ID: 1198673993

View in Genome Browser
Species Human (GRCh38)
Location X:139112316-139112338
Sequence ATGGAGAGCCTACTATATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198673993 Original CRISPR ATGGAGAGCCTACTATATGT TGG (reversed) Intronic
901749049 1:11394708-11394730 AAGGAGAGACTACTATAGATGGG - Intergenic
903237379 1:21958888-21958910 ATTGAGAGCCTACTACATTAGGG - Intergenic
903577647 1:24348642-24348664 ATGGAGAGTTTACTACCTGTGGG + Intronic
903592945 1:24471051-24471073 ATGGAGACCCTGCTAAAGGTCGG + Intronic
904374319 1:30070371-30070393 ATTGAGCGCCTACTATGTGCTGG + Intergenic
904397520 1:30232130-30232152 AGGGAGAGCCTACTACCTCTAGG + Intergenic
904481913 1:30799332-30799354 ATTGAGGGCCTACTATGTGCTGG + Intergenic
904681119 1:32229975-32229997 ATAGAGTGCCTACTATGTGCTGG - Intronic
905004552 1:34699240-34699262 AGAGAGCACCTACTATATGTTGG - Intergenic
906103055 1:43275349-43275371 ATAAAGAACCTACTCTATGTCGG - Intergenic
906632541 1:47384264-47384286 ATTGAGTGCCTACTATGTGCAGG - Intergenic
906733171 1:48100668-48100690 ATGGAGACCCTACTGTGTGCTGG + Intergenic
906786945 1:48624376-48624398 ATTGAGTGCCTACTAAGTGTTGG + Intronic
906937713 1:50228908-50228930 ATGGAGCATCTACTATGTGTAGG + Intergenic
907581945 1:55580207-55580229 ATTGTGTTCCTACTATATGTAGG - Intergenic
907879238 1:58529653-58529675 ATAGAGAGCCAACTGTATTTGGG - Intronic
908646816 1:66287397-66287419 GTGGAGTGCCTACTAAATGTTGG - Intronic
908814984 1:68022521-68022543 ACAGAGAGCCTAGTATTTGTTGG + Intergenic
909720121 1:78757566-78757588 GTTAAGAACCTACTATATGTAGG - Intergenic
910210214 1:84784581-84784603 ATTGAGAGCTTACTATAGGTAGG - Intergenic
910274582 1:85435413-85435435 ATTGAGCATCTACTATATGTTGG + Intronic
910324014 1:85983080-85983102 ATAGAAAGCTTACTATTTGTGGG - Intronic
910500036 1:87879936-87879958 ATTGAGGAACTACTATATGTAGG + Intergenic
911044869 1:93620013-93620035 GTAGAGTGCCTACTATGTGTTGG - Intronic
911332699 1:96543550-96543572 ATGGAGGGCCTACTGTATACTGG + Intergenic
912061005 1:105670144-105670166 ATGTAGAGCCTACTACACTTGGG - Intergenic
912464969 1:109865933-109865955 GTGGAGCCCCTACTACATGTTGG + Intergenic
914855898 1:151350462-151350484 ATACAGAGCCTAATATGTGTTGG + Intergenic
915253868 1:154610492-154610514 ATGCAGAGCATACTATAGTTTGG - Intronic
917000061 1:170347748-170347770 ATTGAGCACCTACTATATGAAGG - Intergenic
917448963 1:175130697-175130719 ATTGAGTGCCTACTATGTGTCGG + Intronic
917687949 1:177437114-177437136 GTGGAGAGATTACTATAGGTAGG - Intergenic
917752322 1:178065281-178065303 AAGGAGAGCCTGCTAAAAGTTGG + Intergenic
918633091 1:186742810-186742832 AGAAAGAGCCTACTTTATGTTGG - Intergenic
919943401 1:202303756-202303778 ATTGAGGGCCTACTATGCGTCGG - Intronic
