ID: 1198683824

View in Genome Browser
Species Human (GRCh38)
Location X:139207011-139207033
Sequence CCTTGGGGTTGTTGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198683824_1198683830 14 Left 1198683824 X:139207011-139207033 CCATCTTCACAACAACCCCAAGG 0: 1
1: 0
2: 2
3: 24
4: 252
Right 1198683830 X:139207048-139207070 TTATTTTCGTTTCACAAATGAGG 0: 1
1: 2
2: 33
3: 246
4: 1512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198683824 Original CRISPR CCTTGGGGTTGTTGTGAAGA TGG (reversed) Intronic
900350077 1:2230136-2230158 TCTTGGGGTTGGGGTGAAGGTGG + Intronic
900504738 1:3023929-3023951 GCATGGGGCTGGTGTGAAGACGG + Intergenic
900958939 1:5907140-5907162 CCATGGGGTAGCTGTGAAGTAGG + Exonic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
902851928 1:19165488-19165510 CCTTGGGGTTGTTGGTGAGGGGG - Intronic
902930555 1:19728333-19728355 CCATGGGGTGGTTGTGAGGGTGG + Intronic
903618951 1:24683825-24683847 GCATGGGGTTGTGGGGAAGAGGG + Intergenic
905317610 1:37093580-37093602 CCTTGGGGAAGTTCTGGAGATGG - Intergenic
906191465 1:43902012-43902034 CCTTGGGCTTGGGGTGGAGAAGG - Intronic
907419711 1:54338760-54338782 CCTTTGTGTTGTTGGGGAGAAGG - Intronic
907570276 1:55476845-55476867 CCTTGGTGTTGCTGGAAAGATGG + Intergenic
907641381 1:56193843-56193865 CCTGGGGCAAGTTGTGAAGAGGG - Intergenic
907833956 1:58091839-58091861 GCTTGTGGTTGTTGAGGAGAGGG - Intronic
909737595 1:78983089-78983111 CCCTGAGGTGGTGGTGAAGAAGG + Intronic
910678180 1:89835723-89835745 CCTAGGGTTAGTTGTGAGGATGG + Intronic
911337712 1:96601161-96601183 CCTTTTGGCTGTTGTGAATAGGG + Intergenic
911654959 1:100433380-100433402 TCTTGTGGAGGTTGTGAAGAGGG + Intronic
915921406 1:159978321-159978343 CTTTGGGGTTGTTAGGAAAAAGG + Intergenic
916933442 1:169603597-169603619 CATTGGGGTGTTTCTGAAGAAGG - Intronic
920006649 1:202838153-202838175 GTTTGGGGCTGTTGTGTAGATGG + Intergenic
920418718 1:205815272-205815294 CTTTGGGGTTATTATGAATAAGG + Intergenic
920420781 1:205831944-205831966 CCTGGGGGTATTTGTGAAAAAGG + Intronic
921290424 1:213651555-213651577 TTTTAGGGTTGTTGTGAACAGGG - Intergenic
921967515 1:221105962-221105984 CCTGGAGGCTGTTCTGAAGATGG + Intergenic
922795511 1:228337678-228337700 GCTTGGGGTGGGTGTGGAGATGG + Intronic
1062790314 10:300208-300230 CCTTTGGGCTGCTGTGAACATGG - Intronic
1063165062 10:3454243-3454265 CATTGGGGATGTTATGGAGAAGG - Intergenic
1063195551 10:3738773-3738795 CCTTGGGGTTGTGGTGAAACAGG + Intergenic
1063266636 10:4458691-4458713 CCTTGAGGTTGTGGAGAAAAGGG - Intergenic
1064139252 10:12776776-12776798 GCTTGGGGCTGTTGTAAACAGGG + Intronic
1064441652 10:15359451-15359473 CCTTGAGGATGTTGAGAAGGAGG - Intronic
1065222966 10:23514719-23514741 CCTTGGGAATGTTGGGGAGAGGG + Intergenic
1066694258 10:38064020-38064042 TCGTAGGGTTGATGTGAAGATGG - Intronic
