ID: 1198676510

View in Genome Browser
Species Human (GRCh38)
Location X:139136947-139136969
Sequence CTGTTGACATGGTTGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198676510 Original CRISPR CTGTTGACATGGTTGGGCCT TGG (reversed) Intronic
900294113 1:1940106-1940128 CTGCTGGCCTGGATGGGCCTCGG + Intronic
901647387 1:10723944-10723966 CTGCTGGCATGGTTTGGACTCGG - Intronic
904892643 1:33790971-33790993 CAGGTGACATGGCTGGGACTTGG - Intronic
906781326 1:48575581-48575603 CTGTGGACATGTCTGGGCCTTGG - Intronic
908651940 1:66343363-66343385 CTGATGACATGTTTGAGCCAAGG - Intronic
912538379 1:110393702-110393724 CTGTTTACATGGTTGGCCTCTGG + Intergenic
915554573 1:156654311-156654333 CAGTTGACATGGGTAAGCCTGGG - Intronic
916031018 1:160877684-160877706 CTGGTGACATGGTTTGGACCTGG + Intronic
919541820 1:198856705-198856727 CTGTAGTCATGGATGGGCTTTGG + Intergenic
919759630 1:201089340-201089362 GTGATGCCATGGTTGGGCCCTGG + Exonic
920080205 1:203367533-203367555 CTGTTGCCCTGGGTGGTCCTGGG - Intergenic
1063506708 10:6606385-6606407 GTGGTGACATGGTTGGGTGTAGG + Intergenic
1063864059 10:10344935-10344957 CTGCTGACCTGGTTGGTCCCAGG + Intergenic
1064673607 10:17740055-17740077 CTGTTTACAAAGTTGGCCCTTGG + Intergenic
1067484532 10:46635484-46635506 CGGTTGATGTGGTTGGGCCGGGG - Intergenic
1067610227 10:47706163-47706185 CGGTTGATGTGGTTGGGCCGGGG + Intergenic
1068547977 10:58373072-58373094 CTGTTTACAAGGTTTGCCCTTGG - Intergenic
1070397609 10:76025168-76025190 CTGGTGACAGGGTTTGGCCTGGG - Intronic
1071431299 10:85609111-85609133 CTTTTGACAAGCTTGCGCCTGGG + Intronic
1071486121 10:86103792-86103814 CTCGTGACATGGTTGGGCCAGGG - Intronic
1072969373 10:100003650-100003672 CTGTTGCCCTGGCTGGGCCCTGG - Intronic
1073528283 10:104206792-104206814 CTGTGGCCATGGTTGGGCCTGGG - Intronic
1075856127 10:125631725-125631747 GCGTTGACATCGCTGGGCCTTGG - Intronic
1076197190 10:128527250-128527272 CTTTGGAGAAGGTTGGGCCTTGG - Intergenic
1081502672 11:43681428-43681450 CTGTTAACATGTTTGGGCAGAGG + Intronic
1081615250 11:44587064-44587086 CTGATGACTTGGTTGGGGCAGGG + Intronic
1084147948 11:67275008-67275030 CTGAAGACAAGGATGGGCCTAGG - Intronic
1085618040 11:78016749-78016771 CTGTTGTCAAGTTTGGGCCCTGG - Exonic
1087929521 11:103960792-103960814 GTGCTGACATGGTTGGGCTCAGG + Intronic
1088045836 11:105449454-105449476 CTCTGGACATGGCTGGGCCCTGG + Intergenic
1089358029 11:117868308-117868330 CTGTTGACGTTGATGGGACTGGG - Intronic
1090547999 11:127786668-127786690 GTGTTAACATGGTGGAGCCTTGG + Intergenic
1090995305 11:131860681-131860703 CTGCTTGCATGGTTGGTCCTTGG - Intronic
1095502553 12:42856335-42856357 GTGTTAACATGGATGGGCCCTGG + Intergenic
1102709172 12:114910193-114910215 CTGTTGACATGACTGTGCATTGG + Intergenic
1104142871 12:126005307-126005329 GTCTTGACATCTTTGGGCCTTGG + Intergenic
1107450506 13:40504504-40504526 CTGTTGAGATGGGTGGATCTTGG - Intergenic
1113132822 13:107057123-107057145 TGGTTGTGATGGTTGGGCCTAGG - Intergenic
1113657776 13:112079611-112079633 CTGGTGACAGGGTGGTGCCTCGG + Intergenic
1113917883 13:113884971-113884993 CTGATGACCTGGTGGGGCCCAGG - Intergenic
