ID: 1198679395

View in Genome Browser
Species Human (GRCh38)
Location X:139165548-139165570
Sequence TCAGGGGCCCAGAGCTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198679386_1198679395 17 Left 1198679386 X:139165508-139165530 CCCGAAAGCACTTTGGATATTTT 0: 1
1: 0
2: 2
3: 28
4: 384
Right 1198679395 X:139165548-139165570 TCAGGGGCCCAGAGCTCTCAAGG 0: 1
1: 0
2: 3
3: 27
4: 262
1198679387_1198679395 16 Left 1198679387 X:139165509-139165531 CCGAAAGCACTTTGGATATTTTT 0: 1
1: 0
2: 5
3: 57
4: 613
Right 1198679395 X:139165548-139165570 TCAGGGGCCCAGAGCTCTCAAGG 0: 1
1: 0
2: 3
3: 27
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198679395 Original CRISPR TCAGGGGCCCAGAGCTCTCA AGG Intronic
900284999 1:1894786-1894808 TCAGGGACCCAGAGCTGACCGGG - Intergenic
900347229 1:2215545-2215567 TCGGGGGCCCAGTGGTCCCAAGG - Intergenic
900376590 1:2357528-2357550 GCCGGGGCCCAGAGCTGCCAAGG - Exonic
900410602 1:2510891-2510913 TCAGGGCCCCAGAGATGCCAGGG + Intronic
900605241 1:3520938-3520960 GCATGGGGCCAGAGCTCTCAGGG - Intronic
900935765 1:5765537-5765559 TCAGGGGTCTTGGGCTCTCAGGG - Intergenic
901852135 1:12022345-12022367 TGAGGGACCCAGAGCCCTCAGGG + Exonic
903643794 1:24878386-24878408 TCAAGAGAGCAGAGCTCTCATGG + Intergenic
904368906 1:30036016-30036038 TCAGGGGCACAGGGCTGTCTGGG + Intergenic
905632312 1:39525468-39525490 TCCCGCTCCCAGAGCTCTCAGGG + Intronic
910426986 1:87128232-87128254 GCATGGTCCAAGAGCTCTCAGGG + Intronic
912430299 1:109625237-109625259 GCAGGGGCCCAGGGCTTTCAGGG + Intronic
913494352 1:119414616-119414638 TTAGGAACCCAGAGCTCTCCAGG + Intergenic
913536111 1:119774181-119774203 GCAGCTGCCCATAGCTCTCAAGG + Intergenic
915123614 1:153648249-153648271 TAAGGGTCCCAGAGCTGTCCAGG - Intergenic
916059115 1:161086765-161086787 CCTGGGGCTCAGAGCTCTAATGG + Intronic
916617210 1:166454392-166454414 TCATGGGGGCAGACCTCTCATGG - Intergenic
917659668 1:177164791-177164813 TCCGGGGTCCAGGGCTCTCCCGG - Intronic
918232857 1:182551346-182551368 TCAGGGAGACAGAGCACTCAGGG + Intronic
919074585 1:192797953-192797975 TCATGGGGGCAGATCTCTCATGG + Intergenic
919798438 1:201336071-201336093 TCTGGGGCCCAGAGTTTTCCTGG + Intergenic
920559223 1:206927219-206927241 TCAGTGGCCCCGAGCATTCAAGG - Intergenic
921127348 1:212189432-212189454 TCTCAGGCCCAGAGATCTCATGG - Intergenic
921422733 1:214967231-214967253 TCACGAGGACAGAGCTCTCATGG + Intergenic
1065436044 10:25704809-25704831 TCACGGGGCCAGATCTCTCATGG + Intergenic
1066010676 10:31191242-31191264 TCAGGGGCCCATAGCTTTCCTGG + Intergenic
1067803113 10:49373530-49373552 TCATGAGCACAGATCTCTCAGGG + Intronic
1068747874 10:60555789-60555811 TCAGGGACCCAGATCTCTTTTGG - Intronic
