
1189071904 X:37872923-37872945 AACACAGTCAGGGGAACATTTGG - Intronic
1189571243 X:42300115-42300137 GACACAAAGAACGGAACAATGGG - Intergenic
1190401069 X:50035511-50035533 AACATAGATATGTGAACAAAGGG + Intronic
1190637889 X:52454469-52454491 AACACAGGGAAGGGAACCAGAGG + Intergenic
1190650826 X:52566929-52566951 AACATAGAGAAGGGAACCAGAGG - Intergenic
1190653956 X:52594656-52594678 AACACAGGGAAGGGAGCCATGGG + Intergenic
1190678763 X:52805994-52806016 AACACAGGGAAGGGAACCAGAGG - Intergenic
1191020437 X:55854185-55854207 GACACAAAGAAGGGAACAACAGG - Intergenic
1191140556 X:57112062-57112084 GACACAAAGAAGGGAACCATAGG + Intergenic
1192036645 X:67569876-67569898 CACATGGAGATGGGGACAATAGG - Intronic
1192354832 X:70391799-70391821 GACAGAAAGAAGGGAACAATAGG - Intronic
1192675832 X:73195289-73195311 AACACAAAGAAGGGAGCAATTGG - Intergenic
1192865242 X:75124286-75124308 TACCCAGAGATGTGAACATTTGG - Intronic
1192934083 X:75839906-75839928 AACACAAAGAGGGGAACAACAGG - Intergenic
1194030606 X:88809016-88809038 AACACAAAGAAGGAAACAACAGG - Intergenic
1195576345 X:106455678-106455700 GACACAAAGAAGGGAACAAGGGG + Intergenic
1195720537 X:107863475-107863497 AACACAGAAATGAGAACTAGAGG - Intronic
1196330124 X:114462225-114462247 CACATAAACATGGGAACAATAGG - Intergenic
1197171522 X:123439975-123439997 AACACATAGAAGGGAACAACAGG - Intronic
1197281325 X:124539881-124539903 AATCCAGAGATGGGACTAATTGG - Intronic
1197417796 X:126196634-126196656 AACATAAACATGGGAACAATAGG + Intergenic
1197498889 X:127220129-127220151 GACACAAAGAAGGGAACAATAGG - Intergenic
1197868698 X:131045602-131045624 GACAGAGAGATGAGAAGAATGGG - Intergenic
1198672712 X:139098692-139098714 AACACAGAGATGGGAACAATAGG + Intronic
1198823624 X:140675655-140675677 GACACAAAGAAGGGAACAGTAGG + Intergenic
1199005532 X:142692249-142692271 GACATAAAGATGGTAACAATGGG + Intergenic
1199842624 X:151665551-151665573 GACACTGAGAAGGGAAGAATGGG + Intronic
1200373231 X:155750240-155750262 AACATAAAGATGGCAACAATAGG + Intergenic
1201459155 Y:14203143-14203165 CACAAAAAGATGGCAACAATAGG - Intergenic
1201493587 Y:14569303-14569325 GAAAGAAAGATGGGAACAATAGG - Intronic
1201547561 Y:15182201-15182223 AACCCAGTGATGGGATGAATTGG - Intergenic
1201790241 Y:17831983-17832005 AACACAAAGAAGGGAACAATAGG + Intergenic
1201811313 Y:18074006-18074028 AACACAAAGAAGGGAACAATAGG - Intergenic
1201859035 Y:18574565-18574587 ACAACAGATAGGGGAACAATTGG - Intronic
1201874287 Y:18745816-18745838 ACAACAGATAGGGGAACAATTGG + Intronic
1202361089 Y:24111036-24111058 AAAACAGAGATGTGGACAAATGG - Intergenic
1202509689 Y:25559082-25559104 AAAACAGAGATGTGGACAAATGG + Intergenic