1114897480 14:27009552-27009574 TTATTGACATGGTTTGGCTTTGG + Intergenic
1118592224 14:67410334-67410356 CTGTTGATATAGCTGGGCCCTGG - Intronic
1119104607 14:71912342-71912364 CTGTTCAATTGGTTGGGCTTAGG + Intergenic
1119386634 14:74261431-74261453 CTGCAGACCTGGCTGGGCCTGGG + Exonic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120472189 14:84939366-84939388 TTGTTGAAATGGCTGGGCTTAGG - Intergenic
1125974328 15:43937749-43937771 GTGTTGACTTGGTTGGACCATGG + Intronic
1126819933 15:52492635-52492657 CTGTTTACAAGGTTGGCCCTTGG - Intronic
1128727840 15:70000834-70000856 CTGTTGTCTTGCCTGGGCCTGGG - Intergenic
1128757292 15:70191631-70191653 CTGTTAACCTGGTCTGGCCTCGG + Intergenic
1131071617 15:89469973-89469995 CTGTTGGCCTGGTGGTGCCTGGG + Intergenic
1131177590 15:90219741-90219763 CTGGTGGCATGCTTGGGCGTGGG + Intronic
1138174252 16:54882397-54882419 TTGTTAGCAGGGTTGGGCCTGGG + Intergenic
1139287537 16:65829096-65829118 CTTTTTACATGGAGGGGCCTTGG - Intergenic
1140247285 16:73262955-73262977 CTGGTGGCTTGGTTGGGGCTGGG - Intergenic
1141051576 16:80769644-80769666 CTGTTCACATCTTTCGGCCTGGG - Intronic
1143615713 17:8047986-8048008 CTGATGGCAGGGTTGGGTCTGGG - Intronic
1143953127 17:10649079-10649101 CTGCTGATTTGGTTGGTCCTAGG - Intronic
1147647161 17:42040683-42040705 CTATTGACTTGGCAGGGCCTCGG - Intronic
1148289562 17:46432361-46432383 ATGGTGCCATGGTTGGCCCTTGG - Intergenic
1148311730 17:46649933-46649955 ATGGTGCCATGGTTGGCCCTTGG - Intronic
1148445592 17:47735082-47735104 CTGTTGTCATTGGTGGACCTGGG + Intronic
1150901785 17:69286956-69286978 CTGCTTACAAGGTTGGCCCTTGG + Intronic
1151132720 17:71914884-71914906 GTGCTGACAAGGTTGGGCATGGG + Intergenic
1155588536 18:27397612-27397634 GTGTTGACATGGCTAGGCCATGG + Intergenic
1156500290 18:37553353-37553375 GTGATGAAATGGATGGGCCTGGG - Intronic
1157690713 18:49679644-49679666 GTGTTGACTTGGATGGGCCACGG - Intergenic
1159913909 18:74172162-74172184 CTGTCGACATGGTTGTGTTTAGG - Intergenic
1159995768 18:74962492-74962514 CTGTGGGAATGGATGGGCCTAGG + Intronic
1160893257 19:1390587-1390609 CTGTTGAAATGGTGGGACTTAGG + Intronic
1161479988 19:4505638-4505660 CTGTGGACAGGGTGGGGCGTGGG - Intronic
1161949627 19:7460554-7460576 CTGTTGCCAGGGTTGGGGCATGG - Intronic
1162150276 19:8640101-8640123 CTGTTCTCATGGTTGCGTCTTGG + Intergenic
1162953502 19:14085618-14085640 CTGTAGCCATGGTAGGGCCGGGG + Exonic
1168694737 19:58397798-58397820 CTGTACACCTGGTTGGGGCTGGG + Intergenic
925152920 2:1628007-1628029 CTGGTCACATGGTGGGGACTTGG + Intergenic
927255056 2:21033998-21034020 CTGTTGACATGGTTACAACTGGG + Intronic
929876321 2:45799982-45800004 CTGTTTCCATGGTGGGTCCTGGG + Intronic
930712342 2:54560423-54560445 CTTTTGTTATGGGTGGGCCTAGG - Intronic
932111826 2:69008865-69008887 AGGTTGACTTGGTTGGGCTTTGG + Intergenic
932321761 2:70827532-70827554 TTGTTGCCCTGGTTGGGGCTGGG - Intergenic
942796668 2:179828860-179828882 CTGCTGACATTGTTGATCCTAGG - Intronic
943337725 2:186639315-186639337 CAGTTGAGATTGTTGGGCTTTGG + Intronic
1169598319 20:7226358-7226380 CTGGTGGCATGCTTGGGCATTGG + Intergenic