1069117129 10:64521327-64521349 TCAGTAACCCAGAGCTTTCAGGG - Intergenic
1069683541 10:70301576-70301598 TCAGGTGCTCAGAGTCCTCATGG - Intronic
1070471017 10:76779588-76779610 TCAGGGACCCAGAAATCTCAAGG - Intergenic
1070937635 10:80313788-80313810 TCAGGGGGGCAGAACCCTCATGG - Intergenic
1071338809 10:84623912-84623934 TCAGAGGCTCAAAGTTCTCAAGG + Intergenic
1072019480 10:91383884-91383906 TGAGGGGCTAAGAGTTCTCAGGG + Intergenic
1073511417 10:104045098-104045120 TCAGGGACCCACAGTGCTCAGGG - Intronic
1074814779 10:117135720-117135742 TCCTGGGCCCAGAGCCCACATGG + Intronic
1075145873 10:119882669-119882691 TCAGGGGCTCAGATCCCTCATGG - Intronic
1075405958 10:122195905-122195927 TGTGGGGCCCAGAGCTGTCCAGG - Intronic
1076674809 10:132142326-132142348 GCAGGGGCCCACAGCGCCCAGGG + Intronic
1077278652 11:1730826-1730848 ACAGTGGTCCAGAGCTCTCCAGG - Intergenic
1077366790 11:2164485-2164507 ACAGTGGCTCAGAGCTCCCAGGG + Intronic
1077902573 11:6501445-6501467 TAAGGGGTCCAGAGCACTGATGG + Intronic
1078050701 11:7962776-7962798 TCTGTGGCCCTGATCTCTCAAGG - Intronic
1078915960 11:15779220-15779242 GCAGAGGCCGAGAGCTCTAAGGG + Intergenic
1080034694 11:27699800-27699822 TTAGGGGGCCAGAGCTGTCGAGG - Intronic
1082029747 11:47595428-47595450 GCAGGGGTCCAGGCCTCTCAGGG - Intergenic
1082815616 11:57506600-57506622 TCAGTGGCCCAGGGCTCTCCTGG - Intronic
1083150077 11:60786465-60786487 CCAGGGCCCCAGAGCTCTCACGG + Intronic
1083876502 11:65526755-65526777 GCAGTGACCCAGAGCTCTTAGGG - Intronic
1084149829 11:67282903-67282925 TCAGTGGCCCAGATCTCTGCTGG - Intronic
1084208227 11:67608349-67608371 TCATGGCCCCAGAGCACTCTGGG + Intronic
1084564433 11:69921126-69921148 TCAGGGCTCCAGACTTCTCAAGG + Intergenic
1086592061 11:88526472-88526494 GCAGGGGCCCAGAGCTCTTAAGG + Intronic
1087008119 11:93488758-93488780 TTAAGGGCCCACAGCTCCCAGGG - Intronic
1089199796 11:116717380-116717402 CCAGGGGCCCAAAGACCTCATGG + Intergenic
1089402306 11:118171404-118171426 GCAGAGGCCCAGAGCTCTGAGGG + Intronic
1089412567 11:118258692-118258714 TCATGGGAGCAGATCTCTCATGG + Intronic
1090204952 11:124878893-124878915 TCTGGGGTACAGAGGTCTCAGGG + Intronic
1090741811 11:129668961-129668983 TCATGGGGACAGATCTCTCATGG + Intergenic
1090875964 11:130789357-130789379 TCAGTGGCCCAGGGCCATCATGG + Intergenic
1090959058 11:131539643-131539665 TCAGGGCCAGAGAGCTCTCCAGG + Intronic
1091676977 12:2498693-2498715 TGAGGGGCACAGAGCACTCCAGG + Intronic
1091753030 12:3034255-3034277 GCTGGGGCGCAGAACTCTCAGGG + Intronic
1093116721 12:15221109-15221131 TCAGAGGCCGAGCGCGCTCAGGG + Intronic
1095990172 12:48029058-48029080 TCAGGGACTCAGAGATCTCTTGG - Intergenic
1096214556 12:49792107-49792129 TCAGAGGCACTGAGCTCTGAGGG + Intronic
