ID: 1198687667

View in Genome Browser
Species Human (GRCh38)
Location X:139244715-139244737
Sequence TTGCCTCTTTCAGCTTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2688
Summary {0: 5, 1: 39, 2: 253, 3: 766, 4: 1625}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198687667_1198687674 26 Left 1198687667 X:139244715-139244737 CCATCAGAAGCTGAAAGAGGCAA 0: 5
1: 39
2: 253
3: 766
4: 1625
Right 1198687674 X:139244764-139244786 TGGAGGAAGTGCAGCCCTGCTGG No data
1198687667_1198687669 9 Left 1198687667 X:139244715-139244737 CCATCAGAAGCTGAAAGAGGCAA 0: 5
1: 39
2: 253
3: 766
4: 1625
Right 1198687669 X:139244747-139244769 TTCTCCCCTAGAGCCTCTGGAGG No data
1198687667_1198687668 6 Left 1198687667 X:139244715-139244737 CCATCAGAAGCTGAAAGAGGCAA 0: 5
1: 39
2: 253
3: 766
4: 1625
Right 1198687668 X:139244744-139244766 GATTTCTCCCCTAGAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198687667 Original CRISPR TTGCCTCTTTCAGCTTCTGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr