ID: 1198685065

View in Genome Browser
Species Human (GRCh38)
Location X:139220087-139220109
Sequence ATCTCTTTGCTGTAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198685065 Original CRISPR ATCTCTTTGCTGTAGATGGG AGG (reversed) Intronic
905978595 1:42201412-42201434 AACTCTTAGCTGTAAATAGGTGG - Intronic
907981889 1:59490821-59490843 ATCAGTTGGCTGTAGATAGGTGG + Intronic
908074531 1:60501122-60501144 ATCAATTGGCTGTAGATGTGTGG - Intergenic
909885406 1:80936014-80936036 ATCTCTTTGGTCTAGAAGGCTGG + Intergenic
910342693 1:86206006-86206028 ATCTCTTCCCTGAAGTTGGGAGG - Intergenic
910449684 1:87332263-87332285 CTGTCTTTCCTGGAGATGGGGGG + Intronic
910653237 1:89592530-89592552 ACATCCTTGCTGTATATGGGTGG - Intronic
911440858 1:97923755-97923777 ATCTGTTTGATGAAGTTGGGGGG - Intergenic
911647861 1:100354546-100354568 ATCTTTTTCCTGTAGATCAGTGG - Intronic
916343580 1:163763149-163763171 ATCAGATTGCTGTAGATGTGTGG - Intergenic
916600181 1:166285562-166285584 TTCTCTTTGCTGGGGATTGGAGG - Intergenic
920695393 1:208178195-208178217 AGCTCTTTGGAGTAGAGGGGAGG + Intronic
922003900 1:221509128-221509150 ATCAGATTGCTGTAGATGTGAGG - Intergenic
922158080 1:223055558-223055580 ATTTCTCTTCTGTGGATGGGTGG - Intergenic
924414462 1:243844818-243844840 AACTCATTGCTGTATATGGGAGG - Intronic
924482083 1:244444972-244444994 ATCAGTTTGCTGTGGCTGGGGGG - Intronic
924711377 1:246532562-246532584 ACCTCTTAGTTGTAGTTGGGGGG + Intergenic
924762312 1:246999721-246999743 ATATCCTTGCTCTAGATTGGTGG - Intronic
924867863 1:248005345-248005367 ATCAGTTAACTGTAGATGGGTGG + Intronic
1064091582 10:12389958-12389980 ATCTTTGTGCTGTGCATGGGAGG + Intronic
1064708089 10:18093657-18093679 ATTTCTTTGCTATAGATGATGGG + Intergenic
1069970241 10:72161758-72161780 ATCACTTGGCTGTAGGTGTGTGG - Intronic
1070774355 10:79101163-79101185 AGCTCTTTGCAGTAGGTGTGAGG + Intronic
1070971335 10:80569890-80569912 TTCTCTCTGCTGGAGATGGAAGG + Intronic
1071205473 10:83271183-83271205 ATCTCATTGCTGCTGGTGGGTGG + Intergenic
1072628294 10:97128425-97128447 AGCTCTTTGCTGAAGAGGAGTGG - Intronic
1073848326 10:107585477-107585499 AGCTCTTTGCTGTGGAGAGGGGG + Intergenic
1073948987 10:108785114-108785136 AGGTCTTTTCTGCAGATGGGAGG + Intergenic
1075990217 10:126831121-126831143 ATCTGTTGGCTGTAGATATGTGG - Intergenic
1080007583 11:27426103-27426125 AGCTCTTTGATTTAGATGGTTGG - Intronic
1080312702 11:30912981-30913003 TTCTCTTTCATGTGGATGGGTGG - Intronic
1080699385 11:34631584-34631606 ATCTCTTGGCAGGAGATGAGTGG + Intronic
1080726215 11:34901611-34901633 ACCTCTTACCTGCAGATGGGGGG + Intronic