1096347908 12:50866576-50866598 ACAGGGCCCTAGAACTCTCAAGG - Intronic
1096843562 12:54393042-54393064 TCAGTGGGGCAGAGATCTCAGGG + Intergenic
1098367694 12:69722432-69722454 TCAAGGACCCAGAGATCTCCAGG + Intergenic
1100591876 12:96037011-96037033 TCACGGGGGCAGAGCCCTCATGG - Intronic
1100657336 12:96660987-96661009 GAAGGGGCACAGAGCTTTCATGG + Intronic
1101469117 12:104978271-104978293 TCATGAGGACAGAGCTCTCATGG - Intergenic
1101724366 12:107376868-107376890 TGAGGGGCCCAGAGGTATAAGGG + Intronic
1102173362 12:110858933-110858955 ACTGGAGCCCAGAGGTCTCAAGG - Intronic
1102443285 12:112979743-112979765 TCGGGGGCCCAGGGCTCTGGGGG - Intronic
1102962463 12:117101484-117101506 TCAGCGGCTCAGAACTCCCAGGG - Intergenic
1104800952 12:131554990-131555012 CCAGGAGCCCAGAGCTCCCCAGG + Intergenic
1105624637 13:22101170-22101192 TCACGGGCCCAGAGCTCTATAGG + Intergenic
1105700090 13:22929236-22929258 TCAGGGACTCAGACCTTTCAGGG - Intergenic
1106424016 13:29608582-29608604 TTTGGGTCCCAGAGCACTCACGG + Intergenic
1109211276 13:59538401-59538423 TCAGGGCCCAAGAGCTCTTTAGG + Intergenic
1109349934 13:61166448-61166470 CCAAGGGGCTAGAGCTCTCAGGG - Intergenic
1110028592 13:70574810-70574832 TCATGAGGTCAGAGCTCTCATGG + Intergenic
1111531349 13:89541469-89541491 TCTGGGCCGCAGAGCTCTCTTGG + Intergenic
1112945072 13:104918537-104918559 TCATGGGGACAGAGCCCTCATGG + Intergenic
1113556479 13:111239653-111239675 TGAGGGGCCCTGAGGTATCAGGG + Intronic
1116176629 14:41479119-41479141 GAAGGGGCACAGAGCTCTCAAGG - Intergenic
1117364530 14:55012810-55012832 TCATGAGGCCAGAGCCCTCATGG + Intronic
1117477516 14:56111507-56111529 TCATGGGGGCAGAGCCCTCATGG + Intergenic
1117792527 14:59356095-59356117 TCAGAGAAACAGAGCTCTCAAGG - Intronic
1119379475 14:74219463-74219485 TCAGGAGCCCTGAGGTCCCATGG + Intergenic
1119427745 14:74546801-74546823 TCAGGTGGGCTGAGCTCTCAAGG + Intronic
1120206381 14:81591369-81591391 CTTGGGGCCCAGAGCTCTGAAGG + Intergenic
1120583009 14:86277651-86277673 TCAGGAGGGCAGAGCACTCATGG - Intergenic
1122409621 14:101519165-101519187 CCAGGGCCACAGAGCTCTCCTGG + Intergenic
1122635793 14:103129071-103129093 GCAGCGCCCCAGAGCTCCCAGGG - Intronic
1122657704 14:103273425-103273447 TCCGGGGCGCAGAGCTCTTGAGG + Intergenic
1122788019 14:104172875-104172897 CCAGGGGCACCGAGATCTCAGGG - Intronic
1124388199 15:29227264-29227286 TCAGGCACCCAGAACCCTCATGG + Intronic
1124567061 15:30825914-30825936 GCTGGGGCTCAGAGCACTCAGGG - Intergenic
1126198486 15:45957702-45957724 TCATGGGCTCAGAACTTTCAAGG + Intergenic
1129100124 15:73253972-73253994 TCAGAGGCCCAGAGCCCTTCTGG + Intronic
1130991894 15:88880465-88880487 TGAGAGGCCCAGGGCTCTAAGGG + Intronic
