ID: 1198701301

View in Genome Browser
Species Human (GRCh38)
Location X:139400302-139400324
Sequence GACGGCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198701295_1198701301 16 Left 1198701295 X:139400263-139400285 CCCTTCCATTTTCTGCAGATAAC No data
Right 1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG No data
1198701296_1198701301 15 Left 1198701296 X:139400264-139400286 CCTTCCATTTTCTGCAGATAACT No data
Right 1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG No data
1198701297_1198701301 11 Left 1198701297 X:139400268-139400290 CCATTTTCTGCAGATAACTACTC No data
Right 1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198701301 Original CRISPR GACGGCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr