ID: 1198683190

View in Genome Browser
Species Human (GRCh38)
Location X:139203525-139203547
Sequence TGGTGGGAAAGGAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2726
Summary {0: 1, 1: 0, 2: 11, 3: 221, 4: 2493}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198683190 Original CRISPR TGGTGGGAAAGGAGGGGGGA GGG Intronic
Too many off-targets to display for this crispr