ID: 1198677421

View in Genome Browser
Species Human (GRCh38)
Location X:139145688-139145710
Sequence CAGTTGGAGAGGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1175
Summary {0: 1, 1: 1, 2: 12, 3: 133, 4: 1028}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198677421 Original CRISPR CAGTTGGAGAGGAGGGAAGG TGG (reversed) Intronic
900125706 1:1068185-1068207 CAGTTGGAGAGGTGTGTGGGAGG - Intergenic
900127348 1:1074410-1074432 CAGCTGGAGGGCAGGGAGGGAGG + Intergenic
900151106 1:1179732-1179754 CTGTTGGTGAGGAGGGTCGGAGG + Exonic
900271257 1:1790161-1790183 CAGCTGTAGAGGTGGGAACGGGG + Intronic
900553857 1:3270107-3270129 CAGTCGGAGAGGAGGACAGTCGG + Intronic
900571338 1:3360035-3360057 CAGTTGGGGACAAGGGATGGCGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901567708 1:10132259-10132281 AAGTGGGAGAGGAGAGAACGTGG + Intronic
901625598 1:10623064-10623086 CAGCTGGAGAGGATGGAGGCCGG + Exonic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901737326 1:11320614-11320636 CATGGGCAGAGGAGGGAAGGTGG - Intergenic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902667028 1:17946680-17946702 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
903341032 1:22654368-22654390 CAGTTGGTGGGGAGAGAGGGTGG - Intronic
903677638 1:25074447-25074469 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
903801052 1:25968482-25968504 GAGTGGGAGAGGAGAGTAGGTGG + Intronic
904236840 1:29122090-29122112 CGGGCGGAGAGGAGGGAGGGGGG + Intronic
904497615 1:30895904-30895926 GAGATGGAGAGGAGGGAGGTTGG + Intronic
904563201 1:31412462-31412484 CAGATGGAGAGAAGGGAGGATGG + Intronic
904812945 1:33175589-33175611 CAGTTGGCGTGTTGGGAAGGAGG + Intronic
905055410 1:35089494-35089516 AAGATGGAAATGAGGGAAGGTGG + Intronic
905408541 1:37753354-37753376 CAGTCGGGGAGGAGGGAACCAGG + Intronic
905564016 1:38948889-38948911 AAGAAGGAAAGGAGGGAAGGAGG + Intergenic
905869674 1:41396025-41396047 CAGTTCAGGTGGAGGGAAGGTGG - Intergenic
906264987 1:44421792-44421814 CAGTGGGAGAGGTGGGGAGTAGG + Intronic
906517121 1:46446241-46446263 CAGTTTGAGGGAACGGAAGGAGG - Intergenic
906532029 1:46529298-46529320 AAGCTGGAGAGGCGGGGAGGGGG - Intergenic
906580238 1:46930012-46930034 CAGGTGGGAAGAAGGGAAGGTGG + Exonic
906603487 1:47148878-47148900 CAGGTGGGAAGAAGGGAAGGTGG - Exonic
906748152 1:48235891-48235913 CACTTCGGAAGGAGGGAAGGAGG - Intronic
907277876 1:53327074-53327096 CCGCTGGGGAGGAGGAAAGGGGG + Intronic
907581248 1:55574644-55574666 TGCTTGGAGAGGAGGGGAGGAGG - Intergenic
907670561 1:56471339-56471361 AGGATGGAGAGGAGGGAAGAAGG + Intergenic
908213116 1:61921783-61921805 CAGGGGAAGAGGTGGGAAGGAGG + Intronic
908250104 1:62258978-62259000 TGGCTGGAGTGGAGGGAAGGAGG + Intronic
908277852 1:62494657-62494679 CAGTTGGTGGGGGGGGCAGGAGG + Intronic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
910734907 1:90442955-90442977 CAGAAGGAAAGGAGGGAGGGAGG + Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911064850 1:93779028-93779050 CAGTTGAGGAGGATGGGAGGAGG + Intronic
911293849 1:96089299-96089321 GAGGTGGGGAGGATGGAAGGAGG - Intergenic
912334104 1:108846612-108846634 CAGCTGGGGAGGAGCGGAGGCGG - Intronic
912696722 1:111847747-111847769 CAGCTGGAGAGGGAGGATGGCGG + Intronic
913179877 1:116311183-116311205 AAGCTGGAGAGGAGGGAGGCGGG + Intergenic
913240396 1:116825237-116825259 CATTGGGAAAGGAGGAAAGGGGG - Intergenic
913575118 1:120164427-120164449 TACTAGAAGAGGAGGGAAGGAGG - Intronic
914521724 1:148423460-148423482 CAACTGCAGAGCAGGGAAGGAGG - Intergenic
914557423 1:148780068-148780090 TACTAGAAGAGGAGGGAAGGAGG - Intergenic
914615411 1:149350162-149350184 TACTAGAAGAGGAGGGAAGGAGG + Intergenic
914815750 1:151060646-151060668 CAGCTGAAGAGGAGAGAAGGGGG + Intronic
914825981 1:151138245-151138267 CACTGGGAGAGGAGCTAAGGTGG + Intronic
914841893 1:151255196-151255218 AAGTTAGAGACGAGGGAATGGGG - Intronic
915426821 1:155834122-155834144 CAGTTAAAGAGGAAGGAATGGGG - Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915839187 1:159201637-159201659 GATTTGGAGAGGAAGGATGGAGG + Exonic
915871538 1:159564975-159564997 CAGTTGGGGAGGACAGAAGAGGG - Intergenic
915935164 1:160086149-160086171 CAGTGGGAGAGAAGAGAAAGAGG - Intronic
916394634 1:164372247-164372269 CAGTTGGATAGGAATGAATGAGG + Intergenic
916452519 1:164934609-164934631 GAGTTGGAGAGGAAAGGAGGTGG + Intergenic
917070170 1:171141896-171141918 AAGAAGGAGAGGTGGGAAGGAGG - Intronic
917471388 1:175328798-175328820 CGGATGAAGAGGAGGGAGGGAGG + Intronic
917737816 1:177936641-177936663 CAGATGGAGAGGAGTGGTGGAGG - Intronic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918085730 1:181243708-181243730 AAGAGAGAGAGGAGGGAAGGAGG - Intergenic
918107659 1:181427565-181427587 AAGTTGGAGAGGAGTTGAGGTGG - Intronic
918178000 1:182061871-182061893 AAGACTGAGAGGAGGGAAGGAGG - Intergenic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
919140175 1:193560480-193560502 GAGTTGGAGAAGAGAGAAAGAGG - Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919491039 1:198205040-198205062 AAGTAGGAGAAGAAGGAAGGGGG - Intronic
919788680 1:201276179-201276201 CAGTTCGATAGGAGGCTAGGCGG + Intergenic
920210052 1:204321420-204321442 CAGTAGGGGAGGCTGGAAGGTGG - Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920398428 1:205662582-205662604 CAGTTTGACAGAAGGAAAGGCGG - Intronic
920496773 1:206460471-206460493 GAGTTGGGGAGGAGGGGCGGGGG + Intronic
920634485 1:207686188-207686210 GAGAAGGAAAGGAGGGAAGGAGG - Intronic
920729577 1:208470489-208470511 AAGATGGGGAGGAGAGAAGGGGG + Intergenic
920921212 1:210298682-210298704 CAGTTGGAGAGGAGGCATCCTGG - Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921487657 1:215733954-215733976 CTGTTGGAGCTGTGGGAAGGGGG - Intronic
922312512 1:224408654-224408676 GAGTTGGACAGGAGGGCAAGAGG + Intronic
922574917 1:226655065-226655087 GAGGTGGGGAGGAGGGGAGGAGG + Intronic
922646405 1:227291174-227291196 CAGGTGGGGAGGAGGGAGGAAGG - Intronic
923003606 1:230027587-230027609 CCCTTGGAGAGAAGGGAAGGTGG - Intergenic
923051636 1:230394569-230394591 CACAAGGAGAGGAGGGGAGGGGG - Intronic
923051932 1:230395588-230395610 CATGAGGAGAGGAGGGGAGGGGG - Intronic
923367104 1:233273497-233273519 CAGTTGGATAGAAGGAAAGAAGG - Intronic
923419934 1:233802819-233802841 CAGTGGGAGAGGAGGAGAAGGGG + Intergenic
923549733 1:234954032-234954054 GAGTCAGAAAGGAGGGAAGGAGG + Intergenic
923564327 1:235065327-235065349 AAGTAGGAGAGGAGGGAATCAGG + Intergenic
923989280 1:239416874-239416896 TAGTTGGTGAGGATGGAAGTGGG + Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924688927 1:246325294-246325316 GAGTTGGGGGGGCGGGAAGGAGG + Intronic
1062935098 10:1379661-1379683 CAGAAGTAGAGGAGGGGAGGAGG + Intronic
1063085682 10:2815713-2815735 AAGCTGGGGAGGTGGGAAGGAGG + Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063705352 10:8424969-8424991 CAGGAAGAGAGGAGGGGAGGGGG + Intergenic
1064052373 10:12069368-12069390 CAGTTACAGAGGATGGACGGGGG - Intronic
1064114774 10:12568346-12568368 GAGGGGGAGAGGAGGGGAGGGGG - Intronic
1064177678 10:13089584-13089606 AAGTTGGAGAGGAGAGAAGAGGG - Intronic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1064533040 10:16329589-16329611 CGGGTGGGAAGGAGGGAAGGAGG + Intergenic
1064934456 10:20664351-20664373 GAGTGAGAGAGAAGGGAAGGAGG - Intergenic
1065177682 10:23095408-23095430 CAGGTGGGAAGGAGGGAAGGAGG + Intergenic
1065366677 10:24944067-24944089 CAGAGGTAGAGGAGGAAAGGGGG - Intronic
1066007295 10:31157452-31157474 AACTTGGAGAGGAGGCAGGGAGG - Intergenic
1066692200 10:38041258-38041280 CACTTGGAGGGGTGGGGAGGAGG - Intronic
1067068476 10:43116559-43116581 ATGTTGGAAATGAGGGAAGGGGG - Intronic
1067358089 10:45549784-45549806 GGGATGGAGAGAAGGGAAGGAGG - Intronic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1067528119 10:47050470-47050492 GAGAGGGAGAGGAGGGAAAGAGG + Intergenic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067714086 10:48673110-48673132 CAGCTGGCCAGCAGGGAAGGTGG - Intergenic
1067789713 10:49278441-49278463 AAATTGGAGTGGAGGGGAGGTGG + Intergenic
1067991698 10:51220826-51220848 AATTTGGAGAAGAGGGAATGAGG + Intronic
1068120579 10:52779310-52779332 AAGGTGGGGAGGAGGGAAGCAGG - Intergenic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1069453070 10:68532767-68532789 TACTTGGAGGGGAGAGAAGGAGG - Intergenic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1070501653 10:77078322-77078344 CAGCTTTAGGGGAGGGAAGGTGG - Intronic
1070837942 10:79462847-79462869 CAGTTTGGGAGGAGTGAGGGAGG + Intergenic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1072190383 10:93073019-93073041 CAGCTGGACAGCAGGGAAGGGGG - Intergenic
1072383745 10:94902022-94902044 TAGTGGGAGAGGAAGGTAGGAGG + Intergenic
1073551405 10:104405278-104405300 CATTTGAAGAGGAAGGAATGAGG - Intronic
1074103402 10:110371507-110371529 TAGGTGGGGAGGAGGGAAGAGGG + Intergenic
1074193187 10:111155725-111155747 CACTTGGTGAGGAGAGGAGGTGG - Intergenic
1074580837 10:114717909-114717931 CAAAAGGAGAGGAGAGAAGGGGG + Intergenic
1074775563 10:116766076-116766098 GAGGTGGAGAGCAGGAAAGGTGG - Intergenic
1074874268 10:117602176-117602198 TAGATGGAGAAAAGGGAAGGGGG + Intergenic
1074963126 10:118465611-118465633 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1075071831 10:119324986-119325008 TAGTTGGAGAGGAGGGAGTTGGG + Intronic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075324375 10:121519005-121519027 CTGGTGGAGAGAAGGGCAGGAGG + Intronic
1075576916 10:123584353-123584375 CATTTGGGGAAGAAGGAAGGGGG + Intergenic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076527155 10:131119057-131119079 CATTTGGAGAGGAGGTAAGGTGG + Intronic
