ID: 1198674866

View in Genome Browser
Species Human (GRCh38)
Location X:139120769-139120791
Sequence CCCACAGTGCCTGAAGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198674866_1198674871 -5 Left 1198674866 X:139120769-139120791 CCTACGCCTTCAGGCACTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 129
Right 1198674871 X:139120787-139120809 GTGGGCTGTGGGCCAGCCAGAGG 0: 1
1: 0
2: 6
3: 49
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198674866 Original CRISPR CCCACAGTGCCTGAAGGCGT AGG (reversed) Intronic
901929260 1:12586324-12586346 CCCACCGTGCCTGGGGGCTTAGG - Intronic
903607297 1:24584316-24584338 CACACAGTGCCAGAAGTCGGTGG - Intronic
904034001 1:27549511-27549533 CCCAGAGTCCCGGAAGGCATCGG - Exonic
905693218 1:39957462-39957484 GCAACAGAGCCTGAAGGGGTAGG + Intronic
906779542 1:48560339-48560361 CCCACAGTGGCCCAAGGCATGGG - Intronic
908751742 1:67430448-67430470 CCCACAGTGCCTTGCGGCGCAGG - Intergenic
912818537 1:112849372-112849394 CCCAGAGAGCCTGAAGGCAGGGG + Intergenic
913535604 1:119769116-119769138 GCCACAGAGCCTGATGGAGTAGG - Intergenic
920012335 1:202877914-202877936 CCCACAGTGGCTGGAGACATCGG - Intergenic
924099377 1:240588011-240588033 CCCACGGTGCCTGCAGGCACAGG + Intronic
924492572 1:244553437-244553459 CCTACAGTGCCTGTAGTGGTGGG + Intronic
1067937084 10:50622407-50622429 CCCCCAGTGCCAGGAAGCGTGGG + Intronic
1069752685 10:70754216-70754238 CACACAGTGCCAGGAGGCATGGG + Intronic
1070505736 10:77111260-77111282 CCCACAGGGCCTGTAGACGGTGG + Intronic
1070796808 10:79221623-79221645 CCCACGTTGCCAGCAGGCGTGGG - Intronic
1072470268 10:95706977-95706999 CCCTCAGTCCCTGCAGGCTTAGG - Intergenic
1073798981 10:107020617-107020639 CCCACACTGCATGAGGGCTTGGG - Intronic
1076492313 10:130870374-130870396 CCCAAAATGCCAGAAGGCATCGG + Intergenic
1080214311 11:29823589-29823611 CCCACAGAGCCTAAAGTAGTGGG + Intergenic
1083396022 11:62392645-62392667 CCCACAGTGTCTGCAGGCTGTGG - Exonic
1083399404 11:62413580-62413602 CCCATACTGCCAGAAGGCATTGG - Intronic
1086924467 11:92625313-92625335 CTGACAGTGCCTGGAGGAGTGGG + Intronic
1088259337 11:107929078-107929100 CCCACAGGGGCTGAAAGAGTTGG - Intronic
1089774111 11:120824327-120824349 CTCACAGAGCCTGAGGGAGTTGG + Intronic
1097237901 12:57552220-57552242 CCCAGAGAGCCTAAAGGAGTTGG - Intronic
1097311999 12:58129412-58129434 CCCAAACTGCATGAAGGCTTTGG + Intergenic
1102304184 12:111792244-111792266 CCCCCAGTGCCCAATGGCGTTGG + Intronic
1103796441 12:123506339-123506361 CACACAGTGCCTTAAGGCATGGG + Intronic
1105877506 13:24572002-24572024 CACACAGTTCCTGAAGTCCTTGG + Intergenic
1121636486 14:95457248-95457270 CCAACTGTGGCTGAAGGCGGTGG - Exonic
1122242141 14:100376114-100376136 CTCACAGTGCCAGAACGCGGCGG + Intronic
1122804169 14:104248280-104248302 CCCCCAGGGCCTGGAGGCCTGGG - Intergenic
1123133429 14:106006768-106006790 CCCACAGTGCCCCTAGGCCTGGG + Intergenic
1123135819 14:106026738-106026760 CCCACAGTGCCCCTAGGCCTGGG + Intergenic
1123165170 14:106319443-106319465 CCCACAGTGCCCCTAGGCCTGGG + Intergenic
1123583455 15:21737214-21737236 CCCATAGTGCCTCTAGGCCTGGG + Intergenic
1123620105 15:22179817-22179839 CCCATAGTGCCTCTAGGCCTGGG + Intergenic
1126929731 15:53634333-53634355 CTCAAACTGCCTGAAGGCATAGG + Intronic
1129968013 15:79754028-79754050 CCCACAGTGCCTTCTGGCCTGGG + Intergenic
1129975322 15:79816759-79816781 CCCACTGTGTCTGAGGGCGAAGG + Intergenic