920087920 1:203431437-203431459 AGTGAGAGCCTACTATGTGTTGG - Intergenic
921240538 1:213176877-213176899 ACTGAGCACCTACTATATGTCGG + Intronic
921317241 1:213904247-213904269 ATGGAGGGCTCACTATATTTCGG + Intergenic
1065160170 10:22911490-22911512 ATGAAGAGCCTTCTAAATGCAGG + Intergenic
1066536703 10:36400024-36400046 ATGAAGTGCCTACTATGTGCTGG + Intergenic
1066622959 10:37377831-37377853 ATTGAGTGCCTACTACATGCAGG + Intronic
1067712778 10:48663657-48663679 ATGGAGAACCTACTACATTTAGG + Intergenic
1069081233 10:64090343-64090365 ATGGATTGCTTACTATTTGTTGG + Intergenic
1069098503 10:64289140-64289162 ATTGAGTGCCTACTATATTTTGG + Intergenic
1069763944 10:70837560-70837582 TTGGAGTGCCTACTGTATGAAGG - Intronic
1073368609 10:102966698-102966720 ATTTAGTGCCTGCTATATGTAGG + Intronic
1075116424 10:119630774-119630796 ATGGAGTGCCTACTATGGGCTGG - Intergenic
1078815408 11:14816676-14816698 ATTTAGAGCTTACTATATGCTGG - Intronic
1079085557 11:17442494-17442516 ATGGAAAGCCTGCTATGTGCTGG - Intronic
1079100063 11:17535585-17535607 ATTGAGAGCTTATTATGTGTTGG - Intronic
1079157925 11:17965702-17965724 ATTGAGTGCCTACTTTGTGTTGG - Intronic
1079849539 11:25513891-25513913 ATGGACAGCCAACTCTGTGTGGG - Intergenic
1080039037 11:27739482-27739504 ATGGAAAGGGAACTATATGTGGG + Intergenic
1081840431 11:46196979-46197001 ATTGAGTGTCTACTATATGCAGG - Intergenic
1081846077 11:46241410-46241432 ATTGAGAGCCCATTATATGTAGG + Intergenic
1082755601 11:57073130-57073152 ATTGAGTACCTACTATGTGTTGG - Intergenic
1082764291 11:57154920-57154942 ATGGAGTGCTTACTACATATTGG - Intergenic
1085360895 11:75886027-75886049 ATTGATAAACTACTATATGTTGG + Intronic
1085849417 11:80102535-80102557 ATGCAGTGCATACTATTTGTGGG - Intergenic
1086984692 11:93235002-93235024 ATTGAAAGCCTACTAAGTGTAGG + Intergenic
1087080611 11:94167751-94167773 ATTGAGGGCCTACCATATGCTGG + Intronic
1087291556 11:96326171-96326193 GTTGAGTGCCTACTACATGTTGG - Intronic
1087796225 11:102456902-102456924 ATTGAGTGCTTACTATATGATGG + Intronic
1088429865 11:109747399-109747421 ATGGAGACTCTACTGTGTGTAGG + Intergenic
1088825989 11:113495147-113495169 ATGGAGTACCTATTATGTGTTGG - Intergenic
1088879504 11:113962519-113962541 ATTGAGGTCCTACTATGTGTCGG + Intergenic
1089154623 11:116391682-116391704 ATGGAGAAGCCACTATATTTAGG - Intergenic
1090784712 11:130039087-130039109 ATTGAGAGCCTCCTATGTGCTGG - Intergenic
1091997282 12:5003442-5003464 ATGGAGTGTCTGCTATGTGTGGG + Intergenic
1092751620 12:11724507-11724529 ATTGAAAGTCTACTATATGCCGG + Intronic
1092959708 12:13584391-13584413 ATTGAGAGCTTACTAAGTGTTGG - Intronic
1093092505 12:14937472-14937494 AAGGAGAGTCTACCATATTTGGG + Intronic
1093849836 12:24022009-24022031 ATTGAGTGCCTACTATGTGTCGG + Intergenic