1076631179 10:131853237-131853259 GAGGTGCAGATGAGGGAAGGGGG - Intergenic
1076949486 10:133670074-133670096 AAGGTGGAGAGGGGGGAGGGGGG - Intronic
1076950470 10:133673373-133673395 AAGGTGGAGAGGGGGGAGGGGGG - Intergenic
1076953433 10:133683292-133683314 AAGGTGGAGAGGGGGGAGGGGGG - Intergenic
1076958368 10:133752872-133752894 AAGGTGGAGAGGGGGGAGGGGGG - Intergenic
1076960341 10:133759481-133759503 AAGGTGGAGAGGGGGGAGGGGGG - Intergenic
1077015927 11:399254-399276 CAGGTGGGGAGGAAGGCAGGGGG - Intronic
1077082349 11:729638-729660 CACTGGGCGAGGAGGGAGGGCGG + Intergenic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077279748 11:1737949-1737971 CGGATGGAGCGGAGGGCAGGAGG + Intronic
1077327542 11:1970264-1970286 CACCTGGAGAGGAGGGACGCGGG + Intronic
1077538241 11:3134605-3134627 CTTTTGGAAAGGAGGGAGGGAGG + Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077914690 11:6603696-6603718 CGGTGGGAGGGGAGGGACGGAGG + Intronic
1078101081 11:8330707-8330729 CGGGTGGGGAGGAGGGACGGAGG - Intergenic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079817188 11:25076541-25076563 AAGGAAGAGAGGAGGGAAGGAGG + Intronic
1080633365 11:34101459-34101481 CAGTTTCAGAGAAGGGATGGGGG + Intergenic
1080716941 11:34812040-34812062 GAGTTGGGGAGGAGTGAAGCCGG - Intergenic
1080765907 11:35296591-35296613 AAGTTGGAGAGGTGGGCAGGAGG - Intronic
1080878654 11:36299221-36299243 CAGCTGGAGTGGAGAGAACGTGG - Intronic
1081541394 11:44037084-44037106 CAGTGGGAGATGGGGAAAGGAGG - Intergenic
1081621159 11:44619910-44619932 CAGTGGGAGAGGGGAGAGGGTGG + Exonic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083136755 11:60685765-60685787 CAGTTTGAGTTGAGGGTAGGGGG - Intergenic
1083254626 11:61488630-61488652 GAGTTGGAGAGGAAGCAGGGTGG - Intronic
1083301784 11:61743506-61743528 CAGAGGGAGAGGAGAGCAGGGGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083855907 11:65393009-65393031 CAGTGAGAGAGGAGATAAGGTGG + Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084349017 11:68580593-68580615 TAGTTGAAGAAGAGTGAAGGTGG + Intronic
1084368211 11:68717528-68717550 CAGATGGAAAGAAGGGAAAGGGG + Intronic
1084476638 11:69393252-69393274 AACATGGAGAGGAAGGAAGGTGG + Intergenic
1084742628 11:71149598-71149620 CAGGTAGAGAGGAGGGTAGTAGG + Intronic
1084751105 11:71204919-71204941 CAGATGGAGATGAGGGAGGCAGG + Intronic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1084892950 11:72245316-72245338 CAGATGGAGCTGAGGGAACGGGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085092980 11:73734550-73734572 GAGTTGGGGAGGAGGAACGGTGG + Intronic
1085344505 11:75759358-75759380 CGGTGGGAGAGGAGTGGAGGCGG + Intergenic
1085753974 11:79188688-79188710 AAGAGAGAGAGGAGGGAAGGGGG + Intronic
1085826940 11:79857956-79857978 CAGCTAGAGGGGAGGAAAGGAGG + Intergenic
1085961921 11:81470852-81470874 GAGTTGGAGGAGAGGAAAGGGGG + Intergenic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1087137383 11:94734654-94734676 CCCTGGGAGAGGAGGGGAGGAGG + Intronic
1087512036 11:99107982-99108004 TATTTGGAGAGGAAGGAATGTGG + Intronic
1088033383 11:105279798-105279820 TATTTGGAGGGGAGAGAAGGTGG + Intergenic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088469190 11:110175987-110176009 CAGTGGGAGAGGCGGGAGTGGGG + Intronic
1088570566 11:111219605-111219627 TAATTGGAGGGGAGGGGAGGGGG - Intergenic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1088840935 11:113627243-113627265 GAGGTGGGGAGGAGGGAGGGAGG + Intergenic
1088884156 11:113994154-113994176 CAGAGGCAAAGGAGGGAAGGTGG - Intergenic
1089313290 11:117574056-117574078 GAGCTGGATGGGAGGGAAGGGGG + Intronic
1089489778 11:118875250-118875272 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1089587393 11:119519252-119519274 GAGAGAGAGAGGAGGGAAGGTGG + Intergenic
1089618295 11:119707527-119707549 CAGTTGGAGTGGGGAGACGGTGG - Intronic
1089663883 11:120004586-120004608 CAGTTGGTGAGAAGTGCAGGTGG - Intergenic
1090589119 11:128246490-128246512 CAGTGGGGGAGGAGGGAGCGGGG - Intergenic
1091268290 11:134287803-134287825 CAGAGGGTGAGGCGGGAAGGAGG + Intronic
1091303531 11:134523141-134523163 CTGCTGGGGAGGTGGGAAGGGGG - Intergenic
1202810524 11_KI270721v1_random:25444-25466 CACCTGGAGAGGAGGGACGCGGG + Intergenic
1091600554 12:1915389-1915411 CAGACTGAGAGGAGAGAAGGAGG + Intronic
1091679437 12:2516268-2516290 CAGCTGGAGAGGAGGGAGTAAGG + Intronic
1091773740 12:3170720-3170742 GAGTTGGGGAGGATGGCAGGAGG + Intronic
1091982356 12:4876429-4876451 TACTGGGAGAGGAGGGAACGGGG + Intergenic
1092163241 12:6327659-6327681 GGGTTGGGGAGGAGGGAAGCTGG - Exonic
1092166970 12:6348317-6348339 AGCTTGGTGAGGAGGGAAGGGGG - Intronic
1092174542 12:6394194-6394216 CTGTTGGGGAGGAGAGAAGCCGG - Intergenic
1092223011 12:6728142-6728164 AAGTGGGAGGGAAGGGAAGGAGG + Intronic
1093053501 12:14532088-14532110 CCGTGGGTGAGGAGTGAAGGTGG - Intronic
1093742704 12:22706497-22706519 TATTTGGAGAGGAGGGAGGTAGG - Intergenic
1093945229 12:25100201-25100223 AAGTTGGAAAGGAAGGAAGGAGG + Intronic
1094318029 12:29153493-29153515 CAGTTGGAGAGGGGAGCAGGTGG + Intronic
1094412590 12:30182844-30182866 CAGTTGGAGAGGAGTTCAGCTGG + Intergenic
1095166065 12:38973602-38973624 CAGTTGGGGAGTAGGGGAGCGGG - Intergenic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095756295 12:45770559-45770581 CAGTTGAAGAGTGAGGAAGGCGG + Intronic
1095852949 12:46830943-46830965 CATTTGCAGAGGAGTGCAGGAGG - Intronic
1095962103 12:47842106-47842128 CAGAGGGAGAGCTGGGAAGGTGG + Intronic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096677401 12:53232944-53232966 AGGCTGGAGAGGAGGGCAGGAGG + Intronic
1096943188 12:55372461-55372483 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1097014304 12:55974334-55974356 AAGTTGGTGAGTCGGGAAGGCGG + Intronic
1097151753 12:56984428-56984450 CAGGAGGGGAGGAGGGAAAGAGG + Intergenic
1097258471 12:57698636-57698658 CAGATGGAGAGGATGGTGGGGGG + Intronic
1097767996 12:63547593-63547615 CAGGTAGAGAGAAGGAAAGGAGG + Intergenic
1097784356 12:63742659-63742681 CAGGTAGAGAGAAGGAAAGGAGG + Intergenic
1097980022 12:65729080-65729102 CAGGTGGCGCGGAGCGAAGGGGG - Intergenic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1099890488 12:88583549-88583571 CAGGTGGACAGGAGGGATGGGGG + Intergenic
1100216888 12:92459980-92460002 TAGTTGGAGAAAGGGGAAGGAGG - Intergenic
1100577091 12:95902366-95902388 GAGGTGGGGAGGAGGGAAGAAGG - Intronic
1100817692 12:98401631-98401653 CAGCTGGAGAGGAGCCAAGCAGG + Intergenic
1100849294 12:98692536-98692558 GAGTTGGGGAGGGGGGAATGAGG - Intronic
1101536613 12:105623677-105623699 CAGTTCAAGGGGAGGAAAGGTGG + Intergenic
1101545285 12:105706655-105706677 CAGATGGGGAGGAGGGATGAGGG - Intergenic
1101843234 12:108342390-108342412 GAGTGGGAGAGAAGAGAAGGAGG + Intergenic
1101902227 12:108799216-108799238 CAGTTGGGGAGGAGAGATGGGGG + Intronic
1101980886 12:109406047-109406069 CTTTTGGAGAGGACAGAAGGAGG + Intronic
1102680287 12:114686305-114686327 CAGGTGGGGAGGAGGGGATGCGG - Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102795253 12:115683665-115683687 ACGTTTGAGAGAAGGGAAGGGGG + Intergenic
1102900057 12:116629412-116629434 CAGAAGGAGAGGAGAGAAGGCGG + Intergenic
1102970458 12:117162071-117162093 CTCTTGGGGAGGAGGAAAGGTGG + Intronic
1103229087 12:119312949-119312971 GAGAGAGAGAGGAGGGAAGGAGG + Intergenic
1103522984 12:121548800-121548822 GAGGTGGGGAGGTGGGAAGGAGG - Intronic
1103837552 12:123835234-123835256 CATTTGGAGTGGAGGGGAGCTGG + Intronic
1103856518 12:123973716-123973738 TTGTTGGAGCCGAGGGAAGGGGG + Exonic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104127336 12:125861035-125861057 CAGGTGCAGAGGAGCGGAGGGGG + Intergenic
1104438076 12:128771724-128771746 CAGTTAGATAGGAGGATAGGAGG + Intergenic
1104473950 12:129054999-129055021 CAGCTGGAGGGGAGGCAGGGAGG - Intergenic
1104906227 12:132214810-132214832 CACTTGGAGACCAGGGCAGGCGG + Intronic
1105776308 13:23664449-23664471 AATTTGCAGAGGAGGTAAGGTGG - Intronic
1106338390 13:28805557-28805579 CAGTTGTAGAACATGGAAGGAGG - Intergenic
1106859756 13:33893066-33893088 CAGGCCGAGAGAAGGGAAGGAGG + Intronic
1106890042 13:34235571-34235593 CAGTTGGAGAGCAGCAAAGATGG + Intergenic
1107353469 13:39541177-39541199 CAGCTGGAGTGGAGAGATGGAGG - Intronic
1107807165 13:44164265-44164287 GGTTTGGGGAGGAGGGAAGGAGG - Intergenic
1108713650 13:53058003-53058025 CAGGTGGAGATGAGGGACTGTGG - Intergenic
1109768025 13:66930644-66930666 CCTTTGGAGGGGAGGGAAGAAGG + Intronic
1109877964 13:68430250-68430272 CAGTTAGAAAGGACAGAAGGAGG + Intergenic
1110563093 13:76930175-76930197 CAGCTGGAGAGTAAGGGAGGGGG - Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1110920306 13:81076009-81076031 CAGTGGAAGAGTAGGGAAAGGGG + Intergenic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1112158159 13:96840005-96840027 AAGAAGGAAAGGAGGGAAGGGGG + Intergenic
1112159050 13:96849388-96849410 CGGTTGGCTAGGAGGGAAGGAGG + Intergenic
1112431432 13:99354109-99354131 CAGGTGCAGAGCAGTGAAGGGGG - Intronic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1113677232 13:112215257-112215279 GGGCTGGAGAGGAGGGAAGTGGG + Intergenic
1113929044 13:113956843-113956865 CAGGGCGAGAGGAGGGCAGGTGG + Intergenic
1114415568 14:22540989-22541011 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1114444912 14:22781074-22781096 CAGTTGCTGAGCTGGGAAGGAGG - Intronic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1114711756 14:24785769-24785791 CAGCTGCAGAGGTGGGAGGGAGG + Intergenic
1115030008 14:28784050-28784072 CAGTTGGAGAATAGGGAAAAGGG + Intronic
1115054675 14:29108838-29108860 AAGTAGGAAAGGAGGGAGGGAGG + Intergenic