1066998262 10:42583169-42583191 TCTTAGGGTTGATGTGAAGATGG + Intronic
1067544229 10:47181311-47181333 CCTTGGAGGTGGTGTGAATAGGG - Intergenic
1069915077 10:71782367-71782389 CCTTGGGGTTGTGCTGATGCTGG - Intronic
1070823264 10:79375582-79375604 GATGGGGGTTGTTGAGAAGATGG + Intergenic
1071504180 10:86222822-86222844 GCTTGGTGTTGTGGTGAGGAAGG - Intronic
1074047140 10:109849616-109849638 CTATGGGATTGTTGTAAAGATGG - Intergenic
1075809035 10:125210976-125210998 CCTTTTGGCTGTTGTGAATAAGG + Intergenic
1076018131 10:127045593-127045615 TCTTGGTGTTGTTGGGAAGAAGG - Intronic
1076081951 10:127590330-127590352 CACTGGGGTTGGTTTGAAGATGG + Intergenic
1076331830 10:129675872-129675894 CCTGGTGGGTGTTGTGAGGAGGG - Intronic
1076881379 10:133241111-133241133 CTTTGGAGTTCTTGTTAAGAGGG - Exonic
1078865919 11:15297127-15297149 CCCTGGGAATGTTGTAAAGAGGG + Intergenic
1079892691 11:26077280-26077302 TCATGGGTTTATTGTGAAGAAGG - Intergenic
1080663923 11:34319221-34319243 CGGTGGGGTTGTGGGGAAGAAGG - Intronic
1081097109 11:38950773-38950795 CCTGGGGATACTTGTGAAGAAGG - Intergenic
1081297883 11:41414101-41414123 GCCTGAGGTTGTTGTGAAAACGG + Intronic
1081859672 11:46325661-46325683 CCATGGGGATGTTGTGATGGAGG + Intergenic
1082799943 11:57407042-57407064 CTTTGGGGATGTTTTCAAGAAGG - Intronic
1083295328 11:61712307-61712329 CCCTGGGGTTGTAGTGAGGATGG + Intronic
1084980124 11:72824552-72824574 CCCAGGGGTTGGTGTGGAGACGG - Intronic
1085049163 11:73371082-73371104 GCTTGGGTTTGATGTTAAGAGGG + Intergenic
1085414292 11:76310071-76310093 ACTTGGGGGTGTTTTGGAGATGG - Intergenic
1088763890 11:112958405-112958427 ACCTGGGTATGTTGTGAAGATGG - Intergenic
1089767735 11:120780553-120780575 CCTTTTGGCTGTTGTGAATAAGG + Intronic
1094628699 12:32151065-32151087 TGGTGGGGTTGTTGGGAAGATGG + Intronic
1094694235 12:32801275-32801297 CCTTGGTGGTGTTTTAAAGATGG + Intronic
1095256253 12:40040396-40040418 TTTTGGGGTTGTTTTGAAAAAGG + Intronic
1096014634 12:48258457-48258479 CCTTTTGGTTATTGTGAATAAGG - Intergenic
1096984682 12:55748626-55748648 CCTTGGGGCTGAAGTGAAAATGG - Exonic
1097529743 12:60783274-60783296 CCTTGGGGTTGTGGTTTATAGGG - Intergenic
1097739430 12:63222026-63222048 CCTTGGGGTTGAAGGGAGGAAGG + Intergenic
1098219405 12:68252696-68252718 ACTTGGGGTGGTGGTGATGATGG - Intronic
1098267267 12:68735212-68735234 CCTTGTGTTTGTTTTGCAGATGG + Exonic
1099169082 12:79342073-79342095 CCTTGTGGCTGTTGCGCAGAGGG + Intronic
1100161513 12:91866143-91866165 CCTTGGTGTTTTTGTGCAGAGGG + Intergenic
1100785168 12:98071007-98071029 TCTTGGGGTTTCTTTGAAGAGGG + Intergenic
1101808007 12:108081811-108081833 CTTTTGGGCTGCTGTGAAGATGG - Intergenic
1101904683 12:108815734-108815756 CCTTGGGGTGGTTGGGAACCTGG - Intronic
1102542708 12:113634183-113634205 CTTATTGGTTGTTGTGAAGAGGG + Intergenic
1102641894 12:114374192-114374214 CCTTGTAGTTGTTCTGAACAGGG - Intronic
