ID: 1198687670

View in Genome Browser
Species Human (GRCh38)
Location X:139244751-139244773
Sequence ACTTCCTCCAGAGGCTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198687670_1198687674 -10 Left 1198687670 X:139244751-139244773 CCCCTAGAGCCTCTGGAGGAAGT No data
Right 1198687674 X:139244764-139244786 TGGAGGAAGTGCAGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198687670 Original CRISPR ACTTCCTCCAGAGGCTCTAG GGG (reversed) Intergenic
No off target data available for this crispr