1095543246 12:43335524-43335546 ATGGACAGCCTAATAAATGGTGG + Intergenic
1096759435 12:53828118-53828140 ATTGAGAGCCTACTATGTGCAGG + Intergenic
1097244461 12:57599510-57599532 ATGGAGAGGCCACTCTATATAGG + Intronic
1097516663 12:60616306-60616328 ATGGAGAGCAAACTCTATGCTGG + Intergenic
1098004689 12:65983590-65983612 ATTGAGCACCTACTATGTGTCGG - Intergenic
1098233100 12:68392761-68392783 ATTGAGCACCTACTATATGCTGG - Intergenic
1099112424 12:78578251-78578273 ATGGAGCGCCTACTAAATACTGG - Intergenic
1100234694 12:92648988-92649010 ATTGAGAGCCTACTGTATGCTGG + Intergenic
1100458038 12:94771769-94771791 AAGGAGTGCCTGCTATATATCGG - Intergenic
1101010050 12:100439991-100440013 ATTGAGAACCTACTATGTGTTGG - Intergenic
1101598279 12:106186803-106186825 ATTGAGTGCTTACTATATGCTGG - Intergenic
1102551373 12:113694525-113694547 ATTGAGCACCTACTATGTGTTGG - Intergenic
1102988151 12:117295104-117295126 ATTGAGCACCTACTATATTTTGG + Intronic
1103164132 12:118755726-118755748 ATTGAGTGCTTACTATGTGTTGG + Intergenic
1103193644 12:119023821-119023843 ATTGAGCACCTATTATATGTTGG - Intronic
1103490771 12:121317791-121317813 ATTGAAAGCCTTCTATGTGTAGG + Intronic
1104428624 12:128698197-128698219 ATTGAGCACCTACTATATGCTGG - Intronic
1105218028 13:18301257-18301279 ATGGGGAGACTGCTAAATGTAGG + Intergenic
1107285027 13:38781132-38781154 AAGGAGAGCCTAAGATATGAGGG - Intronic
1107292010 13:38865347-38865369 ATAGAGAACCTAAAATATGTAGG + Intronic
1107645303 13:42488437-42488459 ATTGAGATCCTACTCTGTGTTGG - Intergenic
1107652760 13:42561121-42561143 ATAAAGAGCCTACTATGTGCAGG + Intergenic
1109822571 13:67677553-67677575 ATTGAGAGCTTACTATGTGCTGG + Intergenic
1112313375 13:98339936-98339958 ATGGAGTGCATACAATATGAGGG - Intronic
1112823921 13:103369775-103369797 ATTGAGAGGCTACTGTATGATGG + Intergenic
1114926311 14:27403790-27403812 ATGGAGAGTCAACTGTATCTAGG - Intergenic
1115323131 14:32106877-32106899 TTTGGGTGCCTACTATATGTCGG - Intronic
1115795656 14:36932509-36932531 ATTGAGTGCCTACTATGTGCTGG + Intronic
1117063819 14:51989301-51989323 ATGCAGAGAATAGTATATGTAGG - Intergenic
1118119270 14:62819993-62820015 ATAGAGTGTCTACTATATGGGGG + Intronic
1118228107 14:63921973-63921995 ATTGAAAGCCTACTATGTCTTGG - Intronic
1118302376 14:64627060-64627082 ACTGAGTGCCTACTATATGCTGG + Intergenic
1119571127 14:75673649-75673671 TTTGAGCGCCTACTATGTGTCGG - Intronic
1120478995 14:85024708-85024730 ATGGCAAGGCTACTATATGGTGG - Intergenic
1122023404 14:98857930-98857952 ATTGAGTGCCTACTATGTGTTGG - Intergenic
1122751619 14:103938214-103938236 CTCGAGAGCCTATTATATGTCGG + Intronic
1125054689 15:35343685-35343707 ATTGAGTGCCTACTAAACGTTGG + Intronic
1126737599 15:51747717-51747739 ATGTAGAGCTTCCTATATTTTGG + Intronic