1081617619 11:44600017-44600039 ATCTCTGGGCTGGAGAAGGGTGG + Intronic
1083724014 11:64619048-64619070 ATGTCTTTTCTGGAGCTGGGAGG + Intronic
1085457682 11:76674403-76674425 ATCTCTCTTCTGTAAAAGGGGGG - Intergenic
1086421055 11:86637672-86637694 AACTTTGTGCTGTAGGTGGGAGG + Intronic
1088069911 11:105769592-105769614 AATTCTGTGCTCTAGATGGGGGG + Intronic
1089570118 11:119402011-119402033 ATCAGTTGGCTGTAGATAGGTGG - Intergenic
1089768671 11:120786804-120786826 AAATATTTGCTGTAGGTGGGGGG - Intronic
1100859394 12:98788230-98788252 TTCTCTTTTCTAGAGATGGGGGG - Intronic
1102786851 12:115612041-115612063 TTATCTGTGCTGTGGATGGGAGG - Intergenic
1105423278 13:20272036-20272058 ATCTCTGTGCTGGAGATGGCAGG + Intergenic
1108673590 13:52716645-52716667 ATCTGATTGTTGTAGATGTGTGG + Intronic
1112035572 13:95493399-95493421 AACTCTTTTCTGGAGATGGGTGG - Intronic
1113215425 13:108035062-108035084 ATGTCTTTTCTGGAAATGGGTGG + Intergenic
1113423331 13:110186855-110186877 ATCTTTTTGCTTTGGATGGGAGG - Intronic
1114869681 14:26641123-26641145 ATCAGATTGTTGTAGATGGGTGG + Intergenic
1115198560 14:30828601-30828623 ATCTCTGTGCTGAGAATGGGTGG - Intergenic
1115644457 14:35358460-35358482 ATCTCTTTCCTGGTGCTGGGTGG - Intergenic
1116740796 14:48751572-48751594 TTCTCTTTCCTGTATATGTGGGG - Intergenic
1117315274 14:54566529-54566551 CTTTCTTTGCTGTCGTTGGGGGG + Intergenic
1117345547 14:54828169-54828191 AGCTCTTTGCTATGCATGGGAGG + Intergenic
1117834059 14:59783540-59783562 ATCTCTTTGCTGAAAATCAGAGG - Intronic
1119405290 14:74395033-74395055 ATCTCTTTTCTGCAGAAGTGAGG - Intergenic
1119883082 14:78116931-78116953 TTCTCTTGGCTGAAGGTGGGTGG + Intergenic
1120487827 14:85137273-85137295 AACTGCTTGCTGTAGAGGGGTGG - Intergenic
1202858475 14_GL000225v1_random:65353-65375 TTCTCCCTGCTGTAGATGCGTGG - Intergenic
1124008379 15:25812728-25812750 CTCTCTTGGCTGTGGAAGGGTGG + Intronic
1126688465 15:51268039-51268061 ATCTTTTTACTGTAGAGGTGGGG + Intronic
1127850569 15:62908544-62908566 ATATCTTTTCAGTAGCTGGGAGG + Intergenic
1129531386 15:76268175-76268197 TTTTTTTTGCTGTAGCTGGGAGG - Intronic
1130016697 15:80193015-80193037 CTCTCTTTGGTGCAGAAGGGTGG + Intergenic
1130838932 15:87679371-87679393 ATCTCTGTGTTTTAGATGGGAGG - Intergenic
1133456659 16:5948168-5948190 CTCTGTTTGCTATAGAGGGGAGG + Intergenic
1133951628 16:10399486-10399508 ATCACTTGGCTGTAGATACGTGG + Intronic
1134568875 16:15274589-15274611 ACCTCTTAGAAGTAGATGGGAGG - Intergenic
1134635652 16:15790000-15790022 ATGTCTTTGTTGTAAAAGGGAGG - Intronic
1134733560 16:16481773-16481795 ACCTCTTAGAAGTAGATGGGAGG + Intergenic