1102830044 12:115989806-115989828 CCTTAGTGTCCTTGTGAAGAAGG - Intronic
1104559577 12:129831779-129831801 CCTGGGGGTTGTTGGGAGGCTGG - Intronic
1105857725 13:24387243-24387265 TAATAGGGTTGTTGTGAAGACGG + Intergenic
1106542399 13:30701621-30701643 TCATAAGGTTGTTGTGAAGATGG + Intergenic
1106774904 13:32999408-32999430 CCTGGGGGTTGCTGGGAAGATGG + Intergenic
1107977480 13:45704115-45704137 CCTAGGGGTGGGTGTGAAGGAGG + Intronic
1108590063 13:51905441-51905463 CCCTTGGGTTGCTCTGAAGAAGG - Intergenic
1111125324 13:83906854-83906876 CTTTGGGGTCCTTGTTAAGAGGG + Intergenic
1113523744 13:110957944-110957966 CCTCGGGGTGGCTGTGAGGATGG + Intergenic
1116803898 14:49472621-49472643 CCTTTTGGTTATTGTGAATAAGG - Intergenic
1116824801 14:49662301-49662323 CCTTGTTGTTGTTGTTGAGACGG + Intronic
1117873370 14:60223905-60223927 TCTTTGGGTTGTTGTGAAAAAGG - Intergenic
1118157891 14:63258592-63258614 CCTTTGGGCTGTTGGGGAGAGGG - Intronic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1122011854 14:98756946-98756968 CCGTGGGCTTGTGGAGAAGATGG + Intergenic
1122030437 14:98908009-98908031 CCTCGGGGTTGTTGTGTGGAAGG + Intergenic
1122421714 14:101582046-101582068 CCTTGGGCTTGGTGTGGAGCAGG - Intergenic
1123476899 15:20597015-20597037 ACATGGGGCTGTGGTGAAGAAGG + Intergenic
1123641112 15:22403349-22403371 ACATGGGGCTGTGGTGAAGAAGG - Intergenic
1124085239 15:26543499-26543521 CCTTGGCTATCTTGTGAAGATGG - Intergenic
1126881350 15:53101669-53101691 GCTTGGGGTTATTGTGAATATGG - Intergenic
1127062460 15:55200933-55200955 CCTTGGGCCTGTTGAGAATAGGG - Intergenic
1128966948 15:72068898-72068920 CCTTAGGGTTGTTATGAGGATGG - Intronic
1129362752 15:75034495-75034517 CCTTGGGGGTTTTGTTAAGGAGG + Intronic
1130153623 15:81331550-81331572 CCTGGGGGTTGTGTTGAAGAAGG - Exonic
1131118577 15:89809200-89809222 CCTGGGGGGTGCTGTAAAGATGG - Intronic
1131349764 15:91688480-91688502 CCTAGGGGTAGGAGTGAAGAAGG + Intergenic
1132484203 16:181653-181675 CCGGGGGGTTGTGGTGAAGGAGG + Intergenic
1132973088 16:2698421-2698443 CCTTGGTTTTATTGGGAAGAGGG + Intronic
1133387052 16:5378272-5378294 CCTTTGGGTTGTTTGGATGAGGG - Intergenic
1134774474 16:16839858-16839880 CCTTAGGGTTGTGGTGGAGTTGG + Intergenic
1134819468 16:17234723-17234745 CCTTAGGGTTGCAGAGAAGATGG - Intronic
1135653814 16:24230027-24230049 CCTTAGGTTTGTTGTGGGGATGG + Intergenic
1137400326 16:48147950-48147972 TATTGTGGTTGTTGTGGAGACGG + Intronic
1137487230 16:48901782-48901804 CCTCTGGTTTGTTGTGATGAAGG - Intergenic
1137562629 16:49512714-49512736 GCCTCGGGTTGTTGTGAAGATGG - Intronic
1137963977 16:52912870-52912892 CCTTGGGGTTGGTCTGTACACGG - Intergenic
1138458359 16:57133836-57133858 CCATTGGGGTGTTGTGAGGAAGG + Intronic
1138999700 16:62494624-62494646 TATTGGGGTTTTTGTGAAAAAGG + Intergenic
1141089036 16:81117420-81117442 CCTGGCGGTGTTTGTGAAGAGGG - Intergenic