1132463057 16:64871-64893 CCCACAGTCCCTGCAGGCCAGGG + Intronic
1132746630 16:1438928-1438950 CCCACAGAGAATGAAGGCCTCGG - Exonic
1138657174 16:58498239-58498261 GCCACAGTGCCTGCAGGAATGGG + Intronic
1143378467 17:6480859-6480881 CCCTCAGTGCCTGGAGCAGTGGG + Intronic
1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG + Intronic
1147330333 17:39695549-39695571 CCCACAGTGCCTTGAGGCTGAGG - Intronic
1148206362 17:45782830-45782852 CTCACAGTGCCTGGAGGGCTGGG - Intergenic
1150670010 17:67186053-67186075 GCCACAGTGCCTGCAGATGTTGG - Intronic
1150793869 17:68222347-68222369 CGCACAGTGGCTGAAGCCGTGGG + Intergenic
1151487703 17:74411780-74411802 CCCAGAGGGCCAGAAGGCTTAGG + Intergenic
1160071082 18:75628315-75628337 CCCACTGGTCCTGAAGGCCTGGG - Intergenic
1162967484 19:14162847-14162869 CCCACACACCATGAAGGCGTTGG + Exonic
1164023482 19:21329454-21329476 CCCTCAGGGCCTGAAGGGGCGGG - Intergenic
1165900798 19:39168384-39168406 CCCACAGTGCCTGTGGGAGGAGG - Intronic
1167536832 19:50059025-50059047 CCCACATTCCTTGCAGGCGTAGG + Intergenic
1168491392 19:56813666-56813688 CCCACACTGGCTGAGGGCATGGG - Exonic
929455187 2:42060269-42060291 CACACAGTGGCTGAAGGGGATGG + Intergenic
932265315 2:70362818-70362840 AGCACAGTGCCTGAGTGCGTTGG + Intergenic
934661854 2:96147296-96147318 CCCACAGAGCTGGAAGGCTTTGG - Intergenic
937078024 2:119121226-119121248 CCCACAGTGCATGGAGGCTGAGG + Intergenic
937264446 2:120607159-120607181 CCCGGACTGCCTCAAGGCGTTGG - Intergenic
937390305 2:121480294-121480316 CCTACAGTGCCTTAAGGAGCAGG - Intronic
938026641 2:127955078-127955100 CCCACAGTGACTGATGGAGGTGG + Exonic
942345727 2:175000842-175000864 CCCAAAGTGCCAGGAGGCATGGG + Intronic
946186023 2:217980805-217980827 CCCAGAGTGCCTCAGGGCCTTGG + Intronic
1169811899 20:9616851-9616873 CCCACAATGCCAGTAGGCATAGG + Intronic
1170658760 20:18315993-18316015 CCCACACTCCTTGCAGGCGTAGG - Exonic
1171045970 20:21809583-21809605 GCCACAGAGGCTGAGGGCGTCGG + Intergenic
1173226136 20:41163365-41163387 CCCACAGCTCCTGATGGGGTAGG - Exonic
1174356130 20:49999197-49999219 CGCAGAGTGCCTGAAACCGTAGG - Intergenic
1175250714 20:57608831-57608853 CCTCCAGTGCCTGAAGGCCCAGG - Intronic
1175715677 20:61252979-61253001 CCGGCCGTGGCTGAAGGCGTGGG + Intronic
1175767157 20:61599498-61599520 CCCACTGTGGCTGGAGGTGTGGG + Intronic
1178037087 21:28597028-28597050 CCCAAAGTGACTGAAAGAGTAGG - Intergenic
1181476065 22:23168515-23168537 CACACAGTGCCTGAAGCGGCAGG - Intergenic
1182299368 22:29329214-29329236 CCCAGAGTCCCTGAAGGTCTGGG + Intronic
1183339738 22:37273603-37273625 CCCACAGACACTGAAGGAGTGGG + Intergenic
954275675 3:49540142-49540164 CGCACAGTCCCTGAGGGCATCGG + Intergenic
958123454 3:89324419-89324441 GCCACAGCGCCTGGAGGCCTAGG - Intronic
966220260 3:177544491-177544513 TCCCCAGTGCCTGGAGGCCTGGG + Intergenic
967384989 3:188902418-188902440 ACGACACTGCCTGAAGGCTTGGG + Intergenic
968573567 4:1354730-1354752 CCCAGAGGGCCTGAAGGTGCAGG + Exonic
977393202 4:96439559-96439581 CACACAGTGCCAGAAGGTATTGG - Intergenic
977724164 4:100275502-100275524 CCCACAGTGCTTGGAGGCCATGG - Intergenic
980324165 4:131319959-131319981 CCCACATTTCTTGAAGGCTTTGG + Intergenic
982066957 4:151662661-151662683 CCCAGAGTTCCTGAAGGAGCTGG + Exonic
984535762 4:180973330-180973352 CCCACAGTGCCTAATGGGTTAGG - Intergenic
985912629 5:2895853-2895875 CCCAGAGTGCCTGCAGGTGTGGG + Intergenic