1134933940 16:18230509-18230531 ACCTCTTAGAAGTAGATGGGAGG - Intergenic
1135808531 16:25566470-25566492 ATGTCTTTTCTGGAAATGGGTGG - Intergenic
1135856507 16:26016019-26016041 ATCTCTTTGCTGTTGGAGGAAGG - Intronic
1140323185 16:73973813-73973835 TTCTCTGTGCGGTAGATGGAAGG - Intergenic
1140926034 16:79584562-79584584 AACTCTTTGCTGAAAATGGATGG + Intergenic
1144350628 17:14392170-14392192 ATCAGTTTGCTATAGATGTGTGG - Intergenic
1146977113 17:37122985-37123007 ATCTCCTTGGTGAAGATGGTAGG + Intronic
1148317899 17:46720320-46720342 ATCTCTTTGGCGTAGAAAGGAGG + Intronic
1148465856 17:47864927-47864949 ATCTCTTGGGTGTGGATAGGGGG - Intergenic
1149264619 17:54913956-54913978 ATCTTTTTGCTTAAGCTGGGTGG - Intronic
1150423125 17:65056316-65056338 ATCACGTTGCTGTAGATGGTGGG + Exonic
1150519688 17:65852929-65852951 ATCTCTTTGGTTTAGATATGTGG + Intronic
1151060986 17:71094268-71094290 ATCAGATGGCTGTAGATGGGTGG - Intergenic
1151448437 17:74182254-74182276 AGCTCCTTGCTGGAGCTGGGAGG - Intergenic
1151544755 17:74785961-74785983 ATCTTTTTTCTGTGGCTGGGTGG - Intronic
1152981948 18:286837-286859 ATCTCTATGCTGCAGATGTCAGG + Intergenic
1156175857 18:34545288-34545310 ATCCCTTTGCAGTAAAAGGGAGG + Intronic
1156383726 18:36587135-36587157 ATGTCTTTTCTGGAGATGGTGGG + Intronic
1163734803 19:18973119-18973141 AACTTTTGGCTGTAGATGGAGGG - Intergenic
1164149916 19:22541901-22541923 ATCTGTTTGCAGCTGATGGGAGG - Intergenic
1164397620 19:27879753-27879775 ACCCCTTAGCTGCAGATGGGGGG + Intergenic
927462217 2:23309171-23309193 ATCTCTTTTCTGGAGAAAGGTGG + Intergenic
927494201 2:23541578-23541600 ATCTCTTTGTTGTAGCTGGAAGG + Intronic
927506467 2:23618247-23618269 ATGTCTTTGTAGTAGATGGTGGG + Intronic
928475079 2:31617372-31617394 ATCTCTGGGCTGGTGATGGGAGG + Intergenic
929092997 2:38238434-38238456 ATATCATTGCTGTAGCTGGTGGG - Intergenic
929320290 2:40535421-40535443 TTCTCTTTTCTGTAGTTGTGTGG + Intronic
930014440 2:46960678-46960700 ATCTCTACTCTGTAAATGGGAGG + Intronic
931750810 2:65328229-65328251 ATCTCTTTGCTGGAGGTCTGAGG - Intronic
935438309 2:103061089-103061111 ATCAGATGGCTGTAGATGGGTGG - Intergenic
937029496 2:118726381-118726403 ATTTCTTTGCTGTGGCTGGTGGG + Intergenic
937467025 2:122142194-122142216 ATCAGTTTGATGTAGATGTGTGG + Intergenic
937981756 2:127619920-127619942 TTCTCTCTGCTGTGGAGGGGAGG + Intronic
939514649 2:143151556-143151578 ATCACTTAGATGTATATGGGAGG - Intronic
939625874 2:144476591-144476613 ATCTCATGGCTGTAGGTGGTAGG - Intronic
939831221 2:147073496-147073518 ATCACTTGGCTGTAGATATGTGG + Intergenic
939991463 2:148879940-148879962 ATTTCTTGGCAGTAGATGGATGG + Intronic