1143098175 17:4489646-4489668 CCCTGGGGCTGTTGGGAGGAAGG - Intergenic
1143549712 17:7622637-7622659 CATGGGGGTGGTTGTGAAAATGG + Intronic
1154940352 18:21107064-21107086 CCTTCAGGTTGTTGTGTATAAGG - Intronic
1155314318 18:24556449-24556471 CCTTTTGGCTGTTGTGAACAAGG - Intergenic
1158360376 18:56665907-56665929 CCTGGGGGAAGTTCTGAAGATGG + Intronic
1160237372 18:77097016-77097038 CCTTTGGGTTGGTGGGAAGTGGG + Intronic
1161010516 19:1957481-1957503 CCTTGGGTTTGCTGTTAGGAGGG + Intronic
1162503220 19:11066620-11066642 CCTTGGGGTTGTTGGGAGAAGGG - Intergenic
1163691162 19:18739204-18739226 CCATGGGGATGGTGTGGAGATGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164548217 19:29186440-29186462 CCTTGGGGTTGCTGGGCACAGGG - Intergenic
1164677128 19:30109038-30109060 CCTTCAGGTTGTTGGGCAGAGGG + Intergenic
1168398330 19:56067339-56067361 CCTTTTGGCTGTTGTGAACAAGG - Intergenic
927615871 2:24594585-24594607 CTTTTGGTTTGTTGTGCAGATGG + Intronic
932172679 2:69571894-69571916 ACCTGGGAATGTTGTGAAGATGG + Intronic
932279951 2:70481890-70481912 CATTGAGGTTGCTGTCAAGATGG - Intronic
933716682 2:85366581-85366603 TCATGGGGCTGTTGTGAGGATGG - Intronic
934054398 2:88239935-88239957 CGTGGGGGTGGCTGTGAAGAAGG + Intergenic
934699641 2:96429283-96429305 CCTTGGTTTTGTTGTGTTGATGG - Intergenic
935608670 2:104997853-104997875 TCTTCGGGGTGTTGAGAAGAAGG + Intergenic
936847003 2:116848407-116848429 ACTTGGGGCTATTGTGAATAGGG - Intergenic
937811957 2:126209467-126209489 CCATAGGGTTGTTGTGAGGTTGG - Intergenic
938295734 2:130178245-130178267 CCATCGGGTTGTTGTGAGGTTGG - Intronic
938460884 2:131495574-131495596 CCATCGGGTTGTTGTGAGGTTGG + Intergenic
941585968 2:167359683-167359705 TCTCTGGGGTGTTGTGAAGATGG - Intergenic
941760738 2:169239999-169240021 CTATTGGGTTGTAGTGAAGAAGG - Intronic
942066448 2:172276334-172276356 CGTTAGGGTTTTAGTGAAGATGG + Intergenic
942155357 2:173121945-173121967 CCTTGGGGTGGCTGGGAAGGAGG + Intronic
942245945 2:174008327-174008349 CCTTAGGTTTGATGTGGAGATGG - Intergenic
944919220 2:204393990-204394012 CCTTGGGGGTGTGATGAAGTGGG - Intergenic
945935787 2:215901661-215901683 CCTTGGGTTAGGAGTGAAGAAGG + Intergenic
946032710 2:216717768-216717790 CCTGGGGGATGTTGTGGGGAAGG + Intergenic
947953990 2:234171754-234171776 CCTTGGAGATGTTGTGATGTGGG + Intergenic
948698641 2:239747099-239747121 CCCTGGAGTTGTTGGGGAGAAGG + Intergenic
948901493 2:240958796-240958818 CCTGGGGCTTGGGGTGAAGAAGG + Intronic
1168830576 20:843223-843245 CCTGTGGGTCGTTGTGCAGATGG - Intronic
1169202194 20:3716965-3716987 CCTTGTGGTTGTGTTGAGGAGGG - Intergenic
1170557298 20:17525182-17525204 CCTTGGGGTGGCTGGGAATAAGG - Intronic
1172884985 20:38224837-38224859 TCTTGGGGTTGTGGGGAGGAGGG + Intronic
1174254230 20:49242374-49242396 CCTTGTGGTTGTTGAGAACTAGG + Intronic
