ID: 1198687668

View in Genome Browser
Species Human (GRCh38)
Location X:139244744-139244766
Sequence GATTTCTCCCCTAGAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198687667_1198687668 6 Left 1198687667 X:139244715-139244737 CCATCAGAAGCTGAAAGAGGCAA 0: 5
1: 39
2: 253
3: 766
4: 1625
Right 1198687668 X:139244744-139244766 GATTTCTCCCCTAGAGCCTCTGG No data
1198687665_1198687668 23 Left 1198687665 X:139244698-139244720 CCAAAGAATTCTGGCAGCCATCA No data
Right 1198687668 X:139244744-139244766 GATTTCTCCCCTAGAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198687668 Original CRISPR GATTTCTCCCCTAGAGCCTC TGG Intergenic
No off target data available for this crispr