1127131488 15:55869111-55869133 ATAAAGAGCCTTCTGTATGTGGG - Intronic
1128515459 15:68339283-68339305 ATGGAGAGCCTGTTATACGCTGG + Intronic
1128801048 15:70497322-70497344 ATTGAGTGCCTACTGTATGCAGG - Intergenic
1130702141 15:86195096-86195118 ATTGAGAGCTTACTATAGGCTGG + Intronic
1133702599 16:8323020-8323042 ATTGAGTGACTACTATATGACGG - Intergenic
1134813760 16:17189011-17189033 ATTGAGCACCTACTATGTGTTGG - Intronic
1135673635 16:24395636-24395658 ATTGAGCACCTACTATGTGTTGG - Intergenic
1136005409 16:27325729-27325751 ATTGAGTGCCTGCTGTATGTCGG + Intronic
1136427856 16:30181179-30181201 ATTGAGTGCCTACTATGTGCTGG - Intergenic
1137387427 16:48054659-48054681 ATTGAGCACCTACTATATGCAGG - Intergenic
1137572043 16:49572953-49572975 ATGGAGTGCATAGTACATGTAGG + Intronic
1137905604 16:52318991-52319013 ACTGAGTGCCTACTATGTGTTGG + Intergenic
1138830786 16:60372313-60372335 ATGAAGTGTCTACTATGTGTCGG + Intergenic
1144760122 17:17702412-17702434 ATTGTGAGCCTACTGTATATGGG + Intronic
1145831826 17:27922432-27922454 ATCAAGTGCCTACTATGTGTTGG - Intergenic
1146003988 17:29149273-29149295 ACTGAATGCCTACTATATGTAGG - Intronic
1146535155 17:33643804-33643826 ATTGAGTGCCTACTACATGCAGG - Intronic
1146939201 17:36832336-36832358 ATTGAGTGCCTACTATAGGCAGG + Intergenic
1148475294 17:47924790-47924812 TTTGAGAGCCTGCTGTATGTTGG - Intronic
1148997728 17:51725830-51725852 ATTGAGTGCCTACTCTATGCTGG + Intronic
1149451136 17:56750950-56750972 ATTGAGTACCTACTATATGTTGG + Intergenic
1150745130 17:67810594-67810616 ATTGAGTGCCTACTGTATGCTGG - Intergenic
1153023700 18:655494-655516 GTGGAAAGCCAACCATATGTTGG - Intronic
1153952737 18:10070739-10070761 ATGGAGAGCCTACTGCAAGCAGG - Intergenic
1155050455 18:22142726-22142748 GTGGAGATCCTGCTATATATGGG - Intergenic
1156575456 18:38310197-38310219 ATTGAGATCATACTATATGGAGG + Intergenic
1157623408 18:49029092-49029114 CTGGAGAGCCCTCTCTATGTGGG - Intergenic
1158570754 18:58595359-58595381 ATGGAGGGCCTACTATATGCCGG - Intronic
1158989733 18:62856208-62856230 ATGGAGCGCCGACCATATGTTGG + Intronic
1161541752 19:4856037-4856059 ATTGAGTGCCTACTGTATGCCGG - Intronic
1162428513 19:10612440-10612462 ATAGAGCGCCTACTGTATGCTGG - Intronic
1162871851 19:13592392-13592414 ATGGAGCACTTACTATCTGTGGG - Intronic
1163257575 19:16166601-16166623 ATTGAGCACCTACTACATGTTGG + Intronic
1163257581 19:16166727-16166749 ATTGAGCACCTACTATGTGTTGG + Intronic
1163485291 19:17581866-17581888 ATTGAGTGCCTACTGTGTGTTGG + Exonic
1164556934 19:29260379-29260401 TTTGAGAGCCAACTATATGCTGG + Intergenic
1165333361 19:35153818-35153840 ATGGAGAGCCAACGAGCTGTGGG + Intronic
1166428290 19:42699207-42699229 ATGGAGAGCCGACTACAGCTTGG + Intronic
1166810846 19:45513898-45513920 ATTGAGTCCCTACTATGTGTTGG + Intronic