1171528481 20:25834951-25834973 CTGTGCACAAGGTTGGGTCTCGG + Intronic
1171548345 20:26020935-26020957 CTGTGCACAAGGTTGGGTCTCGG - Intergenic
1172956979 20:38767873-38767895 CTGTAGACATTGTGGGGCATGGG + Intronic
1173109498 20:40173538-40173560 CTGGTTTCATGGTTGGGCTTAGG - Intergenic
1173354158 20:42271205-42271227 CTGTTGTCATGCTTGGGACAGGG - Intronic
1174121127 20:48266515-48266537 CTGTTGATAGGTTTGGGGCTAGG - Intergenic
1175712553 20:61232679-61232701 CTGTTGACCTGGTTTAGCTTGGG - Intergenic
1177503957 21:21997689-21997711 CTCTGGACCTGCTTGGGCCTGGG - Intergenic
1178601397 21:33997840-33997862 GTGTTGACATGACTGGGCCATGG - Intergenic
1179727945 21:43350701-43350723 CAGTTGGGATGGTGGGGCCTTGG - Intergenic
1180182103 21:46122654-46122676 TAGGTGACATGGCTGGGCCTTGG - Intronic
1180836026 22:18929828-18929850 CTGTGGACCTGGTCAGGCCTTGG - Intronic
1181415676 22:22757013-22757035 CTGTTGACAAGGGTGGGCTGTGG - Intronic
1181511870 22:23392947-23392969 CTGATGACAGGGGTGGGCATGGG - Intergenic
1181745887 22:24954573-24954595 CTGTAGAAATGGTGTGGCCTAGG + Intronic
1182485089 22:30634759-30634781 CTGGGCACATGGCTGGGCCTTGG + Intergenic
1182939569 22:34262356-34262378 CTGGTGACCTCGTTGGGCATGGG + Intergenic
1183042321 22:35191551-35191573 CTGTTTACGAGGTTGGCCCTTGG + Intergenic
1184719349 22:46300900-46300922 CTGATGACATCGATGGCCCTTGG - Intronic
1184894444 22:47399106-47399128 GTGTTTACATGGCTTGGCCTGGG - Intergenic
1203286118 22_KI270734v1_random:155127-155149 CTGTGGACCTGGTCAGGCCTTGG - Intergenic
952231071 3:31431771-31431793 GTGTTGACTTGGCTGGGCCATGG - Intergenic
952354682 3:32573091-32573113 ATTTTAACATGGTTTGGCCTAGG - Intergenic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953674578 3:44990861-44990883 CTGTTTGCAGGGTTGGCCCTTGG - Intronic
960315391 3:116169572-116169594 CTGTTGGCATTGCTGGGCTTTGG - Intronic
961559281 3:127717624-127717646 CTGTTGCCAAGGTTGTCCCTTGG - Intronic
962327469 3:134447749-134447771 CTCAAGACAAGGTTGGGCCTGGG + Intergenic
964429937 3:156594717-156594739 CTGTTGACCTTTTTGGACCTGGG - Intergenic
965636087 3:170782386-170782408 CTGTGGACCTGTTTGGTCCTGGG - Intronic
966304330 3:178513729-178513751 CTCTTGCCTTGCTTGGGCCTTGG + Intronic
967467959 3:189829226-189829248 CTTTTAAGATGGTTGGGTCTTGG - Intronic
969503240 4:7567556-7567578 CTGTTGGCAGGGTGTGGCCTTGG - Intronic
969846757 4:9925443-9925465 CTGTGGAAAGGGGTGGGCCTTGG + Intronic
969880289 4:10167666-10167688 CTGGTAACATGGTTATGCCTGGG + Intergenic
971709156 4:30089147-30089169 CTTTTGACATGGCTGGGATTAGG - Intergenic
973294099 4:48496293-48496315 CTGTTGATTTGGTTGGGGGTAGG + Intergenic
978084138 4:104629643-104629665 TTGTTGTCAGGGTTGGTCCTTGG + Intergenic
978546891 4:109879875-109879897 CTGTAGTCATGGGAGGGCCTGGG + Intergenic
979617684 4:122762653-122762675 CTGTTGACAATGTTGAGCCCTGG + Intergenic
980765612 4:137300196-137300218 ATGTGGACATGTTTGGGCCCCGG + Intergenic
981018738 4:140003270-140003292 TTGTAAACATGGTTGGGTCTGGG + Intronic
985662195 5:1162789-1162811 ATGTGCACAGGGTTGGGCCTAGG + Intergenic
986705760 5:10453385-10453407 TTGTTGACCTTGTTGGCCCTGGG + Intronic
