ID: 1198687669

View in Genome Browser
Species Human (GRCh38)
Location X:139244747-139244769
Sequence TTCTCCCCTAGAGCCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198687667_1198687669 9 Left 1198687667 X:139244715-139244737 CCATCAGAAGCTGAAAGAGGCAA 0: 5
1: 39
2: 253
3: 766
4: 1625
Right 1198687669 X:139244747-139244769 TTCTCCCCTAGAGCCTCTGGAGG No data
1198687665_1198687669 26 Left 1198687665 X:139244698-139244720 CCAAAGAATTCTGGCAGCCATCA No data
Right 1198687669 X:139244747-139244769 TTCTCCCCTAGAGCCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198687669 Original CRISPR TTCTCCCCTAGAGCCTCTGG AGG Intergenic
No off target data available for this crispr