940976907 2:159956544-159956566 ATTTCTGTGCTGAAGAAGGGGGG - Exonic
942392295 2:175508279-175508301 ATCACATGGCTGTAGATGTGTGG - Intergenic
943002720 2:182349140-182349162 AGCTCTTTGCTGTGGATGCCAGG + Intronic
943124210 2:183776340-183776362 ATCAGATTGCTGTAGATGTGTGG + Intergenic
945421477 2:209642260-209642282 ATCTCTTGGTGGTGGATGGGGGG + Intronic
947777969 2:232729872-232729894 ATCTCTTTGGAGCTGATGGGAGG - Intronic
947820012 2:233062999-233063021 ATCTCTTTGCTTTAAATGACTGG - Intronic
948898665 2:240943987-240944009 TTCTAGTTGCTTTAGATGGGAGG + Intronic
1172826571 20:37793094-37793116 ATGTATTTGCTGTTGTTGGGTGG + Intronic
1173395256 20:42673223-42673245 AGCTCTGAGATGTAGATGGGAGG - Intronic
1173504498 20:43576224-43576246 ACATCTTGGCTGTAGAAGGGCGG - Exonic
1173985571 20:47259111-47259133 AGCTCTTTGCTGAAACTGGGTGG - Intronic
1174143761 20:48435923-48435945 AGGCCTGTGCTGTAGATGGGAGG - Intergenic
1175051006 20:56155396-56155418 ATGTCTTTGCAGTCCATGGGGGG - Intergenic
1175863941 20:62164551-62164573 AGCTCCTAGCTGTAGATAGGTGG + Intronic
1176721880 21:10400324-10400346 ATGTGTTTGCTGTTGATGGCGGG + Intergenic
1177244594 21:18506775-18506797 ATCAATTGGCTGTAGATGTGTGG + Intergenic
1179324530 21:40328318-40328340 ATCAGTTTGCTGTAAATGTGTGG - Intronic
1179539549 21:42075225-42075247 ATATTTTTGCTGGAGATGGGGGG + Intronic
1180303070 22:11053101-11053123 ATGTGTTTGCTGTTGATGGCGGG + Intergenic
1180583490 22:16864403-16864425 ATCAGTTAGCTGTAGATGTGTGG - Intergenic
1182961276 22:34477599-34477621 TTCTACTTGCTGTTGATGGGTGG + Intergenic
1184211328 22:43037248-43037270 ATGTGTTTGCTGTTGATGGCGGG - Intergenic
949160594 3:877026-877048 ATCTTTTTGTTGTTGTTGGGGGG + Intergenic
951311812 3:21135780-21135802 ATCTCTTTGTAGTAAATAGGAGG - Intergenic
952226719 3:31384356-31384378 ATCTCTCTGCTAAAGATGGTGGG - Intergenic
953854838 3:46493395-46493417 AGGTCTTTTCTGGAGATGGGTGG - Intergenic
956385869 3:68718633-68718655 ATCTCTTTGCTCTGCATGTGAGG - Intergenic
957728101 3:84094784-84094806 ATCTCTTGGCAGAACATGGGAGG - Intergenic
962374441 3:134848688-134848710 TTCTCTCTGCTGTAGTTGGTAGG + Intronic
965602562 3:170469484-170469506 CTTTCTTTTCTGTAGGTGGGGGG + Intronic
966872260 3:184298932-184298954 CGCTCACTGCTGTAGATGGGCGG - Exonic
969212509 4:5698717-5698739 ATCTCATTACTGTAGACTGGGGG - Intronic
970533607 4:17006730-17006752 ATCTCTTTGCTGCAGTTGAAAGG + Intergenic
971246952 4:24938061-24938083 ATTTCTTCTCTGTTGATGGGTGG + Intronic
971522892 4:27577469-27577491 ATATTTTTTCTGGAGATGGGTGG - Intergenic
973172283 4:47160689-47160711 ATCTATTTGCTCTATATTGGTGG + Intronic
