ID: 1198708936

View in Genome Browser
Species Human (GRCh38)
Location X:139480246-139480268
Sequence GTCAACAGGACTGAATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198708936_1198708939 -10 Left 1198708936 X:139480246-139480268 CCTGCTGATTCAGTCCTGTTGAC No data
Right 1198708939 X:139480259-139480281 TCCTGTTGACTAATCGGTTTGGG No data
1198708936_1198708941 0 Left 1198708936 X:139480246-139480268 CCTGCTGATTCAGTCCTGTTGAC No data
Right 1198708941 X:139480269-139480291 TAATCGGTTTGGGTTAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198708936 Original CRISPR GTCAACAGGACTGAATCAGC AGG (reversed) Intergenic
No off target data available for this crispr