1115243562 14:31272680-31272702 CAGGTGGCAAAGAGGGAAGGAGG - Intergenic
1115450613 14:33543133-33543155 CAGAAAGAGATGAGGGAAGGAGG - Intronic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1115933658 14:38527255-38527277 GGGTGGGAGAGGTGGGAAGGAGG + Intergenic
1118905275 14:70018965-70018987 CAGTTTTAGAGAAGGTAAGGCGG - Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119406879 14:74404595-74404617 CAGTTGGGGAGTAGGGAAGGAGG + Intergenic
1119862811 14:77948798-77948820 CAGGTAGTGGGGAGGGAAGGAGG - Intergenic
1119883031 14:78116567-78116589 CAGTTGGAAAGTAGGGAGGTTGG + Intergenic
1120189762 14:81429967-81429989 AAGTGGGAGAGAAGGGAAGTCGG - Intronic
1120727535 14:87961893-87961915 CATTTGGAGAGGAAGGGATGAGG - Intronic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121255131 14:92525431-92525453 GAGATTGAGGGGAGGGAAGGAGG + Intronic
1121529084 14:94640119-94640141 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
1121561973 14:94882655-94882677 CAGTTGCAGAGGCTGGAAGTCGG - Intergenic
1121577643 14:95001458-95001480 CAGATGGAGAGGCAGGAATGTGG + Intergenic
1121992563 14:98573869-98573891 CAATTGTAGAGGAGGAAAAGAGG - Intergenic
1122570468 14:102695500-102695522 AAGAAGGAAAGGAGGGAAGGAGG + Intronic
1122805645 14:104255240-104255262 AAATTGGACAGGAGGGAAGGGGG - Intergenic
1202872408 14_GL000225v1_random:177138-177160 CTCTTGGAGAGGGGAGAAGGGGG - Intergenic
1123456787 15:20433547-20433569 CAGGAGGAGAGGAGTGAACGTGG - Intergenic
1123467958 15:20530102-20530124 CAGGTGGAGAGAACAGAAGGTGG + Intergenic
1123650155 15:22470940-22470962 CAGGTGGAGAGAACAGAAGGTGG - Intergenic
1123661275 15:22566809-22566831 CAGGAGGAGAGGAGTGAACGTGG + Intergenic
1123728272 15:23125311-23125333 CAGGTGGAGAGAATAGAAGGTGG + Intergenic
1123740561 15:23279782-23279804 CAGGTGGAGAGAACAGAAGGTGG - Intergenic
1123746437 15:23322776-23322798 CAGGTGGAGAGAACAGAAGGTGG + Intergenic
1123908672 15:24945304-24945326 AAGGGGGAGAGGAGGAAAGGAGG - Intronic
1124262937 15:28208701-28208723 CAGGAGGAGAGGAGTGAAAGTGG - Intronic
1124278704 15:28346093-28346115 CAGGTGGAGAGAACAGAAGGTGG + Intergenic
1124315075 15:28661045-28661067 CAGGAGGAGAGGAGTGAACGTGG + Intergenic
1124532876 15:30521990-30522012 CAGGTGGAGAGAATAGAAGGTGG - Intergenic
1124715592 15:32058180-32058202 CAGAGGGAAAGGAGGCAAGGAGG - Intronic
1124720256 15:32105467-32105489 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1124720261 15:32105486-32105508 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1124765780 15:32485654-32485676 CAGGTGGAGAGAACAGAAGGTGG + Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125431069 15:39593898-39593920 CAGACAGAGAGGAGGGAAGGAGG - Intronic
1126393950 15:48191886-48191908 CAGTTAATGCGGAGGGAAGGGGG - Intronic
1126673690 15:51138782-51138804 GAGTTGGAGAGAAGGGGACGTGG - Intergenic
1127065556 15:55234153-55234175 CAGTTGCAGATGAGGAAAGATGG - Intronic
1127464116 15:59227132-59227154 TAGTAGGAGAGGTGTGAAGGAGG - Intronic
1127534583 15:59878273-59878295 TAGTTGGTGAGGAGCAAAGGGGG - Intergenic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128693638 15:69744317-69744339 GAGTGGGAGAGCAGGAAAGGAGG + Intergenic
1129199914 15:73992481-73992503 GAGTAGGAGAAGAGGGGAGGAGG - Intronic
1129450243 15:75647566-75647588 CGGAGGGAGAGGAGGGGAGGTGG + Intronic
1129457429 15:75683258-75683280 CAGATGGAGAGCAGGGAGGCTGG - Intronic
1129641368 15:77382107-77382129 TAGATAGAGAGGAGGGAGGGAGG - Intronic
1129667635 15:77588374-77588396 CAGCTGGAGAGGAGTCAACGGGG - Intergenic
1129726362 15:77903687-77903709 CAGATGGAGAGCAGGGAGGCTGG + Intergenic
1129787695 15:78320429-78320451 CAGATGGAGTGGAAGGAATGGGG - Intergenic
1129797522 15:78389405-78389427 CAGTTTGAGAGGAGGGAGCTGGG - Intergenic
1129960015 15:79675695-79675717 AAGTTGGGCAGGAGAGAAGGGGG - Intergenic
1130226093 15:82059152-82059174 GAGAAGGAGAGGAGGGGAGGGGG - Intergenic
1130390104 15:83447584-83447606 GAGGCGCAGAGGAGGGAAGGAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130546310 15:84859369-84859391 CAGTGGGCGAGGTGGGCAGGAGG + Exonic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130567672 15:85011059-85011081 CAGTTTGGAAGGAGGGAATGGGG - Intronic
1130847155 15:87758169-87758191 GAGAAGGAAAGGAGGGAAGGAGG + Intergenic
1130894916 15:88162463-88162485 CAGAAGGAGAGGGGAGAAGGGGG + Intronic
1130959477 15:88650237-88650259 CCGTTGGAGAGGATGGGAAGGGG - Intronic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131403803 15:92147179-92147201 CAGGTGGAAAGGAGGAGAGGCGG - Intronic
1132091369 15:98950275-98950297 CAGGTGGACAGGAGGGAATGAGG + Intronic
1132202138 15:99962310-99962332 GGGTAGGAGAGGAGGGAACGGGG + Intergenic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132525979 16:414946-414968 CTGGTGGAGGGAAGGGAAGGAGG - Intergenic
1132828313 16:1915804-1915826 ACGGTGGAGAGGAGGGAAGGAGG + Intronic
1133336793 16:5011532-5011554 CAGTTGGAGGGGAGGAGAAGGGG + Intronic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1133520214 16:6549344-6549366 GAGGAGGGGAGGAGGGAAGGAGG + Intronic
1133903425 16:9998767-9998789 GAGTTGGAGAGGAAGGCAAGGGG - Intronic
1134067990 16:11241629-11241651 GAGAGGGAGAGGAGAGAAGGTGG - Intergenic
1134082191 16:11332665-11332687 CTTTGGGAGAGTAGGGAAGGAGG + Intronic
1134449580 16:14354652-14354674 AGGATGGGGAGGAGGGAAGGAGG + Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134829096 16:17309081-17309103 AAGTAGGAGAGGTGGAAAGGCGG + Intronic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135041770 16:19122875-19122897 CAGGTGGAGAGGAGGGGAGGAGG + Intronic
1135293580 16:21260764-21260786 AAGTGGGAGAGTAGGGAAGGAGG + Intronic
1135435520 16:22424569-22424591 GCGGTGGGGAGGAGGGAAGGGGG - Intronic
1135692496 16:24553296-24553318 CAGTTGGAGGGGAGGAAGAGGGG - Intronic
1135762148 16:25146171-25146193 CAATTGGAGAGGAGGCAAATAGG + Intronic
1136035211 16:27534027-27534049 CACTTGGTGAGGAAGGATGGGGG + Intronic
1136142224 16:28294782-28294804 CAGCTGGAGACGAGGGTAGGGGG + Intronic
1137793591 16:51196159-51196181 CAGATGGAGAGGAAGGATTGTGG + Intergenic
1137819914 16:51434450-51434472 GAGTTGGATTGGAGGAAAGGGGG + Intergenic
1138276300 16:55737334-55737356 CAGCTGGAGAGGATGGAGTGTGG + Intergenic
1138585347 16:57966237-57966259 TAGGTGGAGAGGAGGGAACGTGG - Intronic
1138628926 16:58277914-58277936 GGCTGGGAGAGGAGGGAAGGAGG + Intronic
1138699503 16:58847048-58847070 CAGAGGGAGAGGAGGGAGAGGGG + Intergenic
1138708421 16:58941399-58941421 CGATTGGAGAGGAGGAAAGTGGG - Intergenic
1138930720 16:61652866-61652888 AAGATGAAGAGGAGGGAACGAGG + Exonic
1138969591 16:62128764-62128786 GAGGTGGAGAGGAGAGAAGAAGG - Intergenic
1139011037 16:62634314-62634336 TACTTGAAGAGGAGGGAATGAGG - Intergenic
1139181301 16:64751680-64751702 CAGTCTGAGAGGATGGAATGGGG + Intergenic
1139272792 16:65699350-65699372 GAGTTGGAGAGGCGGGTAGGAGG + Intergenic
1139672119 16:68499087-68499109 CAGTAGGGGAAGAGGGAGGGAGG - Intergenic
1140202659 16:72906859-72906881 GAGTTGGGGAGGAGCAAAGGAGG + Intronic
1140625598 16:76790262-76790284 GCATTGGAGAAGAGGGAAGGCGG - Intergenic
1141756777 16:85996730-85996752 CAGTAAGAGAGGAAGGAAGGAGG + Intergenic
1141819290 16:86434022-86434044 CAGGTGGAGAGGATGGAGGATGG - Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141895894 16:86958671-86958693 GAGTTGGTGAGGAGGGGAGGTGG - Intergenic
1142030651 16:87836809-87836831 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1142030666 16:87836850-87836872 GAGGCGGGGAGGAGGGAAGGAGG + Intronic
1142030673 16:87836870-87836892 AGGGAGGAGAGGAGGGAAGGAGG + Intronic
1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG + Intronic
1142280702 16:89146209-89146231 CAGGTAGAGACGAGGGCAGGGGG + Intronic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1142612436 17:1116666-1116688 CAGTTGGGAAGGAGGTAAGTCGG - Intronic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1143020938 17:3916939-3916961 CAGTGGGAGAGGAGAGCTGGGGG - Intergenic
1143136989 17:4717595-4717617 CTGCCCGAGAGGAGGGAAGGGGG + Intronic
1143364930 17:6400891-6400913 AAGTTGGGGAAGAGAGAAGGTGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144100887 17:11941328-11941350 CAGAGGGAGAGAGGGGAAGGAGG - Intronic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144504843 17:15821266-15821288 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1144636143 17:16910493-16910515 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1144643832 17:16954979-16955001 CAGTTGCAGGGTAGGGAGGGAGG - Intronic
1144645928 17:16973334-16973356 GAGGTGGAGAGGAAGGAGGGAGG + Intergenic
1144971150 17:19110788-19110810 CAGTAGGAGAGACTGGAAGGGGG - Intergenic
1144991452 17:19236951-19236973 CAGTAGGAGAGACTGGAAGGGGG - Intronic
1145059139 17:19721258-19721280 CAGTTGAGGAGGAGTGGAGGAGG - Intergenic
1145169016 17:20639149-20639171 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1145194909 17:20883848-20883870 CAGTTGGATATGATGGAGGGTGG - Intronic
1145203579 17:20968588-20968610 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1145931583 17:28689829-28689851 CTGTTAGAAAGGAGGAAAGGGGG - Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146594479 17:34157102-34157124 GAGGAGGAGAGGAGGGACGGAGG - Intronic
1146624280 17:34424101-34424123 GAGAGGGAGAGGAGGGGAGGAGG + Intergenic
1146688341 17:34856659-34856681 GGGTTGGAGAGGATGGAGGGTGG + Intergenic
1146711222 17:35043140-35043162 CAGTTGGAGAGAAAGGTGGGGGG + Intronic
1147357958 17:39912294-39912316 GAGTTGGGCAGCAGGGAAGGAGG - Intronic
1147375381 17:40019755-40019777 CAGCAGGAGAGCCGGGAAGGTGG + Intronic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1148079122 17:44957819-44957841 CAGCTGGAGAGACAGGAAGGAGG - Intergenic