1174385224 20:50184364-50184386 CCTTTTGGCTATTGTGAAGAAGG + Intergenic
1174653396 20:52148981-52149003 CCTTTTGGTTGTTGGGAAGTTGG - Intronic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175872503 20:62215146-62215168 TCTGGGGGTTGTTGGGAGGAGGG - Exonic
1178011723 21:28294955-28294977 CCATGGGGTTGCTGTGGAGTTGG - Intergenic
1179085720 21:38215856-38215878 CCCTGGGGTTGCTGTGACAAAGG + Intronic
1180631779 22:17234833-17234855 GTTTGGGGTTGTTTTGAAGGCGG - Intergenic
1181347574 22:22231251-22231273 CCTTGTGGTTTTTGTGAATAAGG - Intergenic
1181661317 22:24351258-24351280 ACTTGGGGTGCTTGTGAAAATGG - Intronic
1181956060 22:26589068-26589090 CCTTGGGGATGTTGAGGAGGCGG - Intronic
1183088703 22:35506217-35506239 GTTTGGGGTTGTTTTGAATAGGG + Intergenic
1184280244 22:43433332-43433354 CCCTGGGCTTGTTGTGAGCAGGG + Intronic
1184441417 22:44518839-44518861 CCATGGGGTTGTGGGGCAGAGGG + Intergenic
1184840665 22:47050751-47050773 CCTTGGGGTGGGTGGGATGAGGG + Intronic
1184919381 22:47594911-47594933 ACTTGGGGATGCTGGGAAGAAGG - Intergenic
1184974563 22:48051922-48051944 CCCTGGGGTTGTTGGGGTGAAGG + Intergenic
949768695 3:7554649-7554671 GATTGGGGTTGGTGTGAGGATGG + Intronic
950660585 3:14464503-14464525 CCTAGGGGTTGTTGGGCTGAGGG + Intronic
952204271 3:31164131-31164153 TATAGGGGTTGTTGTGAGGATGG + Intergenic
954465374 3:50651406-50651428 CCTTGCTGTTGTTGGGGAGAGGG + Intergenic
955103754 3:55876513-55876535 CCAGAGGGATGTTGTGAAGAAGG + Intronic
960519885 3:118642401-118642423 ACACGGGGTTATTGTGAAGATGG - Intergenic
961826359 3:129601317-129601339 CCTTTGGGTTCTCGGGAAGAAGG + Intronic
962366907 3:134792941-134792963 CCTGGGTGTGGTTGTGGAGATGG + Intronic
963260502 3:143187059-143187081 CCTGGGGGTTTTTAGGAAGAAGG + Intergenic
966442926 3:179966660-179966682 CCTAGTGGTTGTTGTGAAAATGG - Intronic
967588021 3:191237970-191237992 CTTTGGGATTTTTGTCAAGAAGG - Intronic
968173742 3:196530612-196530634 CCTTTGGATTAATGTGAAGAAGG + Intergenic
968702954 4:2065331-2065353 CCTTGGGCTGGGTGGGAAGAGGG + Exonic
969074053 4:4563335-4563357 CCTTGGGATAGTTAAGAAGAAGG - Intergenic
969710493 4:8840503-8840525 CCTTGTGGGGGCTGTGAAGAGGG - Intergenic
970558546 4:17260016-17260038 CTTTGGGGTTGGTGTGCTGATGG - Intergenic
971750583 4:30641866-30641888 CCTTGTGGTATTTGTGAAGCAGG - Intergenic
972580754 4:40393955-40393977 CCTAGGGTTTGTTGCAAAGAAGG + Intergenic
972600243 4:40565714-40565736 CCCTGGGCTTGCTCTGAAGATGG - Intronic
972600408 4:40567004-40567026 CCCTGGGCTTGCTCTGAAGATGG + Intronic
976599928 4:86928603-86928625 ACTTGGGGTTGTGTTGAAGCAGG + Intronic
977371614 4:96144504-96144526 CCATGGGGATATTGGGAAGAGGG - Intergenic
977413000 4:96691683-96691705 TCTTGGGCTTCCTGTGAAGAAGG + Intergenic
977618668 4:99111962-99111984 CCTTGGGGATGTTGTTGAGCAGG + Intergenic
983982008 4:174009296-174009318 CCTGGGTGCTGTGGTGAAGATGG - Intergenic