1131668071 15:94591156-94591178 TCAGTCGCCCAGAGCTCAGAGGG - Intergenic
1132642982 16:986245-986267 TGAGGGGCCCAGTCCTCCCAGGG - Exonic
1133025864 16:2988716-2988738 GCAAGGGCCCTGAGCTCTCCTGG - Intergenic
1133152674 16:3848345-3848367 CCAGGGTCCCAGACCTTTCAGGG + Intronic
1133985029 16:10661943-10661965 TGAGGGACCCAGGGCTCTGAAGG - Intronic
1134831038 16:17323066-17323088 TCAGGGCTGCAGAGCTCTCCAGG + Intronic
1138266461 16:55663375-55663397 TCAGGGGTACAGAGATCACATGG - Intronic
1138432927 16:56981078-56981100 TCAGGGGCCCTGAGCTAGGAGGG + Intronic
1139635413 16:68255564-68255586 TCACAGGCCCAGAGGTCCCAGGG - Intronic
1139834591 16:69828116-69828138 TCAGGGTCCCAGTGCTCTATAGG - Intronic
1140567468 16:76060891-76060913 CCAGGGGCTCAGAGCCCTCAAGG + Intergenic
1140752571 16:78039323-78039345 TCATGAGGGCAGAGCTCTCATGG + Intronic
1142243576 16:88958316-88958338 TCAAGAGCCCAAAGCTCCCAGGG + Intronic
1142720858 17:1774920-1774942 TCAGGGGCTCTGAGGCCTCAGGG - Intronic
1142805462 17:2368998-2369020 CCAGGGGTCCAGAGGCCTCAGGG + Intronic
1143399912 17:6637373-6637395 TGAGGGGCCCACAGCTGCCAGGG - Intronic
1143490007 17:7280928-7280950 TCAGAGGCTCAGAGACCTCAGGG + Intergenic
1145253590 17:21310532-21310554 CAAGGGCCCCAGAGCTCTCTTGG + Intronic
1146529721 17:33598288-33598310 TCAGGGTCACAGAGCTCAGAAGG - Intronic
1147970553 17:44217476-44217498 ACAGTGGCCTAGAGCTCTCTGGG - Intronic
1148093967 17:45039786-45039808 TCAGTGGTTCAGAGCTCTCCTGG + Intronic
1148327747 17:46793617-46793639 TCAGGGGACCAGAGAATTCAAGG + Intronic
1149328330 17:55555857-55555879 TCAGGGGCCCACAGATCAGATGG + Intergenic
1150596471 17:66610277-66610299 GGAGGGGCCCAGAGCTTCCATGG + Intronic
1151120598 17:71788758-71788780 TCATGGGATCAGATCTCTCATGG - Intergenic
1151384013 17:73744205-73744227 TCTGGGGCCCACAGTCCTCAAGG + Intergenic
1151553565 17:74835556-74835578 TCAGACCCCCAGGGCTCTCAGGG - Intronic
1152067250 17:78118663-78118685 CCAGGGACCCAGAGGTCCCAAGG + Intronic
1153170212 18:2307791-2307813 TCATGGGGCCAGATCCCTCATGG + Intergenic
1155139136 18:23028085-23028107 TCAGGGACCCAGATGTCTCCTGG + Intergenic
1155712660 18:28902713-28902735 ACCAGGGCCCAGACCTCTCAGGG + Intergenic
1155982601 18:32196531-32196553 CCAAGGGCCCAAAGCTCTCAAGG - Intronic
1156712679 18:39965877-39965899 TCTGGGGCCCAGAGATTTTAGGG - Intergenic
1157519165 18:48333693-48333715 TCCTGGGCCCCAAGCTCTCAAGG - Intronic
1158520485 18:58168591-58168613 TCAGTGGCCCAGGGCTCTGAAGG - Intronic
1160199529 18:76784717-76784739 CCAGGAGCCCAGGGCTCTTACGG - Intergenic
1160822724 19:1066031-1066053 TCGGGGGCAAAGAGTTCTCAAGG + Exonic
1160827750 19:1088634-1088656 TCCGGCCCCCACAGCTCTCACGG - Exonic