1148338703 17:46860234-46860256 AAGGAGGAGAGGAGGGAAGCGGG + Intronic
1148391323 17:47275246-47275268 CACTTGGTGAGGATGGAAGGGGG + Intronic
1148391499 17:47276150-47276172 GGGTTGGAAAGGAGGGAAGGAGG - Intronic
1148758703 17:49988084-49988106 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1148789589 17:50165973-50165995 AGGGAGGAGAGGAGGGAAGGAGG - Intronic
1149493942 17:57105309-57105331 CTCTTGGAGGGCAGGGAAGGCGG + Intronic
1149821604 17:59784425-59784447 CAATTTGAGAGGAGTGAAGGGGG - Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150474913 17:65467497-65467519 CAGTTAGTGAGGAAGCAAGGGGG - Intergenic
1151245922 17:72794575-72794597 CAGTTTGAGTGTAGAGAAGGAGG - Intronic
1151252677 17:72849505-72849527 TTTTTGGAGAGGAGTGAAGGTGG - Intronic
1151694026 17:75705038-75705060 CAATTGGCGGGGAGGAAAGGGGG - Intronic
1151827084 17:76529664-76529686 CAGGGGAAGAGGAGGGGAGGGGG - Intronic
1151969232 17:77449409-77449431 CAGAGGCAGAGGAGGGGAGGAGG + Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152260634 17:79264953-79264975 CAGTGCGAGAGGAGGGGGGGGGG + Intronic
1152403479 17:80083210-80083232 CAGTTGGGGAGGGGGGAGGCAGG + Intronic
1152710860 17:81870064-81870086 GGGGTGGAGAGGAGCGAAGGTGG - Intronic
1152793813 17:82296909-82296931 GGGGTGGAGAGGAGGGAGGGAGG - Intergenic
1153387239 18:4511323-4511345 CAGTGGGAGAACTGGGAAGGAGG - Intergenic
1153588326 18:6646734-6646756 AAGATGCAGAGGTGGGAAGGTGG - Intergenic
1153827697 18:8891603-8891625 CAGTTGGTCAGGAGTGAAGGTGG + Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1153836620 18:8969751-8969773 AAGGTGGAAGGGAGGGAAGGGGG - Intergenic
1153841339 18:9010873-9010895 CATTTGGTGGGGAGGGAGGGAGG + Intergenic
1154067977 18:11127051-11127073 TAGTTGGAGGAGAGAGAAGGAGG + Intronic
1154197814 18:12279227-12279249 CAGCAGGAGAGGAGGTGAGGAGG + Intergenic
1154216982 18:12422683-12422705 AAGTGAGAGAGGAGTGAAGGGGG - Intronic
1155159951 18:23187362-23187384 CAGTTGGAGAAGAGACAAGGAGG + Intronic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155901218 18:31393493-31393515 CAGTAGCAGAAGAGAGAAGGGGG + Intronic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156105242 18:33651450-33651472 AAGTTGGAAAGGAGGGAGAGAGG + Intronic
1156218019 18:35021303-35021325 CAGTTGAAGAGCTGGGAAGATGG - Intronic
1156292035 18:35755771-35755793 CAGGTGGAGAGGAGGCAAAAGGG - Intergenic
1156526881 18:37776159-37776181 CAGGCAGAGAGGTGGGAAGGAGG + Intergenic
1157249858 18:46085387-46085409 CACTTTGAGAGGTGGGAAGATGG + Intronic
1157307718 18:46529130-46529152 GGCCTGGAGAGGAGGGAAGGAGG + Intronic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157442222 18:47719760-47719782 GAGTTGGAGAGGTGGTAGGGAGG - Intergenic
1157490535 18:48120703-48120725 CACTGGGGGAGGAGGGAAAGTGG + Intronic
1157516201 18:48313458-48313480 CTGTTGGGGAGCAGGGGAGGGGG - Intronic
1157618760 18:49003309-49003331 AGGATGGAGAGAAGGGAAGGAGG - Intergenic
1158282112 18:55839638-55839660 CAGTTGGTGGGGAGTGAAGGAGG - Intergenic
1158602122 18:58864110-58864132 CAGTGGGAGAGGGGGCACGGAGG - Intronic
1158669260 18:59460231-59460253 CAGGAGGAGAGAAGGGAGGGTGG - Intronic
1159685812 18:71418501-71418523 CAGGTGGAGAGGAGGCAGAGTGG + Intergenic
1159962800 18:74568529-74568551 CAGTTGGAGACCTGGGAGGGAGG + Intronic
1160237692 18:77099010-77099032 AAGATGAGGAGGAGGGAAGGAGG - Intronic
1160318199 18:77867313-77867335 CAGGTGGAGAGGAAGGTGGGTGG - Intergenic
1160393947 18:78558574-78558596 CACTTGGGGAGGAGGGAGGGCGG - Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160499287 18:79394386-79394408 GATTTGGAGGGGAGGGGAGGGGG + Intergenic
1160770500 19:828760-828782 GAGGTGCAGAGAAGGGAAGGGGG + Intronic
1160770553 19:828958-828980 GAGGTGCAGAGAAGGGAAGGGGG + Intronic
1160770612 19:829123-829145 GAGGTGCAGAGAAGGGAAGGGGG + Intronic
1160770635 19:829189-829211 GAGGTGCAGAGAAGGGAAGGGGG + Intronic
1160790141 19:919304-919326 GACTGGGAGAGGAGGGCAGGAGG - Intronic
1160929146 19:1561491-1561513 CTGGTGGGGAGGAGGGAAGCTGG + Intronic
1161154325 19:2724256-2724278 CCTTTGGAGAGGAGGGCAGTGGG + Intronic
1161222859 19:3126037-3126059 TGGTTGGAGCGGAGGGAGGGGGG + Intergenic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161595637 19:5149786-5149808 CAGCTGGGGAGGCTGGAAGGGGG + Intronic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1162178526 19:8849705-8849727 CAGATGTAGAGGAGGAAGGGAGG - Intronic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162536446 19:11265291-11265313 CAGCTGGAGTGGAGTGAATGAGG - Intergenic
1162725209 19:12686157-12686179 TAGCTGGAGAGGAGAGAGGGAGG - Intergenic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163465819 19:17468039-17468061 AAGGAGGAGAGGAGGGGAGGAGG + Intergenic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1164323926 19:24176127-24176149 GTGGTGGAGAGGGGGGAAGGGGG - Intergenic
1164405480 19:27941678-27941700 CAGTTTTACAGTAGGGAAGGAGG + Intergenic
1164521296 19:28982197-28982219 CAGGTGAGGAGGAGGGAAGGAGG + Intergenic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164654356 19:29910051-29910073 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1164654381 19:29910131-29910153 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1164654427 19:29910271-29910293 GAGAGGGAGAGGAGGGAGGGAGG - Intergenic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1164882794 19:31749135-31749157 CAATTAGAGAGGAGGAGAGGTGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165150921 19:33759630-33759652 CAGTTGGAGGAGAGGGAATTAGG - Intronic
1166088746 19:40494303-40494325 AAGGAGGAAAGGAGGGAAGGAGG - Intronic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166367845 19:42286272-42286294 GAGTTGGAGGGGAGGGGACGTGG + Intronic
1166422940 19:42652673-42652695 GAGTTGATGAGGATGGAAGGAGG - Intronic
1166517137 19:43455641-43455663 CAGTTGCAGGGGAGGGAAATTGG - Intergenic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1166832068 19:45645030-45645052 TAGACGGAGAGGAGAGAAGGGGG - Intronic
1167130542 19:47582326-47582348 GAGAGGAAGAGGAGGGAAGGAGG - Intergenic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1167571351 19:50290867-50290889 CAGCTGGAGAGGAGGTCAGGAGG - Exonic
1167598207 19:50438331-50438353 CAGATAGACAGGTGGGAAGGTGG + Intronic
1167792151 19:51689411-51689433 GAGTCGGGGAGAAGGGAAGGAGG + Intergenic
1167792655 19:51690991-51691013 AGGTTGGGAAGGAGGGAAGGGGG + Intergenic
1167799203 19:51729479-51729501 AAAATGGAGAGGAAGGAAGGAGG + Intergenic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168282294 19:55312106-55312128 CAGTTGGGGGGCACGGAAGGGGG - Exonic
1168464973 19:56594951-56594973 AAGTAGGAGAGGTGGGAAGAAGG - Intergenic
1202683867 1_KI270712v1_random:31364-31386 CAGTGGCAGAGGGGGGGAGGGGG - Intergenic
925225741 2:2182883-2182905 GAGTTGCAGGGGAGAGAAGGAGG + Intronic
925235569 2:2274345-2274367 GGGTAGGAGAGAAGGGAAGGAGG + Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925472836 2:4181492-4181514 GAGTTTGAGAGGAGAGAAAGTGG - Intergenic
925501759 2:4512747-4512769 CAGCTGGAATGGAGTGAAGGAGG - Intergenic
926244645 2:11113721-11113743 AAGGTGGGGAGGAAGGAAGGAGG - Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
926841734 2:17088690-17088712 CAGCTGGAGAGGTGGGCAAGGGG + Intergenic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927435215 2:23060737-23060759 CAGCTGGAGAGGTGGGTTGGAGG - Intergenic
928202032 2:29253614-29253636 GGGTTGGGGAGGAGGGATGGGGG + Intronic
928217121 2:29371070-29371092 ATGTTGGAGCTGAGGGAAGGAGG + Intronic
928334465 2:30384580-30384602 AAGATGAAGAGGAGGGTAGGAGG + Intergenic
929027004 2:37614569-37614591 CCTCTGGAGAGGAGGGAATGAGG - Intergenic
929423441 2:41818938-41818960 GAGGAGGAGAGGAGGGGAGGAGG + Intergenic
929778188 2:44941531-44941553 GAGGGGGAGAGCAGGGAAGGAGG - Intergenic
929846731 2:45537978-45538000 CCATTGGAGAGCAGGCAAGGAGG + Intronic
930110632 2:47675803-47675825 CAGATGGGGAAGAAGGAAGGAGG + Intergenic
930114640 2:47708064-47708086 AAGCTGGAGAGGTGGGCAGGAGG + Intronic
930312243 2:49755928-49755950 AGGGTGGAAAGGAGGGAAGGGGG + Intergenic
930365435 2:50433731-50433753 AAGGTGGAAGGGAGGGAAGGAGG + Intronic
930752211 2:54945085-54945107 GAGTGGGAGAGGAGGGAGAGAGG - Intronic
931050536 2:58408979-58409001 CACTTGGAAAGGTGGGAGGGTGG - Intergenic
931098878 2:58973195-58973217 AAGGTGGGGAGGAAGGAAGGGGG + Intergenic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
932347320 2:71004204-71004226 CAGGTGGAGAGGTGGGCAAGTGG - Intergenic
932365989 2:71153946-71153968 CAGTTGGACCGAAAGGAAGGGGG - Intergenic
932413228 2:71559388-71559410 GGGTGGGAGAGGAAGGAAGGAGG - Intronic
932460183 2:71876954-71876976 AAGTTGGAGGGGAGGGAGGGAGG + Intergenic
932591588 2:73070998-73071020 GAGATGGAGAGCAGGGACGGGGG + Intronic
932749010 2:74359181-74359203 GAGGTAGAGTGGAGGGAAGGAGG + Intronic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
933709624 2:85315783-85315805 CAGCTGGAGGGGAAGGTAGGGGG + Intergenic
933713440 2:85343991-85344013 CAGCTGGAGGGGAAGGTAGGGGG - Exonic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
935550397 2:104446983-104447005 CAGCTGTAAAGGAGGGGAGGGGG + Intergenic
935841254 2:107113569-107113591 CTGATGGAGAGGAGTGAATGAGG + Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936358565 2:111774141-111774163 CTATTGCAGAGAAGGGAAGGAGG + Intronic
936451363 2:112636152-112636174 CAGGTGCAGGGGAAGGAAGGTGG + Intergenic
936965355 2:118122636-118122658 AAGTTGGAGATGAGGAAAAGGGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937430682 2:121835716-121835738 CAGAAGGGGAGGAGGGGAGGAGG - Intergenic