1166868444 19:45855227-45855249 ATTGAGTGCCTACTATGTGCCGG - Intronic
1168351143 19:55676543-55676565 ATTGAGCGCCTACTATCTGTGGG + Intronic
927971702 2:27309687-27309709 ATGGAGTGCCTAGTATGTGGTGG + Exonic
928065164 2:28157213-28157235 ATCAAGTGCCTACTATATGAAGG + Intronic
928200540 2:29245212-29245234 ATGGAGCCCCTACTATGTGCAGG - Intronic
928200599 2:29245508-29245530 ATGGAGCCCCTACTATGTGCAGG - Intronic
928200622 2:29245638-29245660 ATGGAGCCCCTACTATGTGCAGG - Intronic
928962538 2:36942548-36942570 ATGGAGAGACTACTATAAGCGGG + Intronic
929632371 2:43476981-43477003 ATTGACTACCTACTATATGTAGG + Intronic
930636028 2:53806520-53806542 ACACAGAGCCTACTATATTTTGG - Intronic
931104568 2:59041205-59041227 ATTGAGAGCCTACTCTGTGCTGG + Intergenic
931176550 2:59860564-59860586 ATGGAGAGCCTTCCTTATGTGGG - Intergenic
932045470 2:68344490-68344512 ATTGAATGCTTACTATATGTTGG - Intergenic
932721321 2:74140738-74140760 ATGGAAGGCTTACTATGTGTCGG + Intronic
933625530 2:84593773-84593795 ATGGAAAGTCTAATATATGTGGG + Intronic
933891048 2:86770275-86770297 ATGAAGAGCCTAGTACATTTTGG + Intronic
934296278 2:91745407-91745429 ATGGGGAGACTGCTAAATGTAGG - Intergenic
935319010 2:101867094-101867116 GTGGAGAGCCTACCATGAGTGGG + Intronic
936578501 2:113675102-113675124 CTGGAGAGCCTGCCAGATGTAGG - Intergenic
938871021 2:135476658-135476680 ATGGAGAGCTCAATATTTGTTGG - Intronic
939570521 2:143834979-143835001 ATAGAATGCCTACTATATGTCGG + Intergenic
939691056 2:145260658-145260680 ATTGAGTGCCTAGTATGTGTAGG - Intergenic
940200505 2:151144726-151144748 ATGGAGAATTTACTGTATGTTGG + Intergenic
940341073 2:152581983-152582005 ATTGAGAACCTACTATATGCCGG + Intronic
940355209 2:152733911-152733933 ATTGAGGGGCTACTATGTGTTGG - Intronic
943753206 2:191531542-191531564 ATGGAGCACCTACTATATCCAGG - Intergenic
944482578 2:200172914-200172936 ATTGAGTGCCTACTATGTGCAGG + Intergenic
944914026 2:204339166-204339188 AAGGAGAGCCAACTATATGTTGG - Intergenic
945569620 2:211449879-211449901 ATTGAGAATCTACTATATCTAGG + Intronic
946412938 2:219524305-219524327 CTTGAGCGCCTACTATTTGTAGG + Intronic
946474316 2:219993027-219993049 AATGAGAGCTTACTATATCTAGG - Intergenic
947239873 2:227982837-227982859 ATGGAGCCCCTACTATGTGCAGG - Intronic
947239925 2:227983533-227983555 ATGGAGCACCTACTATGTGCAGG - Intronic
1168753433 20:299206-299228 ATGGAGTGCCTACCACGTGTTGG - Exonic
1168982618 20:2020842-2020864 ACAGAGCACCTACTATATGTTGG - Intergenic
1169859726 20:10138610-10138632 AGGGAGCACTTACTATATGTTGG - Intergenic
1170290790 20:14765947-14765969 TTGGAGAGCCTCCTAAATCTAGG + Intronic
1171217100 20:23360466-23360488 ATTGAGCACCTACTATGTGTGGG + Intergenic
1172243584 20:33430166-33430188 ATTGAGCGCCTACTATATATTGG + Intronic