973791862 4:54385289-54385311 TGCTCTTTGCTGGAGATGTGTGG - Intergenic
974884250 4:67796997-67797019 ATGTGTTTGCTGTTGTTGGGTGG + Intergenic
974895912 4:67938706-67938728 ATCTGATGGCTGTAGATGTGTGG + Intronic
975320779 4:73008308-73008330 ATCTATTTGTTGAAGATGGTGGG - Intergenic
976710003 4:88059966-88059988 ATGTCTTTCCTGTTGATGTGGGG - Intronic
978211099 4:106136211-106136233 TTCTGTTTACTGTAGATGGATGG - Intronic
978275908 4:106949387-106949409 ATCTCTTCTCTGTGGGTGGGTGG + Intronic
980291460 4:130851374-130851396 TTCTATTTGCTGTAGTTGGCAGG + Intergenic
981523497 4:145689711-145689733 ATCTGTTGGCTGTAGGTGTGTGG - Intronic
982275982 4:153637690-153637712 TTCTCTTTGCTGTGGTTGTGTGG + Intergenic
984328812 4:178289375-178289397 ATCTCATGGGTGTAGATGTGTGG - Intergenic
985817263 5:2136044-2136066 ATCTCTGGCCTGTAGATGGCGGG + Intergenic
986932792 5:12847953-12847975 ATCTGTTGGCTGTAGATGCATGG - Intergenic
989848051 5:46171245-46171267 ATCTCATGGTTGTAGATGTGTGG - Intergenic
994787207 5:104180229-104180251 AGATCTTTTCTGCAGATGGGAGG + Intergenic
995417466 5:111926488-111926510 AGATCTTTTCTGTAGATGGAAGG - Intronic
995668417 5:114571337-114571359 ATCAGTTTGCTGTAGATAGGTGG + Intergenic
997411435 5:133694131-133694153 ATGGCTTTGCTGGGGATGGGAGG - Intergenic
997598820 5:135125759-135125781 ATCTCTTTTCTGTAAAATGGGGG - Intronic
998062213 5:139127712-139127734 ATATCTTTATTGTAAATGGGAGG - Intronic
998419516 5:141970689-141970711 ATTTCTTTTCTGCAGATGGCAGG + Exonic
1001403616 5:171460996-171461018 ATCTCATTGCTTTAGAGAGGAGG + Intergenic
1001989475 5:176104482-176104504 CTCTCCTTGCTCAAGATGGGTGG - Intronic
1007738494 6:43996927-43996949 ATCTTTTTGGTGGGGATGGGGGG + Intergenic
1008048704 6:46877859-46877881 AGCTCTTTGCTGAAGATGAAAGG + Intronic
1008345664 6:50423394-50423416 ATCACTTTGCTGTAAATGTGTGG - Intergenic
1009643448 6:66367255-66367277 ATCAGATTGCTGTAGATGTGTGG - Intergenic
1010879073 6:81145573-81145595 ATGTGTTTGTTGTAGATGGGAGG - Intergenic
1011181070 6:84621641-84621663 ATCAGTTGGCTGTAGATGTGTGG - Intergenic
1012485464 6:99716692-99716714 ATGAGTTTGCTGTAGATGTGTGG + Intergenic
1013722014 6:113041653-113041675 ATCAGATTGCTGTAGATGTGTGG + Intergenic
1016044504 6:139467312-139467334 TTTTCTTTTCTGGAGATGGGGGG + Intergenic
1016206599 6:141474487-141474509 TTCACTTTGCTGGAGATGAGTGG - Intergenic
1021202152 7:17739503-17739525 ATCAGATTGCTGTAGATGTGTGG - Intergenic
1021297568 7:18927318-18927340 ATCTGATTGTTGCAGATGGGAGG - Intronic
1023023042 7:36027961-36027983 CCCTCCGTGCTGTAGATGGGAGG - Intergenic
1023548407 7:41343192-41343214 ATGTCTTTTCTGAAAATGGGTGG + Intergenic