938569228 2:132546886-132546908 CAAATGAAGGGGAGGGAAGGAGG + Intronic
938701225 2:133881845-133881867 CAGTTAGAGAGGTAGGAAGAGGG + Intergenic
938771583 2:134505481-134505503 AAGCTGGGGAGGAAGGAAGGGGG + Intronic
938791625 2:134681341-134681363 GAGCTGGAGAAGAGGGTAGGAGG - Intronic
939144015 2:138390731-138390753 CAGATGGCGTGGAGGGAGGGCGG - Intergenic
939487998 2:142841354-142841376 CAGTTGGAGAGGAAGCCAGAAGG - Intergenic
939645719 2:144696443-144696465 CAGTTGGAGAAGAAGAAAGCAGG + Intergenic
940668587 2:156639686-156639708 TAATTGGGGAGGAGGGAAGTGGG - Intergenic
941231373 2:162915923-162915945 GAGTTGGAGGAGAGGAAAGGGGG - Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941949877 2:171143763-171143785 CAGCAGTAGAGGAGGGAAAGAGG + Intronic
942241264 2:173965214-173965236 CACATGGTGAGGAGCGAAGGCGG + Exonic
942523191 2:176825977-176825999 CAGTTTTAGATGTGGGAAGGTGG + Intergenic
942591534 2:177552330-177552352 CAGCTGCCGAGTAGGGAAGGGGG - Exonic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
943727013 2:191262287-191262309 CAGCTGGGGAGGAGGGGGGGCGG - Intronic
944963103 2:204899216-204899238 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
945752360 2:213804010-213804032 GAGTTGGAGAGGCTGGAAAGAGG - Intronic
946100422 2:217315754-217315776 CAGTTGGAGAGGAGTTCAGCTGG + Intronic
946199875 2:218065249-218065271 GAGTAGGAGAGGAGGGGTGGGGG + Intronic
946227019 2:218269624-218269646 CATGTGGCGAGAAGGGAAGGTGG + Intronic
946413115 2:219525634-219525656 CAGGTGCAGAGGAAGGAAGATGG - Intronic
946677093 2:222171707-222171729 CAGCTGAGGAGGAGAGAAGGAGG - Intergenic
946679893 2:222202382-222202404 CAGTTGCAGAAGAAGGAAAGGGG + Intronic
946966506 2:225042551-225042573 AAGCTTCAGAGGAGGGAAGGGGG - Intergenic
947809015 2:232988184-232988206 CACTGGGGGAGGAGGGGAGGTGG + Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947926900 2:233929371-233929393 CAGAAGGTGAGAAGGGAAGGGGG + Intronic
948133975 2:235621850-235621872 CAGTTGGGTAGGAGTGGAGGAGG + Intronic
948266361 2:236637939-236637961 GATCTGGGGAGGAGGGAAGGAGG - Intergenic
948725131 2:239929830-239929852 CAGTGGGAGAGCAGGGCCGGCGG - Intronic
948766898 2:240227041-240227063 CAGTTGGAAAGGAGTGAGGTAGG + Intergenic
1168807715 20:682480-682502 CAGCTGGAGAGGAGGCAGTGTGG - Intergenic
1168892909 20:1306241-1306263 TCGATGGAGAGCAGGGAAGGGGG + Exonic
1168960063 20:1862895-1862917 TTGGTGGAGAGGAGGGAAGGAGG - Intergenic
1169073552 20:2748674-2748696 CTGATGGAGGGGAGGGGAGGGGG + Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1170268736 20:14499716-14499738 AAGACGGGGAGGAGGGAAGGAGG - Intronic
1170278492 20:14619505-14619527 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1170354490 20:15477553-15477575 CAGTTGGACAGGGAGAAAGGAGG + Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170438069 20:16350542-16350564 AAGGTGGGGAGGAGGGAAGATGG + Intronic
1170939381 20:20835713-20835735 CACATGGCGAGGAGGGAAGAGGG + Intergenic
1171178440 20:23073381-23073403 CAGTAGGAGAGGAAGGGAAGTGG - Intergenic
1171249733 20:23638325-23638347 CAGTAGGAGAGGAGGGGGAGGGG - Intronic
1171302901 20:24079184-24079206 CAGCGGGAGAAGAGGCAAGGAGG + Intergenic
1171354592 20:24534302-24534324 CAGATGGAGGGGAGGGGTGGAGG - Intronic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173234091 20:41228000-41228022 CAGAAGGAGAGGAAGGAATGGGG - Intronic
1173252295 20:41370358-41370380 CAGAAGCAGAGGAGGAAAGGAGG + Intergenic
1173465960 20:43281630-43281652 CAGTAGGAGAGAGGGGAAGTGGG - Intergenic
1173695804 20:45010958-45010980 CAGTTGGAGAGAAGGGATTAAGG + Intronic
1173849210 20:46207320-46207342 GAATTGGAGAGGAGGGGAGCTGG + Intronic
1173929221 20:46804505-46804527 CAGATGGAGAGGAATGAAAGGGG + Intergenic
1174123498 20:48285631-48285653 CAGTGGGAGAGGAAGCAAGGCGG + Intergenic
1174198010 20:48786895-48786917 GAGGTGGAGGGGAGGGAAAGAGG + Intronic
1174275512 20:49400994-49401016 CAGGTGGATAGGTGGGTAGGTGG - Intronic
1174852309 20:54007048-54007070 AAGTTGGCGTGGAGGCAAGGAGG + Intronic
1174882425 20:54294825-54294847 GACTTGGAGAAGAGGGAAGTGGG - Intergenic
1175413344 20:58785691-58785713 AAGAAAGAGAGGAGGGAAGGGGG + Intergenic
1175540940 20:59747213-59747235 CAGATGGACAGGAAGGGAGGAGG - Intronic
1175786095 20:61712570-61712592 AAGCTGGAGAGAAGGGGAGGAGG - Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176942869 21:14944800-14944822 CAGTTTCAGAGGAGTGATGGAGG - Intergenic
1177304083 21:19289913-19289935 CACTTGGAAGGGTGGGAAGGTGG + Intergenic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1178030142 21:28516673-28516695 GAGTTGGAGGGGAGGGTAAGAGG + Intergenic
1178170534 21:30035080-30035102 GAGGAGAAGAGGAGGGAAGGAGG - Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178317180 21:31576412-31576434 TAGTTTGGGAGGAGGGGAGGAGG + Intergenic
1178430263 21:32512561-32512583 CACTGGGAGAGGAGGGGAGGGGG + Intronic
1178490330 21:33046702-33046724 GAGTTGGGGGGCAGGGAAGGAGG - Intergenic
1178602251 21:34004809-34004831 CAGTGGGAGGGGAGGTATGGGGG - Intergenic
1178940606 21:36902106-36902128 CAGTTTGAGAGGCGTGATGGAGG + Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179164526 21:38925196-38925218 CAGCTGCAGGGGAAGGAAGGAGG + Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714412 21:43280145-43280167 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714420 21:43280161-43280183 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714428 21:43280177-43280199 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714436 21:43280193-43280215 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714490 21:43280315-43280337 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714650 21:43280684-43280706 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714693 21:43280782-43280804 GAGGTGGAGGGGAGGGAAGGTGG + Intergenic
1179714701 21:43280798-43280820 AAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1180156154 21:45978125-45978147 GAGGGGGAGAGGAGGGAAGGGGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180205060 21:46254685-46254707 CAGTTGGAGATGCATGAAGGGGG + Intronic
1180285693 22:10742338-10742360 CTCTTGGAGAGGGGAGAAGGGGG + Intergenic
1180911014 22:19449943-19449965 GAGTTGGGGAGTAGGGAAGAAGG + Exonic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181031902 22:20152395-20152417 CACCGGGAGAGGAGGGAACGGGG - Intergenic
1181468961 22:23126487-23126509 CAGATGGAATGCAGGGAAGGAGG - Intronic
1181615248 22:24049827-24049849 CAGGTGGAGAGGTGGGAAGATGG - Intronic
1182110453 22:27719411-27719433 CAGTGGGAGAGAAAGGAGGGAGG - Intergenic
1182280322 22:29214606-29214628 AAGTTGGAGAGGAGAGAAGTTGG + Intronic
1182318736 22:29464670-29464692 CAGTTGTAGAGAAGGGCAGTGGG - Intergenic
1182458873 22:30470366-30470388 CAGGTCCAGAGGAGGGAAGGGGG - Intronic
1182803672 22:33052461-33052483 CTGTTTGGGAGGAGGAAAGGAGG + Intronic
1183137890 22:35907357-35907379 CAGTTTGAGAGGAAGAAAAGAGG - Intronic
1183160598 22:36110525-36110547 GATTTGGACAGGAGGGAGGGAGG + Intergenic
1183319101 22:37154264-37154286 CAGATGGAGAGGCAGGGAGGGGG + Intronic
1183430646 22:37763487-37763509 CTGCTGGAGAGGCGGGGAGGTGG + Intronic
1183437126 22:37802717-37802739 GAGTTGGAGGGGAAGGGAGGGGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183545825 22:38454589-38454611 CAGCTGGGGAGGCGGAAAGGCGG + Intronic
1183551027 22:38485531-38485553 GAGTTGGTGGGGAGGGAGGGAGG - Exonic
1183782400 22:40007275-40007297 GAGGAGGAGAGGAGGAAAGGAGG - Intronic
1183832624 22:40426469-40426491 CAGTTGAGTAGGAGAGAAGGAGG - Intronic
1183988929 22:41585067-41585089 CAGTTGGAGTGGGTGGGAGGTGG + Intronic
1184120171 22:42444829-42444851 CCGTGGGAGAGGAGAGAGGGGGG + Intergenic
1184342049 22:43891502-43891524 CATTTGCAGAGGAGGGATCGTGG - Intronic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184928774 22:47664051-47664073 TGGTTGGAGAAGAAGGAAGGTGG - Intergenic
1185157567 22:49203359-49203381 AAGATGCAGAGGAAGGAAGGGGG + Intergenic
949149064 3:742435-742457 GTGTTGGAGGGGAGGGATGGTGG + Intergenic
949870635 3:8584961-8584983 CAGTTGGAGAACAGGGACAGAGG - Intergenic
949892241 3:8741962-8741984 CAGTTGGAGAGAGGGGCTGGAGG - Intronic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950038260 3:9902741-9902763 CACTTGGAGGGGAAGGAATGTGG + Intronic
950167830 3:10815044-10815066 CAGATGGAGAGTAGGGTTGGTGG + Intergenic
950263994 3:11561531-11561553 CAGCTGGGGAGGAGGGGTGGTGG - Intronic
950270519 3:11611105-11611127 CAGTTGAGGAGGGAGGAAGGCGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950375587 3:12569620-12569642 CAGTGGGAGATGATGGAAGTAGG + Intronic
950584707 3:13883908-13883930 CAGATGGTGGGGAGAGAAGGGGG + Intergenic
950585126 3:13886864-13886886 AAGAAGGAGAGGTGGGAAGGAGG + Intergenic
950622218 3:14215131-14215153 CAGCTGGAGAAGAGGGAGGGTGG - Intergenic
950684429 3:14606283-14606305 CAGTAGGGGAGGAATGAAGGAGG + Intergenic
950795352 3:15505984-15506006 CAGGTGGGGAGGAGGGAGGCTGG + Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952590147 3:34942633-34942655 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
953374793 3:42419718-42419740 CACTTGGAAAGGAAGCAAGGAGG - Intergenic
953661713 3:44895539-44895561 CAGTTGGAGAGGGAGGTGGGTGG + Intronic
953673194 3:44979842-44979864 CAGTTTGTGAGAAGGGAGGGTGG + Intronic
954091497 3:48287909-48287931 CAGCTGGAGAGTGAGGAAGGGGG + Intronic
954857119 3:53653742-53653764 CAGAAGGAGAGGAGAGAAAGAGG + Intronic
955533261 3:59897039-59897061 CAGTTGGAAAGGTGGGTGGGAGG - Intronic
955874209 3:63473234-63473256 TAATTGCAGGGGAGGGAAGGGGG - Intronic
956857156 3:73286544-73286566 CAGTAGGAGAGAAGGAAAGAGGG + Intergenic