1161106188 19:2445201-2445223 TCAGGGGCCCAGAGGGGTCTGGG - Intronic
1161441033 19:4291703-4291725 CTGGGGTCCCAGAGCTCTCAGGG - Intergenic
1161812686 19:6479618-6479640 TCAGGGACTCAGATCTCTCAGGG - Intronic
1163595848 19:18220678-18220700 GCTGAGGCCCAGAGATCTCATGG - Intronic
1164448679 19:28339758-28339780 TCATGGGGGCAGATCTCTCATGG + Intergenic
1168555387 19:57334480-57334502 CCAGGGTCACAGAGCTGTCAAGG + Intergenic
927651462 2:24916032-24916054 GGAGGGGCAGAGAGCTCTCAAGG - Intronic
928456144 2:31424258-31424280 TCATGGGGGCAGATCTCTCACGG + Intergenic
928696202 2:33852643-33852665 TCAGGGGGGTAGATCTCTCATGG - Intergenic
930358490 2:50348274-50348296 TCAGGGGACCAAAACTCACAAGG + Intronic
931988869 2:67769134-67769156 GCAGGGGCACAGAGCCCTCCAGG + Intergenic
934612850 2:95753619-95753641 CCAGTGGCACTGAGCTCTCAGGG + Intergenic
934653380 2:96104669-96104691 CCAGGGGCACAGAGCACTGAGGG - Intergenic
935886181 2:107621993-107622015 TCAGGGAACCAGATCTCACAAGG + Intergenic
937454087 2:122026309-122026331 ACAGGGGCCCAGAGCACACATGG + Intergenic
938195598 2:129324708-129324730 TCAGGGGCCCAGGACTGTCTGGG - Intergenic
938422530 2:131156127-131156149 TGTTGGGCGCAGAGCTCTCAGGG + Intronic
938696540 2:133840288-133840310 CCAAGAGCCCAGAGCTCCCAAGG - Intergenic
938927538 2:136057982-136058004 TCAGGAGGGCAGAGCCCTCATGG + Intergenic
944887783 2:204082586-204082608 GCAGAGGCCAAGAGCTCTAATGG + Intergenic
944946969 2:204699214-204699236 TTAGGGGCCCAGGGCTCCCTGGG - Intronic
945410402 2:209499873-209499895 TAATGGGGGCAGAGCTCTCATGG - Intronic
945948579 2:216017597-216017619 TCAGGTGCCCAGAGGGCTCTTGG - Intronic
1170571507 20:17635382-17635404 TCAGGGGCCCAGAACCCAGACGG + Intronic
1172099592 20:32477185-32477207 TCAGGGGCCCAGCGCTCCCCTGG + Intronic
1173737602 20:45373014-45373036 CGAGGGGCACAGAGCTCTCCGGG - Exonic
1176040010 20:63060396-63060418 TCCGGCGCCCAGAGCTCACAGGG + Intergenic
1178597808 21:33970647-33970669 TCTGGGGCCCAGAGAGCTTAGGG - Intergenic
1179433598 21:41344246-41344268 TCAGGGGACCTGGACTCTCAGGG - Intronic
1179909675 21:44441211-44441233 TCAGGTGGCCAGAGCTCACAGGG + Intronic
1179965662 21:44803214-44803236 GCAGGGACCCATGGCTCTCATGG - Intergenic
1181028028 22:20136942-20136964 ACCAGGGCCCAGAGCTCTCAGGG - Intronic
1181361934 22:22344207-22344229 CCATGTGCACAGAGCTCTCATGG + Intergenic
1181361999 22:22344650-22344672 TCAGCAGCCTAGTGCTCTCAGGG + Intergenic
1181881440 22:25983534-25983556 TGACTGGCCCAGAGCTCTGAAGG - Intronic
1182692694 22:32175091-32175113 TCAAGTGCCCAGAGGTCACAGGG - Intergenic
1184424863 22:44403412-44403434 GCAGAGGCCCAGAGCTCAGAGGG + Intergenic