987865181 5:23527664-23527686 CCCACACTCCCTGCAGACGTAGG - Exonic
989168038 5:38449528-38449550 CCCCCAGAGACTGAAGGCTTGGG - Intronic
992213214 5:74501419-74501441 CCCACAGTGCCTGACCTAGTGGG - Intergenic
996020787 5:118588732-118588754 GCCACAGTGCCCTAAGGCTTGGG - Intergenic
999188297 5:149729185-149729207 CCCACAATGCATGAAGGGGCTGG - Intergenic
1001380956 5:171306388-171306410 CCCAGAGTGTCTGATGCCGTAGG + Exonic
1001999210 5:176187892-176187914 CCCACAGTGGCTGAAGCAGCAGG - Intergenic
1003116592 6:3287607-3287629 CCCACACAGCCTGGAGGAGTCGG + Intronic
1005815338 6:29547375-29547397 CACACAGTCCCTCAAGGCTTCGG - Intergenic
1007662329 6:43494578-43494600 CCCTCAGTTCCTCAAGGCTTAGG + Intronic
1019592267 7:1841633-1841655 CCCACAGTGGCTGAGGCCGGTGG + Intronic
1020077227 7:5266387-5266409 TCCACAGTGCCTCTAGGGGTGGG - Intergenic
1020275590 7:6622694-6622716 GCCACAGTCCCCGCAGGCGTAGG - Exonic
1022339543 7:29455531-29455553 CCCACAGTTCCTGCAGTGGTGGG - Intronic
1022496204 7:30854727-30854749 CCCAAAGACCCTGAAGGCCTGGG + Intronic
1023356798 7:39375444-39375466 CGCCCAGTCCCTGAAGCCGTGGG + Intronic
1024050335 7:45617164-45617186 CCCACATTTCCTGAATGCCTAGG - Intronic
1026994588 7:74607040-74607062 CCCCCAGTCCCTGGAGGCCTGGG + Intergenic
1027700806 7:81468211-81468233 CCCACTGGGACTGAAGGCGGGGG + Intergenic
1028504088 7:91552664-91552686 GCCCCAGTTCCTGAAGGCTTGGG - Intergenic
1029202989 7:98851500-98851522 CCCAGGGTCCCTGAAGGTGTGGG + Exonic
1029595907 7:101537598-101537620 CCCACAGAGCCTGCAGACCTGGG - Intronic
1029735594 7:102464357-102464379 CCAACGGTGCCTGAAGGCCGTGG - Intronic
1032581666 7:133108725-133108747 ACCACAGTGCCTGTGGGAGTAGG - Intergenic
1033831565 7:145260299-145260321 CCCCCAGGGCCTGAAGCCTTGGG - Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034675340 7:152889017-152889039 CCCCCAGTGCCCGAAGGCGCTGG - Intergenic
1034849728 7:154482268-154482290 GCCACAGAGCCTGTAGGTGTTGG - Intronic
1035958228 8:4106772-4106794 GCCACAGTGGCTGACGGCGATGG + Intronic
1037861025 8:22405684-22405706 CCCACAGTCCCTCAAGGTGCAGG + Intronic
1039465234 8:37780634-37780656 CTCACAGTCTCTGAAGGCGCTGG + Intergenic
1042485097 8:69339242-69339264 CCCACAGTGCCTGAGGGGCTGGG - Intergenic
1044962287 8:97542816-97542838 CCCACAGTCCCTGCTGGCTTGGG + Intergenic
1045017086 8:98009586-98009608 CCCAAGGTGCCTGAAGAGGTAGG - Intronic
1045993150 8:108333772-108333794 TCCACAGGGCCTGATGGTGTAGG - Intronic
1046601407 8:116321218-116321240 CTCACTGTGCCTGAAGACCTTGG + Intergenic
1048259513 8:132933937-132933959 CCCACACTGCCTGATGGGGCAGG - Intronic
1049549467 8:143250352-143250374 CCCACAGTGCGTGCATTCGTAGG - Exonic
1049709460 8:144057109-144057131 CCCACTGTGCCTGCAGGGATGGG + Exonic
1056262669 9:84864330-84864352 CCCACAGTCCCGGAAGTCCTTGG - Intronic
1059447802 9:114349693-114349715 CCTACAGGGCCTGAAGGCCATGG - Intronic
1060413065 9:123412499-123412521 CTCACAGAGCCTGCAGGCATAGG - Intronic
1061627310 9:131848662-131848684 CCCACAAAGCCAGCAGGCGTGGG - Intergenic
1190760361 X:53433568-53433590 CCCACAGTGCTTGAAGGCTCAGG + Intronic
1192169043 X:68843183-68843205 GCCACAGGGCCTGCAGGCGGAGG + Intergenic
1198517333 X:137422898-137422920 ACCACAGTGTCTGAAGCAGTTGG - Intergenic
1198674866 X:139120769-139120791 CCCACAGTGCCTGAAGGCGTAGG - Intronic
1199990135 X:152982910-152982932 CCCACTGTGGGTGAAGGAGTCGG + Intergenic