958026875 3:88059206-88059228 CGGCTAGGGAGGAGGGAAGGGGG + Intronic
958542435 3:95496165-95496187 CAGCAGGAGAGGAGGGTGGGTGG - Intergenic
959254511 3:103992012-103992034 CACGAGGAGAGGAGGTAAGGAGG + Intergenic
959628458 3:108480886-108480908 CAGATGGAGAAGAAGGAACGGGG - Intronic
960586169 3:119323039-119323061 GAGCTGGAGCGGAGGGAACGTGG - Intronic
960783410 3:121345865-121345887 CAGTTTGGGATTAGGGAAGGAGG - Intronic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
961315883 3:126035350-126035372 CTGGTGATGAGGAGGGAAGGAGG + Intronic
961368813 3:126417520-126417542 CAGTTGGAGAGGCAGGCAGGGGG + Intronic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961639038 3:128353446-128353468 GAGGAGGAGAGGAGGGAAAGAGG - Intronic
961745505 3:129061560-129061582 CAGCTGGTGACTAGGGAAGGTGG - Exonic
961812064 3:129527700-129527722 AAGATGGAGTGGAGGGAGGGAGG - Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
962550863 3:136489880-136489902 AAAATGGAGAGGAGAGAAGGTGG + Intronic
962559535 3:136591264-136591286 GAGGAGGGGAGGAGGGAAGGCGG + Intronic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
962747360 3:138406894-138406916 GAGTTACAGAGGAGGGATGGGGG - Intergenic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
963230464 3:142904413-142904435 GAGCAGGAGAGGAGAGAAGGAGG + Intergenic
963357877 3:144232916-144232938 AAGATTGGGAGGAGGGAAGGAGG + Intergenic
963718774 3:148835590-148835612 CACTTGCATAAGAGGGAAGGAGG + Intronic
963774116 3:149421189-149421211 CAGTTGGTGGGGAGGAGAGGAGG + Intergenic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966246437 3:177813254-177813276 CATTTTGAGGGGAGGGGAGGGGG - Intergenic
966855645 3:184192376-184192398 CAGTTAGATAGGAGGAATGGAGG - Intronic
966886494 3:184380283-184380305 CAGCTGGGGAGGAGGGAGGGAGG - Exonic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967269889 3:187724861-187724883 GAGGTGGAGCGCAGGGAAGGAGG - Intronic
967726732 3:192869291-192869313 GAGGAGGGGAGGAGGGAAGGAGG + Intronic
967788117 3:193519356-193519378 GAGTTGGAGAGGAAGGCAGGTGG - Intronic
967828485 3:193898024-193898046 CGGCTGGAGAGCCGGGAAGGCGG + Intergenic
967838117 3:193981397-193981419 AAAGTGGAGAGGAAGGAAGGAGG - Intergenic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968081120 3:195847602-195847624 AGGCTGGAAAGGAGGGAAGGGGG - Intergenic
968085594 3:195872599-195872621 CTGTTGGGGAGGAGGGCCGGTGG - Intronic
968090750 3:195896870-195896892 CAGTTGGAGAGGCTGGAGAGGGG - Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968423419 4:504368-504390 GAGCTGGAAAGGAGGGAAGTGGG + Intronic
968565625 4:1311083-1311105 CGGCTGGAGAGGAGGCGAGGTGG + Intronic
969108865 4:4828911-4828933 GAGGGGGAGAGGAGGAAAGGAGG - Intergenic
969196678 4:5568847-5568869 CAGTTGGACGGGATGGATGGAGG - Intronic
969231604 4:5835748-5835770 CAGTTGGAGAGATTGGGAGGAGG - Intronic
969258659 4:6020331-6020353 CAGTTGGAGGCGGGGGATGGGGG + Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
970168985 4:13269975-13269997 CAGTGGGGGAGGAGAAAAGGAGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
972619573 4:40733822-40733844 AAGGTGGGAAGGAGGGAAGGAGG + Intergenic
973093765 4:46171501-46171523 CAGTTGGTGGGGAGGGAGGGAGG - Intergenic
973182190 4:47283281-47283303 CATTTGTAGATGAGGGAAAGAGG + Intronic
973770426 4:54201376-54201398 GGGTTGGGGAGGAGGGAGGGAGG + Intronic
975528136 4:75373654-75373676 CTGTAGGGGAGGAGGGAGGGAGG - Intergenic
976221820 4:82762204-82762226 GAGGGGGAGAGGAGGGGAGGGGG + Intronic
976361306 4:84181808-84181830 CATTTGGAGAGTAGAGAAGTGGG + Intergenic
976512534 4:85928311-85928333 CGGGAGGAAAGGAGGGAAGGAGG - Intronic
976607148 4:86994757-86994779 CAGCTGGAGCAGAGGGAAAGGGG + Intronic
976636638 4:87293001-87293023 CAGTTGGAAAAGAGGCAAGCAGG + Intergenic
976788007 4:88844664-88844686 CAGTTGGAGAGGCAGGTAGAGGG + Intronic
976929666 4:90550093-90550115 AATTTGGAAAGCAGGGAAGGGGG + Intronic
977997989 4:103517676-103517698 AGGCAGGAGAGGAGGGAAGGAGG - Intergenic
978196150 4:105974389-105974411 CAGTTGGAAATGTGGGAATGTGG - Intronic
978491211 4:109314080-109314102 TAAATGCAGAGGAGGGAAGGTGG - Intergenic
979807538 4:124993375-124993397 CAGTTGGAGAGGAAAGTAGGTGG + Intergenic
979994316 4:127412148-127412170 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
980026895 4:127778726-127778748 AAGTTGGAGAGTAGGCAATGAGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
982071835 4:151702342-151702364 CAGCTGGAGAAGAGGGAGGGAGG + Intronic
982209082 4:153020493-153020515 CAGGAGGAGAGTGGGGAAGGAGG - Intergenic
982220318 4:153119124-153119146 CAGCTGGACAGGAGGGGAGAGGG - Intergenic
982229403 4:153194805-153194827 AAGTTGGAGATGAGGGGTGGTGG + Intronic
983155051 4:164336990-164337012 AAGGAAGAGAGGAGGGAAGGAGG + Intronic
983946436 4:173590938-173590960 CAGTAGGAGAGGTGGGACCGAGG - Intergenic
984639498 4:182145261-182145283 AAGTTGAAAAGGAGTGAAGGAGG + Intronic
984711704 4:182890765-182890787 CAGTGGGAGAGCAGGAATGGAGG + Exonic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985026470 4:185744010-185744032 AAATGGGAGAGGAGGGAAAGGGG - Intronic
985136574 4:186792007-186792029 CAGTTGGAGAGTGGGGAACTAGG - Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985663627 5:1169863-1169885 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
985772812 5:1823787-1823809 CACTCTGAGAGGAGGGGAGGAGG - Intergenic
985791019 5:1926799-1926821 CCATGGGGGAGGAGGGAAGGAGG - Intergenic
986105812 5:4658373-4658395 CAGGTGAAGATCAGGGAAGGAGG + Intergenic
986260629 5:6142945-6142967 CAGAGGCAGAGGAGGGAATGAGG - Intergenic
986424561 5:7617746-7617768 CACCAGGAGAGGAAGGAAGGTGG + Intronic
986759793 5:10869476-10869498 AAGGTAGAGAGGAAGGAAGGAGG - Intergenic
987001587 5:13665505-13665527 CAGTGGGAGAACTGGGAAGGAGG + Intergenic
987036670 5:14026012-14026034 CAGTTTGACAGGAGTGAAAGTGG + Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
987960991 5:24808593-24808615 CTTTTGGAGTGGAGGAAAGGTGG - Intergenic
988031082 5:25763221-25763243 CAGGTGGTGAAGAGGGAAGGAGG + Intergenic
989210196 5:38851489-38851511 GAGATGGGGAGGAAGGAAGGTGG + Intronic
989748820 5:44866190-44866212 CAGATGGTGAGGAGGGAAAGAGG - Intergenic
990407280 5:55503923-55503945 GAATGGGAGAGGAGGGAGGGAGG + Intronic
990426061 5:55690396-55690418 AAGTTGGAGAGAAGAGAGGGAGG + Intronic
990506133 5:56447420-56447442 GGGTTGGAGAGGAGGGAATGCGG - Intergenic
992219636 5:74558945-74558967 TTGGTGGAGTGGAGGGAAGGGGG + Intergenic
992222663 5:74588085-74588107 AAAATGGGGAGGAGGGAAGGAGG + Intergenic
992750557 5:79857007-79857029 CAGTCAGAGAGGAGGAAAGATGG + Intergenic
992776948 5:80097221-80097243 AAGGTGAAGAGGAGGGAAGCTGG - Intergenic
992877965 5:81076479-81076501 GAGTTGGAGAAGAGAGAAAGAGG + Intronic
992877987 5:81076606-81076628 GAGTTGGAGAAGAGAGAAAGAGG + Intronic
992995237 5:82325921-82325943 TGGATGGAGAGAAGGGAAGGGGG - Intronic
993720566 5:91317736-91317758 GAGTTGGAGGTGAGGGTAGGTGG + Intergenic
993900646 5:93582115-93582137 AAGATGGAGAGGGGGGGAGGCGG - Intergenic
993915544 5:93740528-93740550 CGGTTGGAGAGGGGAGAAGAAGG - Exonic
994055353 5:95408102-95408124 GAGAGAGAGAGGAGGGAAGGAGG + Intronic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994099879 5:95880745-95880767 CAGAGAAAGAGGAGGGAAGGAGG + Intergenic
994608160 5:101997549-101997571 GAGTTGGGAAGGAGGGAGGGAGG - Intergenic
994753056 5:103763131-103763153 CATTTGTAGGGAAGGGAAGGGGG + Intergenic
994987206 5:106951823-106951845 CAGTTGGAGTTTAGGGAAGAAGG - Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
995883145 5:116864879-116864901 CAGTTGCAGTGGTGGGGAGGGGG - Intergenic
996595081 5:125191455-125191477 CGGATTGAGAGGAGGGAGGGAGG - Intergenic
996684953 5:126269777-126269799 CTGTGGGAGAGGAATGAAGGTGG + Intergenic
996877211 5:128252681-128252703 CAGGTAGAGTGGAAGGAAGGGGG + Intergenic
997251945 5:132395912-132395934 CAGGAGGAGAACAGGGAAGGAGG + Intergenic
997584676 5:135037318-135037340 CACGAAGAGAGGAGGGAAGGGGG + Intronic
998358536 5:141563133-141563155 CTGCTGGAGAGGATGGATGGAGG - Intronic
998399540 5:141841393-141841415 GAGAGAGAGAGGAGGGAAGGGGG + Intergenic
1000465102 5:161566240-161566262 TAGGTGGAGAGTAGTGAAGGAGG - Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1000936181 5:167305072-167305094 CTTTTGGAGAGGAGGAAAAGAGG - Intronic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1001415237 5:171540996-171541018 AAGAGGGAGAGGAAGGAAGGAGG + Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1002097159 5:176838205-176838227 GAGCTGGAGAGGTGGGAAGTAGG + Intronic
1002261243 5:177995317-177995339 CTGTTGGGGAGGAGAGAACGGGG + Intronic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002340411 5:178513084-178513106 CAGATGGAGAGGAGGAAGGCTGG + Intronic
1002461431 5:179375845-179375867 CAGCAGGGGAGGGGGGAAGGGGG + Intergenic
1002557294 5:180052717-180052739 AAATTGGTGAGGAGGGAGGGAGG + Intronic
1002616212 5:180458087-180458109 GAGATGGAGAGGAGGGGAAGAGG - Intergenic
1002775900 6:327322-327344 CAGCTGGAGGAGAGTGAAGGTGG + Intronic
1003383572 6:5647231-5647253 CAGGAAGAGAGGCGGGAAGGTGG - Intronic
1003909080 6:10727173-10727195 GTGTTGGAGAGGAGGGAAACAGG - Intronic
1003961938 6:11216777-11216799 CAAATGGAAAGGAGGCAAGGCGG - Intronic
1004088029 6:12471155-12471177 AAACTGGAGAGGAGGGAATGGGG - Intergenic
1004110306 6:12711429-12711451 CAGTTGGAGTGGATGGGAAGGGG + Intergenic
1004226533 6:13789814-13789836 GAGATGGAGAAGAGGGAGGGAGG + Exonic
1004510942 6:16284356-16284378 GAGTTGGAGAGCAGGGAAATGGG - Intronic
1004551668 6:16653895-16653917 CTGTGGGAGAGGAGGCAAAGAGG + Intronic
1004964327 6:20830693-20830715 TAATAGGAGAGGAGAGAAGGAGG - Intronic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1005494200 6:26374635-26374657 GAGCTGTAGAGGAGGGAAGCTGG + Intronic
