ID: 1198699609

View in Genome Browser
Species Human (GRCh38)
Location X:139382716-139382738
Sequence GTAACCAGGTAACCAGCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198699602_1198699609 28 Left 1198699602 X:139382665-139382687 CCGCAGAGCAGGAGGCCTGGGTC No data
Right 1198699609 X:139382716-139382738 GTAACCAGGTAACCAGCAACCGG No data
1198699604_1198699609 13 Left 1198699604 X:139382680-139382702 CCTGGGTCTGCAGCTGTGGTTTA No data
Right 1198699609 X:139382716-139382738 GTAACCAGGTAACCAGCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198699609 Original CRISPR GTAACCAGGTAACCAGCAAC CGG Intergenic
No off target data available for this crispr