1184477803 22:44730805-44730827 TCAGTGGCCCAGAGGACCCAGGG - Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1184865126 22:47198014-47198036 TTAGGGTCCCGCAGCTCTCAGGG - Intergenic
1184901417 22:47448736-47448758 TGACTGGCCCAGAGCACTCAGGG + Intergenic
1185384962 22:50527364-50527386 TCAGGGGCCCTGAGCATTGAGGG + Intronic
949233795 3:1784156-1784178 TCAGGGGACCAGAGGTGGCAGGG - Intergenic
949642554 3:6054536-6054558 TCAGGGGGCCAGATCCCTTATGG - Intergenic
950555597 3:13694013-13694035 TCATGAGGACAGAGCTCTCAAGG + Intergenic
951655605 3:25004543-25004565 TCATGGGAGCAGAGCTCTCATGG + Intergenic
952436250 3:33275477-33275499 TCATGAGGACAGAGCTCTCACGG + Intergenic
953403746 3:42649963-42649985 TCAGGAGTCCAGAGGTGTCAGGG + Intergenic
953492665 3:43364175-43364197 TCCCAGGCCCAGAGCTCTCCCGG - Intronic
954115483 3:48464827-48464849 TCAGGTGGTCAGAGCGCTCACGG + Exonic
955120663 3:56054950-56054972 TCAGAGGCTCACAGCCCTCATGG + Intronic
958859734 3:99432013-99432035 TCATGAGAGCAGAGCTCTCATGG + Intergenic
960235912 3:115281913-115281935 TCTTGGGCCAAAAGCTCTCAGGG + Intergenic
961553172 3:127680494-127680516 CCAGGGGCCAGGAGCTCTCTTGG + Exonic
961888640 3:130112216-130112238 TCAGGGGCCCAGACCTAGCTGGG + Intronic
963436564 3:145276169-145276191 CCAGGGCCCCAGACCTCACATGG + Intergenic
965301543 3:167011339-167011361 TCAGGGGTGGAGAGCCCTCATGG - Intergenic
966149052 3:176846262-176846284 TCAGGGCCCCAGTTCTCTCCAGG + Intergenic
968403482 4:318324-318346 TCAGGGTCCCAGAGCTTTCTGGG + Intergenic
969605921 4:8202268-8202290 GAAGGTGCCCAGAGCTCTCCAGG + Intronic
970237861 4:13976793-13976815 TCACGGGGGCAGATCTCTCATGG - Intergenic
971505068 4:27357876-27357898 AATGGGGCCCAGAGCTCACATGG + Intergenic
971513991 4:27464001-27464023 CCTGGAGCCCAGAGCTATCATGG - Intergenic
973582853 4:52361400-52361422 TCATGGGGCCAGATCCCTCATGG + Intergenic
974257923 4:59486291-59486313 TCATGAAACCAGAGCTCTCATGG - Intergenic
980981986 4:139662481-139662503 TCATGGGAGCAGAGCTCTCATGG + Intergenic
981194518 4:141903084-141903106 TCATGGGGGCAGATCTCTCATGG - Intergenic
982106496 4:152016059-152016081 TCAGGAGGGCAGAGCCCTCATGG - Intergenic
985025740 4:185737567-185737589 GCAGGGTCTCCGAGCTCTCATGG - Intronic
990214365 5:53514135-53514157 TTAGGGCCCCAGAGCACTCCAGG + Intergenic
992497154 5:77305332-77305354 TCAGGGCCCAAGAGCTCACTGGG - Intronic
992522504 5:77569473-77569495 TCAACCACCCAGAGCTCTCATGG + Intronic
992977125 5:82132044-82132066 TCATGGGCACAGATCCCTCATGG - Intronic
993091591 5:83433268-83433290 TCATGCGGACAGAGCTCTCATGG + Intergenic
994117492 5:96077553-96077575 TCATGGGGCCAGATCCCTCATGG + Intergenic
998201448 5:140126779-140126801 TGATGGGCACAGAGCACTCAGGG - Exonic
