ID: 1198693995

View in Genome Browser
Species Human (GRCh38)
Location X:139316185-139316207
Sequence TGTAGGAATGTGCATACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198693995_1198693999 25 Left 1198693995 X:139316185-139316207 CCAACTGTATGCACATTCCTACA No data
Right 1198693999 X:139316233-139316255 CCTCCTGAAGACTTGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198693995 Original CRISPR TGTAGGAATGTGCATACAGT TGG (reversed) Intergenic
No off target data available for this crispr