1172405512 20:34685963-34685985 ATGGAGGACCTACTGTATATTGG + Intergenic
1172575791 20:36007475-36007497 ATGGAGGGCCTATTATATGTCGG + Intronic
1173008889 20:39163312-39163334 ATTGAGAGCCTGTTATATGTTGG - Intergenic
1173105636 20:40131022-40131044 ATTGAGAGCCTTCTATGTGCAGG - Intergenic
1173443818 20:43099954-43099976 ATTGAGTCCCTACTAGATGTAGG - Intronic
1174695559 20:52553052-52553074 ATTGAGTGCCTACTATATGGAGG - Intergenic
1175490891 20:59380599-59380621 ATGAAGTGCCTACTGCATGTTGG + Intergenic
1175721708 20:61291520-61291542 ATGGAGTGCCTCCTTCATGTAGG + Intronic
1178136062 21:29629002-29629024 ATTGAGCCCCTACTATATGCAGG + Intronic
1178330759 21:31689131-31689153 ATTGAGGGCCTACTATGTGCTGG - Intronic
1182426340 22:30274921-30274943 ATGGAGAGCCTATTACATTCTGG - Intergenic
1183248898 22:36714392-36714414 ATAGATAACCTACTATGTGTTGG + Intergenic
1183309072 22:37099531-37099553 CTTGAGAGCCTGCTATGTGTAGG + Intronic
1184909336 22:47516349-47516371 ATGGAGTGCCTACTATGTGCCGG + Intergenic
949510694 3:4764401-4764423 ATGGAGTGCCTTCTATTTGCTGG + Intronic
950119999 3:10475450-10475472 ATTGAGCACCTACTATGTGTTGG + Intronic
950152341 3:10697473-10697495 CTGGAGGGCCTACTGTATGTTGG - Intronic
950980235 3:17296381-17296403 GTTGAGAGCCTACTACATGCAGG + Intronic
953179054 3:40579821-40579843 ATTGAAAGCCTACCATATATTGG + Intergenic
953642526 3:44722612-44722634 ATGCAGAGCCTACTTGAGGTGGG + Exonic
953672453 3:44974988-44975010 ATTGGGAGCCTACTATAGATAGG - Intronic
954158566 3:48702849-48702871 GTGGAGTGCCTACTTTATGCTGG - Intronic
955490370 3:59475953-59475975 ATTGAGAGCCTACTAGATGCTGG + Intergenic
955850011 3:63210241-63210263 ATGCAGGGCCTACTGTATGCTGG + Intergenic
960836752 3:121914635-121914657 ATCGAGTCCCTAATATATGTCGG + Intronic
963904907 3:150765032-150765054 ATTGAGTGCCCACTGTATGTTGG + Intergenic
965182795 3:165426261-165426283 ATGGAAAGCCTGCTATAGGGAGG - Intergenic
965850823 3:173020652-173020674 ATTGAGAGCCTATTATGGGTAGG + Intronic
966586161 3:181627805-181627827 ATTGAGAGCTTACTATTTGCAGG - Intergenic
966633347 3:182103870-182103892 ATGGAATGCCTAATATATGTTGG + Intergenic
967260930 3:187641232-187641254 AATGAGCGCCTACTACATGTAGG - Intergenic
967318307 3:188171283-188171305 ATGGAATGCCTACTTTGTGTAGG - Intronic
968053061 3:195669310-195669332 ATGGAGACCCTACCATGTGCTGG - Intergenic
968102753 3:195979052-195979074 ATGGAGACCCTACCATGTGCTGG + Intergenic
969302573 4:6305848-6305870 ATGGAGCACCCACTATATGCTGG + Intergenic
970291356 4:14576003-14576025 ATGAAGTTCTTACTATATGTGGG - Intergenic
970526345 4:16936275-16936297 ATTGAGAGCTTACTATGTGTTGG + Intergenic
970567164 4:17342769-17342791 ATGGAGTGCCTAGTATGTGTTGG - Intergenic