1005659827 6:27985565-27985587 CAGCTGGAGAGTGGGGAAAGTGG + Intergenic
1006146059 6:31960363-31960385 CAGTTGGGGAGAAGGGGAGGTGG + Intronic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006506576 6:34492805-34492827 GACTTCTAGAGGAGGGAAGGAGG + Intronic
1006590787 6:35155213-35155235 GAGTTGGAGAGGAGGGAAATGGG - Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1007155113 6:39735296-39735318 CAGTTTGATTGGAGGGAAAGGGG - Intergenic
1007175571 6:39894539-39894561 CCTTTAGAGAGGAGGGAGGGGGG - Intronic
1007227514 6:40325398-40325420 GAGTTGCAGAGGAGGGTGGGTGG + Intergenic
1007386596 6:41524281-41524303 GAGGAGGAGAGGAGGGGAGGGGG + Intergenic
1007396016 6:41578250-41578272 CAGGTGGAGACGAGAGAAAGTGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007958211 6:45936032-45936054 CAGAGGGAGAGGAGTCAAGGAGG - Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1009993132 6:70868477-70868499 TAGTTGGAGAAGAGAGAATGTGG - Intronic
1010295079 6:74185933-74185955 CAGGTAGGGAGCAGGGAAGGGGG + Intergenic
1010682393 6:78811910-78811932 TAGTTGAATAGGAAGGAAGGTGG + Intergenic
1011711818 6:90062738-90062760 CAGTTGGAGAGAAGGGAAAGAGG - Intronic
1011735009 6:90301883-90301905 GAGTCAGAGAGGAGGGAAGGTGG + Intergenic
1012306175 6:97660955-97660977 CAGTTGTAAAGGAAGAAAGGAGG - Intergenic
1013132316 6:107245123-107245145 CTGTTGGGGAGGTGGGATGGGGG - Intronic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1013824556 6:114195730-114195752 CAGTTGGAGAGAGGAGAAAGAGG + Intronic
1014286719 6:119507332-119507354 CTGGAGGAGAGAAGGGAAGGAGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015322962 6:131896733-131896755 AAGTTGGAGAACAGGGCAGGTGG + Intergenic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016350842 6:143165540-143165562 CAGGTGGAGCGGAGGGCTGGTGG - Intronic
1016425138 6:143927302-143927324 GACTTGGAAAGGTGGGAAGGTGG - Intronic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1016758308 6:147710973-147710995 AAGGTGGGGAGGAGGGAGGGAGG + Intronic
1017074714 6:150607025-150607047 AAGTTGGAGGGAAGGGAAGGGGG - Intronic
1017228924 6:152051582-152051604 CAGAGGGAGAGGAGAGATGGGGG - Intronic
1017274841 6:152554093-152554115 CATTTGGAGAGCTGGGAATGAGG + Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1018219836 6:161566774-161566796 CTGGTGGAGGGGAGGGGAGGAGG - Intronic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1018721266 6:166574310-166574332 CTGCTGGGGAGGAGGGAAGGAGG - Intronic
1018905576 6:168073547-168073569 CAGGCGGAGATTAGGGAAGGAGG + Intronic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019009715 6:168834283-168834305 CAGTTGGAGAGGAAGAGAGCAGG + Intergenic
1019059210 6:169243175-169243197 AGGTGGGAGAGGTGGGAAGGTGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019161805 6:170073952-170073974 CAGGTGGAGCGCAGGGTAGGCGG - Intergenic
1019266764 7:121525-121547 GAGGTGGAGAGGAAGGGAGGAGG + Intergenic
1019304306 7:325585-325607 CAGCTGGAGAGGGGGGAGGTGGG - Intergenic
1019367430 7:642012-642034 CACTTGGGGAGGAGGGAGGAGGG - Intronic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019773971 7:2901451-2901473 CAGATGGAGAGGAGAGGAGAGGG + Intergenic
1019783523 7:2958876-2958898 GAGATGGGGAGGAGGGAAGATGG + Intronic
1019936787 7:4262958-4262980 GAGGTGGCGGGGAGGGAAGGGGG - Intronic
1020104141 7:5413369-5413391 GATGGGGAGAGGAGGGAAGGAGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1021360533 7:19707453-19707475 CCATTGGAGAGGAGGGCAGGGGG - Intronic
1021803655 7:24333422-24333444 AAGTTGGGGAAGATGGAAGGGGG + Intergenic
1022414646 7:30167622-30167644 AGGTGGGAGAGGAGAGAAGGGGG - Intergenic
1022506429 7:30910972-30910994 GTGCTGGAGAGGAGGGAGGGAGG - Intergenic
1022585366 7:31603720-31603742 CTGTGGGAGAGGAAGTAAGGTGG - Intronic
1022636600 7:32142181-32142203 CAGAAGGAGAAGGGGGAAGGAGG + Intronic
1023055169 7:36285047-36285069 GAGCAGGAGAGGGGGGAAGGAGG + Intronic
1023256755 7:38320002-38320024 GTGTTGGTGAGGAGTGAAGGTGG + Intergenic
1023320477 7:38991928-38991950 CCATTGTAGAGAAGGGAAGGAGG - Intronic
1023522087 7:41059151-41059173 CAGCAGGAGAGTAGGGGAGGGGG - Intergenic
1023638688 7:42237547-42237569 GAGGAGGAGAGAAGGGAAGGAGG - Intronic
1023860941 7:44217463-44217485 GAGAGGGAGAGGAGGGGAGGAGG + Exonic
1023956627 7:44891820-44891842 CCAGTGGAGAGGAGGGAAGTTGG + Intergenic
1024027417 7:45424466-45424488 CACATGGTGAGGAGGGAGGGAGG + Intergenic
1024237742 7:47410547-47410569 AAGGTGGAGAGGATTGAAGGTGG - Intronic
1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG + Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025016271 7:55441227-55441249 TGGCTGGGGAGGAGGGAAGGGGG + Intronic
1025965387 7:66265218-66265240 CAGAAGGAGAGGAGAGATGGTGG + Intronic
1026401794 7:70021413-70021435 AAGCTGGATGGGAGGGAAGGAGG + Intronic
1026891447 7:73985194-73985216 CAGCTCGTGAAGAGGGAAGGTGG + Intergenic
1026927423 7:74204121-74204143 GGGAAGGAGAGGAGGGAAGGAGG + Intronic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1027894458 7:84023601-84023623 AGGTTGCAGAGCAGGGAAGGCGG + Intronic
1028472440 7:91219933-91219955 CAGGTGGAGAGGACAGAGGGAGG - Intergenic
1029189331 7:98760714-98760736 CAGTTGGAGAGGACAGAAGGAGG + Intergenic
1029411033 7:100410831-100410853 CAGATGGAGAGGATGGTAGTGGG - Intronic
1029426253 7:100495808-100495830 CAGTAGGAGATGGGGGCAGGGGG + Intergenic
1029580603 7:101434614-101434636 GTGTTGGTGAGGAGAGAAGGCGG + Intronic
1029706090 7:102276789-102276811 CAGTAGGGGAGGAGGGAATGGGG + Intronic
1029831678 7:103267035-103267057 CAGTGGGAGAGGAAGGGATGAGG - Intergenic
1029945350 7:104527171-104527193 AAGTTGGAGAGTTGGGCAGGGGG + Intronic
1030133290 7:106221371-106221393 AAGGTGGAGAGGAAGAAAGGGGG - Intergenic
1030424441 7:109356285-109356307 CAGAAAGAAAGGAGGGAAGGAGG + Intergenic
1030744529 7:113149024-113149046 GAGTTGAAGATGAGGGAAAGAGG + Intergenic
1031101671 7:117487947-117487969 CAGTTCTAGAGGAAGCAAGGTGG + Intronic
1031606048 7:123769371-123769393 CTGTTAGAGAGAGGGGAAGGAGG + Intergenic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032037489 7:128531245-128531267 CAGTGGGAGAGGAGGGGGAGGGG - Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032125572 7:129189918-129189940 CATTTGGAGGGAAGGGTAGGGGG + Intronic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1032694447 7:134322255-134322277 CATTTGGGGAGGAGGGGAGAGGG - Intergenic
1032986090 7:137338957-137338979 CATTTGGAGAGGAGAGAGGAAGG + Intronic
1033024598 7:137760286-137760308 CATTTGGGGAGGAGAGAGGGAGG - Intronic
1033028663 7:137803145-137803167 CATTTGGAGAGAAGGGATGGAGG + Intronic
1033136151 7:138786128-138786150 GAGGTGGAGAAGAGGGAAGCTGG - Intronic
1033270641 7:139930053-139930075 CGGCTGGAGGGGAGGGATGGAGG - Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034021824 7:147652706-147652728 AAGTTAGAAAGGAAGGAAGGGGG + Intronic
1034461031 7:151198187-151198209 GAGATGGAGAGGTGGGTAGGTGG + Intronic
1034461042 7:151198235-151198257 CAGATGGAGAGGTGGGTAGAAGG + Intronic
1034503443 7:151467292-151467314 CAGTAGGAGGGCAGGGCAGGCGG - Intronic
1034549640 7:151812278-151812300 GAGTCTGAGAGGAGGTAAGGGGG + Intronic
1034564168 7:151900061-151900083 CTTCTGGAGTGGAGGGAAGGAGG - Intergenic
1034744948 7:153515715-153515737 CACTTGGAGTGGGGAGAAGGGGG + Intergenic
1034959825 7:155358305-155358327 CACGAGGAAAGGAGGGAAGGTGG + Exonic
1035038031 7:155908124-155908146 TAGGGGGAGAGGAAGGAAGGTGG + Intergenic
1035251392 7:157599849-157599871 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251397 7:157599865-157599887 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251402 7:157599881-157599903 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251412 7:157599911-157599933 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251417 7:157599927-157599949 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251422 7:157599943-157599965 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251426 7:157599959-157599981 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251430 7:157599975-157599997 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251435 7:157599991-157600013 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251440 7:157600007-157600029 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251445 7:157600023-157600045 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251450 7:157600039-157600061 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251455 7:157600055-157600077 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251459 7:157600071-157600093 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251468 7:157600101-157600123 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251473 7:157600117-157600139 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251478 7:157600133-157600155 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251482 7:157600149-157600171 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251486 7:157600165-157600187 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251491 7:157600181-157600203 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251496 7:157600197-157600219 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251501 7:157600213-157600235 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251506 7:157600229-157600251 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251510 7:157600245-157600267 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251514 7:157600261-157600283 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035570570 8:669980-670002 CAGGTGGAGAGGAGAGAGGACGG - Intronic