987389543 5:17363125-17363147 GTGGGGAAATGGTTGGGCCTGGG - Intergenic
988914352 5:35877341-35877363 CTTTTGACATGGCTGGTCATGGG - Exonic
989030863 5:37116939-37116961 CAGGTGAAATGGTTGGGTCTGGG + Intronic
991005778 5:61826672-61826694 CTGTTGCCCTGGTTGGCCTTGGG - Intergenic
992522286 5:77566817-77566839 CTGTGCACATGTCTGGGCCTGGG + Intronic
996925703 5:128823843-128823865 GTGTTGACATTCTTGGGCCCAGG - Intronic
1003761845 6:9187637-9187659 CTTTTTACATAGTTGGCCCTGGG - Intergenic
1003873316 6:10417909-10417931 CTGTTGAGTAGGTTTGGCCTGGG - Intronic
1006015807 6:31079676-31079698 CTGTTCACAGGCTTTGGCCTGGG - Intergenic
1006052538 6:31355644-31355666 CTGGTCACATGGGTGGTCCTAGG - Intronic
1007594586 6:43043652-43043674 CTGCAGACATGGCTGTGCCTTGG - Intronic
1010350169 6:74864167-74864189 CTGCTTGCATGGTTGGCCCTTGG - Intergenic
1013175094 6:107669779-107669801 CTGTTTTCCTGGCTGGGCCTTGG + Intergenic
1016719535 6:147279103-147279125 CTGCTTACAAGGTTGGCCCTTGG - Intronic
1017802857 6:157913663-157913685 CTGTTGCCATGGTTAGGACCAGG - Intronic
1024631650 7:51253444-51253466 ATCTTGACAAGGTTGTGCCTGGG - Intronic
1031033279 7:116758489-116758511 CAGTTGAAATGGTTTGGGCTGGG - Exonic
1031240307 7:119229683-119229705 CTGTTGATATGGTTTGGCTGTGG - Intergenic
1031313208 7:120225667-120225689 TTGTAGACATAGTTGGACCTAGG - Intergenic
1031528460 7:122849895-122849917 CTGATGCCATGGTTGGGGCAGGG - Intronic
1034253562 7:149712683-149712705 CTGGTGAATTGCTTGGGCCTGGG - Intergenic
1034509015 7:151519529-151519551 CGGTTGATGTGGTTGGGCCGGGG - Exonic
1034983174 7:155491130-155491152 CTGTTGCCATGGTTGGCCTCAGG + Intronic
1035362914 7:158325165-158325187 CTGTGGAGATTGTGGGGCCTGGG - Intronic
1038947255 8:32374949-32374971 CTGATGACATTCTTAGGCCTAGG - Intronic
1039143434 8:34418941-34418963 CTGTGGACATCGTAGAGCCTGGG + Intergenic
1040293484 8:46137336-46137358 AGGTTGACATGGTCGGGCCACGG - Intergenic
1046361592 8:113165912-113165934 CTGTTGCCATGGTGGGGTCAAGG + Intronic
1049678461 8:143904114-143904136 CTGTTGACAGCGTTGTCCCTGGG + Intergenic
1052437023 9:28443365-28443387 CTGTTGAGCTGGTTGGGGCGGGG + Intronic
1053468908 9:38331423-38331445 CTGCTGTCAAGGTTGGCCCTTGG - Intergenic
1057935756 9:99237444-99237466 CTGTTTGCAAGGTTGGACCTTGG + Intergenic
1060131767 9:121107124-121107146 CTGGTGACAGGATAGGGCCTGGG + Intronic
1061561510 9:131407216-131407238 CTGTTGACATGGTTGGAGGGTGG + Intronic
1185750307 X:2605646-2605668 CTGTTGACATGATGGGGCTGTGG - Intergenic
1186162847 X:6795846-6795868 CTTTTGACATGGTATGGGCTTGG - Intergenic
1186211372 X:7253777-7253799 CTGACGACAGGGTAGGGCCTGGG - Intronic
1186516769 X:10172075-10172097 CTGTTTGCAAGGTTGGCCCTTGG - Intronic
1186768948 X:12798668-12798690 CTGTTCGCAAGGTTGGCCCTTGG + Intronic
1190424375 X:50318703-50318725 CTGTTTGCAAGGTTGGCCCTTGG + Intronic
1190753765 X:53383262-53383284 TTCTTGACATTGCTGGGCCTGGG - Intronic
1198334056 X:135650201-135650223 CTGGTGACATCCTAGGGCCTCGG + Intergenic
1198676510 X:139136947-139136969 CTGTTGACATGGTTGGGCCTTGG - Intronic
1198749501 X:139924509-139924531 CTGTTTGCAAGGTTGGTCCTTGG + Intronic