985432358 4:189893663-189893685 CCTTGTGGTTGCTGTAAATAAGG + Intergenic
985750014 5:1668241-1668263 GCCTGGGGTTGTGGTGAAAATGG + Intergenic
989225962 5:39028638-39028660 CTTTGGGGCTGTTATGAATAAGG - Intronic
989286518 5:39706418-39706440 CCTTGGAGATGTTGTTAAAAGGG - Intergenic
992778029 5:80105225-80105247 CCTTGGTGGTGTGGGGAAGAAGG - Intergenic
992981613 5:82180429-82180451 CATTGGTGGTGCTGTGAAGAAGG + Intronic
994596255 5:101840536-101840558 CCTTTTGGCTATTGTGAAGAGGG + Intergenic
995623520 5:114053740-114053762 CCTAGGGGATGTGGTGAAGGGGG + Intergenic
996772083 5:127096639-127096661 CATTGTTGTTTTTGTGAAGACGG + Intergenic
999233706 5:150078111-150078133 CCTTGGTGTTGTTGTGTTGGAGG + Exonic
999322123 5:150621985-150622007 TCTTGAGATTGTTGTGCAGATGG + Intronic
999750794 5:154627041-154627063 CAGTGGGGTTGTTGAGAACATGG - Intergenic
1001705485 5:173738270-173738292 CCATGGGGATATTGTGAAGAGGG + Intergenic
1002643471 5:180641414-180641436 CCCTGGGGTGCTTGGGAAGACGG + Intronic
1002827288 6:785121-785143 CCCTGGGCTTCTTGTGGAGATGG - Intergenic
1004695829 6:18031960-18031982 CCTTGGGGCTATTATGAATAAGG - Intergenic
1005234783 6:23747403-23747425 CCTTGGAGGTGATGTGTAGAGGG - Intergenic
1006375144 6:33667869-33667891 GCTTGCGGTTGTTGTGCAGCAGG - Exonic
1006603682 6:35242124-35242146 CGTAGGGGTTGTTGAGAAGCTGG - Intronic
1011629703 6:89311762-89311784 CCATGGGGATGATGTGAAGATGG - Intronic
1012422804 6:99083337-99083359 CCTTTGGGTTGTTGAGTAGGAGG + Intergenic
1015187301 6:130432813-130432835 CTGTAGGATTGTTGTGAAGAGGG - Intronic
1015408795 6:132868472-132868494 CATTGGTGGTGTTGTGAAGAAGG - Intergenic
1015426627 6:133077728-133077750 TCATGAGGTTGTTGTCAAGATGG + Intergenic
1018321140 6:162610157-162610179 ACACAGGGTTGTTGTGAAGAAGG - Intronic
1018717157 6:166542236-166542258 CCTTAGGGTGGTTGTCATGAAGG - Intronic
1018717272 6:166543314-166543336 CCTTGGGGTGATTCTGAAGCAGG - Intronic
1018751246 6:166808109-166808131 GCTTGGCCTTGTTGTGAACATGG - Intronic
1019998693 7:4742178-4742200 TCTTAGGGCTGTTGTGAACATGG + Intronic
1020006600 7:4786633-4786655 CCTTGTGGGTGTTTTGGAGAGGG + Intronic
1020897161 7:13954809-13954831 CAATGGGGTTGTTTTGAACAAGG - Intronic
1021333306 7:19366552-19366574 CCTTTGGAGTGTTTTGAAGAGGG + Intergenic
1021944091 7:25708439-25708461 CCTGGGGGTTGTTGAAATGAGGG - Intergenic
1022190502 7:28012991-28013013 CCATGGGGTAAGTGTGAAGATGG - Intronic
1022252857 7:28626409-28626431 TCATGGGATTGTTGTGAGGATGG - Intronic
1022854076 7:34298375-34298397 CCTTGGGCTTTGTGGGAAGAAGG - Intergenic
1022946806 7:35293819-35293841 CATTGGGGTTTTTGAGACGAAGG - Intergenic
1023258151 7:38332036-38332058 CATTGGGGTCCTTGTGAAGGAGG + Intergenic
1023448138 7:40253189-40253211 TCTAGTGGTTGTTGTGAAGATGG + Intronic
1024743622 7:52382621-52382643 CCTTGGGGTTATTGGGGAAAAGG - Intergenic