970902622 4:21177128-21177150 ATTGAATGCCTACTATATATAGG + Intronic
971184875 4:24364830-24364852 ATTGAGAGCTTACTAGCTGTTGG - Intergenic
971392995 4:26203404-26203426 ATGGAGACCCTACTGTATGTGGG - Intronic
972171356 4:36349477-36349499 ATTGAGTGCCTACTATGTGCTGG - Intergenic
973220376 4:47719350-47719372 ACGGAGAGCCTGCTATGTGCTGG - Intronic
973343651 4:49031365-49031387 ATGGAAATGCTACTATAGGTAGG + Intronic
973345468 4:49050011-49050033 ATGGAGTGCCTACTACATGCAGG - Intronic
974020042 4:56685069-56685091 ATGGAGCGCCTACTATGTTCTGG - Intergenic
975177592 4:71305997-71306019 ACTGAGTGCCTACTATGTGTTGG - Intronic
975953951 4:79813271-79813293 ATGGAGCACCTACTATATTCCGG + Intergenic
978130656 4:105192520-105192542 ATTGAGAACTTACTATATGTTGG - Intronic
981082902 4:140652735-140652757 ATCGAGAGCCTGCCATGTGTGGG - Intronic
981170052 4:141612493-141612515 ATTGAGTGCCTCCTATTTGTAGG + Intergenic
981927814 4:150158555-150158577 ATTGAGCACCTAATATATGTTGG + Intronic
982155033 4:152510955-152510977 AATGAGATCCTAGTATATGTAGG - Intronic
982290175 4:153773146-153773168 TTGGAGAGCATACTTTGTGTGGG + Intergenic
983568756 4:169182034-169182056 ATTGAGTGCCTACTATGTGCTGG - Intronic
984370192 4:178854225-178854247 ATTGAGAGCCTACAGTTTGTGGG + Intergenic
991420510 5:66436745-66436767 AGGGTGAGCCGATTATATGTTGG + Intergenic
992922738 5:81543733-81543755 ATTGAATGCCTACTATTTGTAGG - Intronic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
995539630 5:113171877-113171899 AGGGAGAGCCTTCCTTATGTAGG - Intronic
995925218 5:117365777-117365799 ATTGAATGCCTACTATATTTTGG + Intergenic
996637821 5:125716090-125716112 ATGGAGAGCTTAGTATGTATTGG - Intergenic
1000133135 5:158319353-158319375 ATGGAGTGCCTACTATATGTCGG + Intergenic
1000846658 5:166290336-166290358 ATACATAACCTACTATATGTAGG + Intergenic
1001601196 5:172929769-172929791 ATTGAGCACCTACTATATGCTGG + Intronic
1002798977 6:503255-503277 ATTGAGATCCTACTACATGGAGG + Intronic
1007318808 6:41011453-41011475 ATTGAGAACCTACTGTGTGTTGG - Intergenic
1007374522 6:41447234-41447256 ATTGAGAGCCTACTATGGGCTGG - Intergenic
1007502718 6:42311056-42311078 ATTGAGCACCTACTATATGTTGG + Intronic
1007791834 6:44313484-44313506 ATTAAGAGCCTACTATGTGCCGG - Intronic
1008015331 6:46512196-46512218 ATGGAGTGCATACTGTGTGTAGG + Intergenic
1008602176 6:53106952-53106974 ATGGAGAGCCTATTATGTGCTGG - Intergenic
1009346814 6:62623333-62623355 ATGGAGAGTCAAATGTATGTTGG + Intergenic
1009430595 6:63561332-63561354 ATTGAGTGCTTACTATGTGTTGG - Intronic
1010779154 6:79923740-79923762 ATTGAGCATCTACTATATGTTGG - Intronic
1010873665 6:81073573-81073595 ATGAAGAGTCTACTATGTGCTGG - Intergenic
1011113312 6:83862305-83862327 ATTGAGAACCTACCATATGCTGG + Intronic
1013027486 6:106291522-106291544 ATGGAGATCCTTCTGTGTGTCGG - Intronic
