ID: 1198702240

View in Genome Browser
Species Human (GRCh38)
Location X:139409710-139409732
Sequence TTAAGGGTTTTTATCATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198702235_1198702240 -6 Left 1198702235 X:139409693-139409715 CCTTCTACCCTCAGTTTTTAAGG No data
Right 1198702240 X:139409710-139409732 TTAAGGGTTTTTATCATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198702240 Original CRISPR TTAAGGGTTTTTATCATAAA TGG Intergenic
No off target data available for this crispr