1035992758 8:4510752-4510774 AAGGAAGAGAGGAGGGAAGGAGG - Intronic
1036098126 8:5747509-5747531 CAGTTGCAGAAGATGAAAGGAGG - Intergenic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036444492 8:8809704-8809726 CAGTTGGGGAGAGGGGGAGGGGG + Intronic
1036461657 8:8958960-8958982 AAGTGGGAGAGTTGGGAAGGTGG - Intergenic
1036493905 8:9252057-9252079 AAGGGGGAGAGGGGGGAAGGGGG + Intergenic
1036611327 8:10352434-10352456 GAGTTGAAGAGGAGGCAGGGAGG + Intronic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1037056268 8:14445534-14445556 CAGCTGGAGAAGGGGGCAGGTGG - Intronic
1037057042 8:14455974-14455996 CAGTTGGAGGGGAGGGGATGCGG + Intronic
1037139962 8:15507870-15507892 CAGATGGAAAGGAGTGAAGGTGG + Intronic
1037187476 8:16081513-16081535 GAGTTGGAGTGAAGGGAAGGGGG - Intergenic
1037346374 8:17905618-17905640 CATTTTGAGAAGAGGGAAAGAGG + Intronic
1037658276 8:20905989-20906011 CACGTGGAGGGAAGGGAAGGAGG + Intergenic
1038147673 8:24913634-24913656 CGGTCGGGGAGGAGGGGAGGGGG - Exonic
1038542619 8:28402233-28402255 GAGGTGGGGAGGAGGGAGGGAGG + Intronic
1038542635 8:28402265-28402287 TAGATGGGGAGGAGGGAGGGAGG + Intronic
1038596467 8:28890588-28890610 GAGATAGGGAGGAGGGAAGGCGG - Exonic
1038717855 8:30008002-30008024 GAGATGGAGAGGAGGAAAGAAGG + Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1040387087 8:46921016-46921038 CAGTTACAGGGGAGGGGAGGAGG + Intergenic
1040491711 8:47929349-47929371 CAGAACAAGAGGAGGGAAGGTGG + Intronic
1040728514 8:50412845-50412867 CAGTTGGGAAGGATGTAAGGTGG + Intronic
1041731310 8:61066089-61066111 CAGTTGGGAAGGACGTAAGGGGG + Intronic
1041788621 8:61664747-61664769 GGGCTGGAGAGGAGGGAAGGTGG + Intronic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042204220 8:66312253-66312275 AAGTAGGAGAGGAATGAAGGAGG - Intergenic
1042893349 8:73637191-73637213 CAGAAGGAGAGGAGGAAAAGGGG + Intronic
1043767096 8:84149794-84149816 CAGTTGGAGAGGAGGGTTTGAGG + Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044160895 8:88913737-88913759 AAGATGGAGAGGAGAGGAGGTGG - Intergenic
1044217058 8:89624657-89624679 GGGTTTGGGAGGAGGGAAGGAGG - Intergenic
1044800418 8:95948291-95948313 GAGTTGGGCAGGAGGGAAGCAGG - Intergenic
1044896936 8:96902572-96902594 CAGATGGATGGGATGGAAGGAGG - Intronic
1045388098 8:101690186-101690208 CTTGTGGAGAGGAGGGGAGGGGG + Intronic
1045508364 8:102794552-102794574 CAGCTGGAGAGGAGGAATGGTGG - Intergenic
1045526949 8:102949090-102949112 CAGCTGGAAAGGAGGGAATGTGG - Intronic
1046647441 8:116801709-116801731 AAATTGAAGATGAGGGAAGGAGG - Intronic
1046682231 8:117183103-117183125 CAGGTGGAGAGGTGGGAGGCTGG + Intergenic
1046941181 8:119933062-119933084 CCGTTGGAGAGGAGGGAGTGGGG + Intronic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047278344 8:123423248-123423270 CAGAAAGAAAGGAGGGAAGGAGG - Intronic
1047292063 8:123540258-123540280 GAGGTGCAAAGGAGGGAAGGGGG - Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047681699 8:127260188-127260210 CATTTTGGGAGAAGGGAAGGAGG - Intergenic
1047724246 8:127670465-127670487 GAGTTGGGGAAGAGGAAAGGGGG - Intergenic
1047907001 8:129483131-129483153 AAGGAGGAGAGGAGGGAAGGGGG + Intergenic
1047915159 8:129575148-129575170 CAGTTGGAAAGAAGGGAATAAGG + Intergenic
1048260785 8:132943522-132943544 CAGGTGGAGAGCAGGGAGGAGGG - Intronic
1048366439 8:133742706-133742728 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
1048574216 8:135678282-135678304 CAGGAGGAGAGGAGGGAGAGAGG - Intergenic
1049245591 8:141560552-141560574 CAGATGGAGGGCAGGGGAGGAGG + Intergenic
1049350879 8:142163996-142164018 GAGATGGAGATGAGGGATGGAGG + Intergenic
1049653323 8:143786794-143786816 AACTTGGAGGGGAGGGAATGAGG + Intergenic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1050689688 9:8211879-8211901 AATTTGGAGAGGAGGGCAAGCGG - Intergenic
1050778690 9:9302524-9302546 AAGTGGGAGAGTGGGGAAGGCGG - Intronic
1050837698 9:10104156-10104178 GGCTGGGAGAGGAGGGAAGGAGG + Intronic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1051544195 9:18255793-18255815 CAGCTGGAGACCAGGGAAAGAGG - Intergenic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1053131230 9:35616937-35616959 CAGACGGAGAGAGGGGAAGGGGG + Intronic
1053300907 9:36948808-36948830 GAGTTGGAGAGGAGGCAGGAGGG - Intronic
1053312217 9:37027133-37027155 CAGTTGGAGAGAGGCGGAGGGGG - Intronic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1054822504 9:69537544-69537566 CTTCTGGAAAGGAGGGAAGGAGG + Intronic
1054850646 9:69843452-69843474 AAGTAGGAGGGGAGGGGAGGGGG - Intronic
1054929379 9:70620025-70620047 CAGGGGGAGAGGAGGAAAGGTGG - Intronic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056027547 9:82514777-82514799 AAGTAGGAAAGGAGGGAGGGAGG - Intergenic
1056123115 9:83509014-83509036 AAGTTGGGGAGGAGGCAAGGAGG - Intronic
1056224338 9:84480686-84480708 GATTTGGAAAGGAGGGAGGGGGG - Intergenic
1056502904 9:87228060-87228082 TAGCTGGAGAGGAGGTAGGGAGG - Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056965166 9:91159365-91159387 AAGAAAGAGAGGAGGGAAGGAGG + Intergenic
1057014048 9:91634973-91634995 AAGTAGCAGAGGAGGGGAGGAGG + Intronic
1057042398 9:91857186-91857208 TAGTTGGATGGGAGGGGAGGAGG - Intronic
1057082594 9:92184217-92184239 TAGGTGGAGAGGAGGATAGGTGG - Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057260001 9:93577699-93577721 AAGATGGGGAGGGGGGAAGGAGG + Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057535990 9:95907096-95907118 CAGTTGTAGAGGACAGAAAGAGG - Exonic
1058378205 9:104349496-104349518 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1058551709 9:106122022-106122044 CAGTCGGAGAAGAGGAAAAGAGG + Intergenic
1058641347 9:107088702-107088724 CAGCAGGAGAGGAGGTATGGTGG - Intergenic
1059349611 9:113655185-113655207 CAGGTGAAGAGGAAGGGAGGTGG - Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1060151566 9:121292234-121292256 AAGTCAGAGAGGAGGGGAGGGGG + Intronic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060332461 9:122685827-122685849 CGGATGGGGAGGAGGGAAAGGGG - Intergenic
1060935032 9:127509787-127509809 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060935039 9:127509808-127509830 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060993532 9:127862417-127862439 AAGTGGGAGAGGAAGGAAGTGGG - Intergenic
1061230892 9:129315341-129315363 CAGAGAGAGAGGAGGGATGGTGG - Intergenic
1061498554 9:130989679-130989701 CCATGGGAGAGGAGGGCAGGGGG - Intergenic
1061838025 9:133342051-133342073 CAGTCAGGGAGGAGGGAGGGTGG - Intronic
1061942711 9:133891845-133891867 GGGATGGAGAGGAGGGATGGAGG + Intronic
1061999281 9:134207753-134207775 CAGGTGGAGAGGATGGGGGGAGG - Intergenic
1061999310 9:134207829-134207851 CAGCTGGAGAGGATGGGGGGAGG - Intergenic
1062245393 9:135563395-135563417 CAGGTGGACAGGTGGGTAGGTGG + Intronic
1062284879 9:135768440-135768462 AAGGCGGAGAGGATGGAAGGCGG - Intronic
1062328768 9:136026460-136026482 CAGAAGGAGAGGAGGAGAGGAGG + Intronic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062477879 9:136738277-136738299 CACTTGGAGGGGAGGGACAGAGG + Intronic
1203785640 EBV:126073-126095 CAGTTGGGGAGGAGGGGAACTGG - Intergenic
1203732042 Un_GL000216v2:99404-99426 CTCTTGGAGAGGGGAGAAGGGGG + Intergenic
1185581381 X:1213262-1213284 AAGGGGGAGGGGAGGGAAGGGGG - Intergenic
1185612891 X:1402782-1402804 CATTTGGGGAGGGGGGAAGGAGG - Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1185890477 X:3817341-3817363 CAGTAGGAGAGCAGGGGTGGTGG + Intergenic
1185895460 X:3854487-3854509 CAGTAGGAGAGCAGGGGTGGTGG + Intergenic
1185900577 X:3892911-3892933 CAGTAGGAGAGCAGGGGTGGTGG + Intergenic
1185905693 X:3931342-3931364 CAGTAGGAGAGCAGGGGTGGTGG + Intergenic
1186490804 X:9970554-9970576 AAGGAGGAGAGGAGGGAGGGAGG - Intergenic
1186623454 X:11266111-11266133 GAGTTGGGGAGGAGGAAAGAGGG + Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1188245829 X:27834847-27834869 CAGTTGGAAGGGAGGGACTGAGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189203078 X:39214625-39214647 CTGTTGGAGAGGGAGGAATGGGG + Intergenic
1189364812 X:40380313-40380335 CAGCTGGAGGGGAGGCAAGGTGG + Intergenic
1189667363 X:43370985-43371007 GAGAGGGAGAGGAGGGAGGGAGG + Intergenic
1189746128 X:44170731-44170753 CGTTTGGAGAGGAGTGAAGCAGG - Intronic
1189882309 X:45504872-45504894 GAGATGGAGAGGAGGGAGAGGGG + Intergenic
1190091316 X:47439787-47439809 CACTTAGATAGGAGGGAAGGTGG + Intergenic
1190248825 X:48707398-48707420 AGGGAGGAGAGGAGGGAAGGAGG - Intronic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1191904904 X:66077254-66077276 GAGAAGGAGAGAAGGGAAGGAGG - Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1194847181 X:98824789-98824811 CATTAAGAGAGGAGTGAAGGAGG + Intergenic
1194982560 X:100455047-100455069 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1196534422 X:116825164-116825186 CAATGGAAGAGGAGGGGAGGGGG + Intergenic
1196586578 X:117436109-117436131 CAGGGGTAGAGGAGAGAAGGGGG - Intergenic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1198693818 X:139314042-139314064 CAGGTGGAAAGGAGAGAAAGAGG - Intergenic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1199963757 X:152801076-152801098 CAGATGGTGGGGAGGGAGGGAGG - Intergenic
1200250112 X:154548246-154548268 CAGTTGGAGAGGAAGGGATGGGG + Intronic
1200352213 X:155509975-155509997 AAGTTGGAGAGGAGGAATGATGG - Intronic
1201438682 Y:13985729-13985751 CTGATGGTGAGGAGGGAGGGAGG - Intergenic
1201445891 Y:14056979-14057001 CTGATGGTGAGGAGGGAGGGAGG + Intergenic
1201894869 Y:18982532-18982554 CAGTAGGAGAGCAGGGATGGTGG - Intergenic