1013717036 6:112974896-112974918 ATGGAGATCCTTATATATTTTGG + Intergenic
1014138441 6:117914553-117914575 ATTGAGTGACTATTATATGTTGG + Intronic
1014164098 6:118204046-118204068 ATGGAGGGCCTACTTTATCTAGG + Intronic
1014645798 6:123971033-123971055 ATTGAAAGCTTACTATATGCTGG + Intronic
1015058770 6:128936546-128936568 ATAAAAAGCATACTATATGTAGG - Intronic
1024402297 7:48939001-48939023 CTTGAGTGCCTACCATATGTTGG + Intergenic
1028439410 7:90841820-90841842 ATGGAGTGCCCACTCTGTGTTGG + Intronic
1030354670 7:108528688-108528710 TTAGAGAGTCTACTATTTGTTGG - Intronic
1035114850 7:156516011-156516033 ATGGAGTGCCAACTTTGTGTCGG - Intergenic
1038335487 8:26642182-26642204 TTGGAGTGCCTACTATGTGCAGG + Intronic
1038891276 8:31727099-31727121 ACGGAGTGCCTACTATGTATAGG + Intronic
1039815932 8:41094506-41094528 ATGGAGTACCTCCTACATGTGGG - Intergenic
1041500464 8:58533944-58533966 ATGTAGAGCTAACTATATATTGG - Intergenic
1041993003 8:64017123-64017145 ATGGTCAGCCTGCTATATTTGGG - Intergenic
1043314629 8:78905085-78905107 TTGGAAATCCTACTATATGAGGG - Intergenic
1043926702 8:86044961-86044983 ACTGAGTGCCTGCTATATGTGGG + Intronic
1044038017 8:87330910-87330932 ATCAAGACCCAACTATATGTTGG - Intronic
1045753576 8:105514874-105514896 ATTAAGAGCCTACTATGTGCAGG - Intronic
1047090027 8:121564068-121564090 ATAGAAATTCTACTATATGTTGG - Intergenic
1048189509 8:132275191-132275213 ATTGAGTGACTACTATCTGTTGG - Intronic
1048365526 8:133735161-133735183 TTTGAGCACCTACTATATGTAGG + Intergenic
1048446016 8:134493838-134493860 ATTGAGTGCCTACTATAAGCTGG - Intronic
1050633953 9:7590295-7590317 ATTGAGTCCCTACTATATGCTGG + Intergenic
1050746726 9:8884825-8884847 GTGGAGGGCCCACTATGTGTTGG + Intronic
1056024290 9:82476779-82476801 ATGGAATACCTACTGTATGTTGG + Intergenic
1056501742 9:87216275-87216297 ATGGAGAGACTTCTATTTCTTGG - Intergenic
1057868125 9:98697573-98697595 ATCCAGTGCTTACTATATGTCGG - Intronic
1058032104 9:100211353-100211375 TTGGAGAGCCTTTTATATATAGG - Intronic
1060174618 9:121488335-121488357 ATTGAGGGCCTACTACATGCAGG + Intergenic
1186596002 X:10982114-10982136 ATTGAGTGCTTCCTATATGTTGG + Intergenic
1187439935 X:19309323-19309345 ATTGAGCTCCTCCTATATGTGGG + Intergenic
1188250423 X:27886861-27886883 ATTGAGTGACTACTATATGTTGG + Intergenic
1188310504 X:28611323-28611345 ATTGAGTTCCTGCTATATGTGGG + Intronic
1189381189 X:40503516-40503538 ATTGAGTGCTTACTATATGCAGG - Intergenic
1189753553 X:44247723-44247745 ATTAAGCACCTACTATATGTAGG - Intronic
1190114307 X:47616216-47616238 ATTTAGTGTCTACTATATGTGGG - Intronic
1196759777 X:119190726-119190748 ATGGAGTGCTTACTATGTGCTGG + Intergenic
1198673993 X:139112316-139112338 ATGGAGAGCCTACTATATGTTGG - Intronic