ID: 1198701296

View in Genome Browser
Species Human (GRCh38)
Location X:139400264-139400286
Sequence AGTTATCTGCAGAAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198701296_1198701298 -3 Left 1198701296 X:139400264-139400286 CCTTCCATTTTCTGCAGATAACT No data
Right 1198701298 X:139400284-139400306 ACTACTCTCCTTTTGAGAGACGG No data
1198701296_1198701303 25 Left 1198701296 X:139400264-139400286 CCTTCCATTTTCTGCAGATAACT No data
Right 1198701303 X:139400312-139400334 GGCCTGTTACTGGGCTTTGATGG No data
1198701296_1198701301 15 Left 1198701296 X:139400264-139400286 CCTTCCATTTTCTGCAGATAACT No data
Right 1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG No data
1198701296_1198701302 16 Left 1198701296 X:139400264-139400286 CCTTCCATTTTCTGCAGATAACT No data
Right 1198701302 X:139400303-139400325 ACGGCTCTTGGCCTGTTACTGGG No data
1198701296_1198701299 4 Left 1198701296 X:139400264-139400286 CCTTCCATTTTCTGCAGATAACT No data
Right 1198701299 X:139400291-139400313 TCCTTTTGAGAGACGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198701296 Original CRISPR AGTTATCTGCAGAAAATGGA AGG (reversed) Intergenic
No off target data available for this crispr