1000462100 5:161535845-161535867 TCATGGGGGCAGAGCTCTTATGG + Intronic
1001351662 5:170973897-170973919 TCATGAGGGCAGAGCTCTCATGG - Intronic
1002206666 5:177567760-177567782 CCAGGAGACAAGAGCTCTCATGG + Intergenic
1002716887 5:181233658-181233680 TCAGGGGACCAGACCTCTGGGGG - Exonic
1003038006 6:2661914-2661936 TCAGGACCTCAGAGCTCACATGG - Intergenic
1005717679 6:28567080-28567102 TCAAGGGCTCACAGCTCTAAGGG + Intergenic
1006636680 6:35466323-35466345 TCAGGGGCCCAAATGTTTCAAGG - Exonic
1006733525 6:36254752-36254774 TCAGGGGCTGAGACCTCTCTGGG + Intronic
1007252599 6:40506032-40506054 TGAGGGGCCTAGATCTTTCAAGG + Intronic
1009735869 6:67675235-67675257 TCAGGGACCCAGACCTCACTTGG - Intergenic
1011115765 6:83889935-83889957 TCATGGGGGCAGATCTCTCATGG - Intronic
1011226694 6:85115828-85115850 TCTGGTCCCCAGAGCTCTCTTGG - Intergenic
1013730083 6:113155106-113155128 TCAGAGGCCCAGAGCTCTAGGGG + Intergenic
1014207288 6:118669894-118669916 TCTGGGGCCCAGAGAGCTTATGG - Intronic
1015700877 6:136034818-136034840 TCAGGGACCCTGGGCCCTCAGGG + Intronic
1016935870 6:149449062-149449084 TCAGGGGCCCTGGCCTCTCCTGG - Intronic
1017646399 6:156543400-156543422 TCACGGGGCCAGATCTCTCATGG + Intergenic
1017710928 6:157167190-157167212 TCAGGAGCGCAGAGCTGCCAAGG - Intronic
1018712529 6:166506960-166506982 TCAGGGCCACGGGGCTCTCAGGG + Intronic
1018984458 6:168625707-168625729 CCTGGGGCCCAGGGCTCACACGG - Intronic
1019161899 6:170074574-170074596 GCAGGGGCACAGAGCGCCCAGGG + Intergenic
1019530458 7:1500444-1500466 CGAGGAACCCAGAGCTCTCAGGG + Intronic
1019738220 7:2660707-2660729 TCAGAGGCACAGAGCTCCCCGGG - Intronic
1019920190 7:4158323-4158345 ACAGGAGCCCAGAGCTCTCAGGG + Intronic
1020014187 7:4821323-4821345 ACTGGGGGCCAGACCTCTCATGG - Intronic
1020135513 7:5585879-5585901 CCAGGAGCCCAGAGCCTTCAGGG + Intergenic
1020679627 7:11220670-11220692 TCATGGGGACAGAGCCCTCACGG - Intergenic
1022089137 7:27096430-27096452 TCAGTGGGCCAGAGCTCGCCGGG + Intergenic
1024307993 7:47944183-47944205 TCACGGGGGCAGATCTCTCATGG + Intronic
1024569407 7:50711342-50711364 TCCGGGTCCCAGAGCTCCCTGGG + Intronic
1025952012 7:66152739-66152761 TAAGGGGCCCAGAGCACTGTTGG + Exonic
1028105709 7:86875842-86875864 TCTGGGGCCCAAAGCTATCATGG - Intergenic
1029114090 7:98228589-98228611 TCAGGGGACCACAGTTCTCTGGG + Intronic
1029605319 7:101595487-101595509 TCTGGGGCTCAGAGCAATCAGGG - Intergenic
1029952783 7:104604374-104604396 TCACAGGCCCAGAGCTCTAGCGG - Intronic
1030983021 7:116209150-116209172 GCAGGGGCCCACACCTTTCAAGG + Intergenic
1031357285 7:120802267-120802289 TCACGGGCCCAGACCACCCAAGG + Intronic
1032590047 7:133183458-133183480 GCACCAGCCCAGAGCTCTCATGG - Intergenic