1023730032 7:43182451-43182473 ATCAGTTGGCTGTAGATGTGTGG + Intronic
1025794796 7:64729543-64729565 ATCTCAGTGCTGTTGAGGGGTGG - Intergenic
1025868041 7:65404578-65404600 AGATCTTTCCTGTAAATGGGAGG + Intergenic
1028351098 7:89849692-89849714 ATGTCTTGGGTGTAGGTGGGTGG + Intergenic
1032162537 7:129521777-129521799 AGAACTTAGCTGTAGATGGGCGG - Intergenic
1034089023 7:148346938-148346960 CTCTCTTTGCTGTCTTTGGGAGG - Intronic
1036666762 8:10749783-10749805 ATCTGTTTGCTGTTGTTGGATGG + Intronic
1037580759 8:20244842-20244864 ATTTTTTTTCTGGAGATGGGAGG - Intergenic
1038496975 8:28010421-28010443 ATCTCTTTGCCCTAGCTTGGTGG - Intergenic
1039025599 8:33254573-33254595 TTCTCTTTTCTGTAGATGGAGGG + Intergenic
1039302838 8:36228570-36228592 ATCAGATGGCTGTAGATGGGTGG - Intergenic
1039338008 8:36615470-36615492 ATCAGTTGGCTGTAGATAGGTGG - Intergenic
1042171321 8:65994147-65994169 ATCTGTTGGTTGTAGATGTGTGG + Intergenic
1042203291 8:66302952-66302974 CTCTCTTTGCTATATATGTGTGG - Intergenic
1042491702 8:69406844-69406866 ATCACTTTACTGTATGTGGGTGG - Intergenic
1043297220 8:78681031-78681053 ATCCCTTTCCTGAAGATGAGGGG + Intronic
1045509052 8:102799373-102799395 ATCTGTTTGCTATAAATCGGAGG - Intergenic
1045713198 8:105010954-105010976 ATCTCTCTTCTGTGCATGGGAGG + Intronic
1050316486 9:4407137-4407159 ATGAGTTTACTGTAGATGGGTGG - Intergenic
1051605567 9:18914997-18915019 ATCTCTTCACTGTAGTAGGGAGG - Intergenic
1052761663 9:32598540-32598562 ATGAGTTTGCTGTAGATGTGTGG - Intergenic
1055415531 9:76078621-76078643 ATCAGATTGCTGTAGATGTGTGG + Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1062313363 9:135952114-135952136 ATCTGTCCGCTGCAGATGGGTGG + Intronic
1186612797 X:11154676-11154698 GTCTCTTTTCTGTACAAGGGAGG + Intronic
1189422586 X:40869680-40869702 ATCAGTTGGCTGTAGATGTGTGG + Intergenic
1190585932 X:51942071-51942093 ATCAGTTGGCTGTAGATGTGTGG - Intergenic
1191745765 X:64484891-64484913 ATCAGATTGTTGTAGATGGGTGG - Intergenic
1191843856 X:65531977-65531999 ATTTCTTTGTTGTAGAAGGGTGG - Intronic
1193352387 X:80478269-80478291 ACCTCTTAGCTGCAGGTGGGGGG + Intergenic
1193513032 X:82429436-82429458 ATCTCTTTCCTGAAGATTAGTGG + Intergenic
1194679563 X:96835745-96835767 TTCTCTGTGTTGTACATGGGAGG + Intronic
1196799466 X:119529736-119529758 ATCTGTTGGCTATAGATGCGTGG + Intergenic
1198685065 X:139220087-139220109 ATCTCTTTGCTGTAGATGGGAGG - Intronic
1199954053 X:152728072-152728094 GCCTCTTTGGTGTTGATGGGTGG + Exonic
1199955639 X:152740381-152740403 ACCTCTTTGGTGTTGGTGGGTGG - Intergenic
1201478722 Y:14413672-14413694 TTCTCTTTGCTCAGGATGGGAGG - Intergenic