1026122936 7:67553244-67553266 CCTTGGGGACTTTGTGAAGCAGG + Intergenic
1027615089 7:80412716-80412738 CCCTGGGGTTTCTGAGAAGAAGG - Intronic
1029441625 7:100590009-100590031 GCTTGGGGTTGAAGAGAAGAGGG + Exonic
1030606880 7:111646992-111647014 GGTTGGGGTTGGTGAGAAGATGG + Intergenic
1031658398 7:124388009-124388031 AATGGGGGTTGTTGTTAAGAGGG + Intergenic
1033395055 7:140965587-140965609 ACATGGGGTTGTTGTGAAGATGG + Intergenic
1033438778 7:141359616-141359638 TCTTGGAGTTCTTGTGAATAGGG + Intronic
1036192491 8:6683128-6683150 GCCAGGGGTTGTGGTGAAGATGG - Intergenic
1040596595 8:48843817-48843839 TGTTGGTGTTGTTGTGAAGGTGG + Intergenic
1044451702 8:92342963-92342985 CCTTGGGTGAGTGGTGAAGAGGG + Intergenic
1045442997 8:102233622-102233644 CCTTTGGGGTGATGTGAAGAGGG - Intronic
1046904064 8:119553618-119553640 CCTCGTGGTGGTTGGGAAGAGGG - Intergenic
1048255777 8:132904175-132904197 CCACAGAGTTGTTGTGAAGATGG + Intronic
1048616524 8:136081022-136081044 CCTGGGGGAGGGTGTGAAGAAGG - Intergenic
1049309179 8:141924340-141924362 CCTTCAGGCTGCTGTGAAGACGG + Intergenic
1049559157 8:143299335-143299357 CCCTCCGGTTGTTGGGAAGAGGG + Intergenic
1049985881 9:950525-950547 CCAAAGGGTTTTTGTGAAGATGG + Intronic
1051148168 9:14051774-14051796 GCTGGGGGTTGTGGGGAAGAAGG + Intergenic
1052778865 9:32760128-32760150 CTTTAGGGTTGCTGTGAGGAGGG + Intergenic
1053020647 9:34691662-34691684 TCTTGGGCTGGTGGTGAAGAAGG + Intergenic
1053271493 9:36752562-36752584 CCTTGGGGTAGTTGTCAGAAAGG - Intergenic
1053473086 9:38360622-38360644 TCTGGGGGTTGTTGTGAGGAGGG - Intergenic
1056100665 9:83297927-83297949 CCTTGGGGTTGTTGGGCAGGAGG - Intronic
1056135837 9:83628749-83628771 CCTTGGGGTTGATGGGAACCAGG + Intronic
1056580010 9:87883637-87883659 CCATGGGGCTGTGGTGAAGGAGG - Intronic
1057151319 9:92798538-92798560 CCTTGGCGTTGTTCAGAAGGAGG + Intergenic
1057450920 9:95159187-95159209 CCTGGGGCTTGTTGTGGAGTGGG - Intronic
1057980509 9:99657484-99657506 CTTTGGGGTTGGGATGAAGAAGG - Intergenic
1061426606 9:130502560-130502582 TCTTGTTGTTGTTGTTAAGATGG + Intergenic
1061451263 9:130668052-130668074 TCCTGGGGCTGTTGTGAGGATGG + Intronic
1062381120 9:136287076-136287098 CCTTTTGGCTGTTGTGAATAAGG - Intronic
1186478384 X:9877163-9877185 CCTTGTGGTCGTTGAGAAGCTGG + Intronic
1190141241 X:47847187-47847209 TCATGAGGTTGTTGTGAAGATGG - Intronic
1192223577 X:69213591-69213613 CCTTGGGAGGGTTGTGAGGAGGG + Intergenic
1192775513 X:74240430-74240452 GCTTGGGGGTGATGTGAAGATGG + Intergenic
1194427300 X:93755289-93755311 CCATAGGTTTGTTGTGAGGATGG - Intergenic
1197798847 X:130328271-130328293 CTGTTTGGTTGTTGTGAAGAAGG - Intergenic
1198568848 X:137934072-137934094 CATTGGGGATGTGGTGAAAAGGG - Intergenic
1198683824 X:139207011-139207033 CCTTGGGGTTGTTGTGAAGATGG - Intronic
1200486845 Y:3779520-3779542 CCATGGGAGAGTTGTGAAGATGG + Intergenic