1034338437 7:150338008-150338030 TGAGTGGCCCAGAGCACTCCTGG + Exonic
1034362630 7:150514090-150514112 GCAGGTTCCCAAAGCTCTCACGG - Intergenic
1036629386 8:10499827-10499849 TCTGGGTCAGAGAGCTCTCAAGG + Intergenic
1037363897 8:18102583-18102605 TCATGGGGCCAGATCCCTCACGG + Intergenic
1038270292 8:26069422-26069444 TGAGGGTCCCACAGCTCACACGG - Intergenic
1038625926 8:29193187-29193209 TCTGGGCCCAAGGGCTCTCAGGG - Intronic
1040605065 8:48923538-48923560 ACAGCGGCCCAGACCTCACACGG - Intergenic
1041315941 8:56562639-56562661 TCATGGGGGCAGATCTCTCATGG + Intergenic
1042368577 8:67964597-67964619 TAAGAGCTCCAGAGCTCTCAAGG + Intronic
1042454462 8:68984543-68984565 TCAGGAGCCCAGAAACCTCAAGG - Intergenic
1044318036 8:90772287-90772309 TCAAGGGCTCAGAACCCTCAGGG - Intronic
1045438787 8:102190014-102190036 TCATGGGGGCAGATCTCTCATGG - Intergenic
1046888806 8:119399303-119399325 TCATGGGGGCAGATCTCTCATGG + Intergenic
1048423215 8:134297499-134297521 TCATGGGCACAGAACTCACAGGG + Intergenic
1049593166 8:143471716-143471738 TCAGGGGCCCAGAGCCCAGGGGG + Intronic
1050366208 9:4876090-4876112 TTAGTGGCCCAGAACTATCAAGG - Intronic
1050700985 9:8338362-8338384 TCATGGGAGCACAGCTCTCATGG + Intronic
1052892154 9:33711654-33711676 TCATGGGGACAGATCTCTCATGG + Intergenic
1052901230 9:33796416-33796438 GCAGGGGCTCAGATCTCTCCTGG - Intronic
1053119662 9:35537258-35537280 CCCTGGGCCCAGAGCTCTCATGG + Intronic
1056413926 9:86358338-86358360 CCAGTGGCCCAGAGAACTCAGGG - Intergenic
1060594788 9:124841451-124841473 GCAGGGCCCCAGAGAGCTCAGGG - Intergenic
1061296324 9:129678867-129678889 TCAGTTGCCCAGAGCTCGCTGGG + Intronic
1185839428 X:3374984-3375006 ACTGGGGCCCAGACCACTCAAGG + Intergenic
1185913514 X:4008762-4008784 TTAGGGGCTCAGCGCTCTCTGGG - Intergenic
1189070309 X:37856612-37856634 TCATGGGGGCAGATCTCTCATGG - Intronic
1193244562 X:79212781-79212803 TCAGGGGCCCAGAGCTAATGAGG + Intergenic
1195238986 X:102932354-102932376 TCATGGGGGCAGATCTCTCAAGG - Intergenic
1196221447 X:113115718-113115740 TCATGAGGGCAGAGCTCTCATGG + Intergenic
1196855978 X:119984722-119984744 TGAGGGGCCCAGTGCCTTCAAGG + Intergenic
1197348760 X:125357376-125357398 TCTGGGCCCCACAGCTCTCTGGG + Intergenic
1198401631 X:136274167-136274189 TAAGCTGCCCAGAGCTCCCAAGG - Intergenic
1198679395 X:139165548-139165570 TCAGGGGCCCAGAGCTCTCAAGG + Intronic
1198771451 X:140135106-140135128 TCATGAGGCCAGAGCCCTCATGG + Intergenic
1199261568 X:145780703-145780725 TCATGGGGGCAGATCTCTCATGG + Intergenic
1199506908 X:148573273-148573295 TCAGGGTCCCAGAGGCTTCATGG - Intronic
1199821514 X:151453723-151453745 TCCGGTGCCCTGTGCTCTCAGGG + Intergenic
1200119494 X:153783635-153783657 TCCGGGCCCCAGGGCTCCCATGG - Intronic