ID: 1198708939

View in Genome Browser
Species Human (GRCh38)
Location X:139480259-139480281
Sequence TCCTGTTGACTAATCGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198708936_1198708939 -10 Left 1198708936 X:139480246-139480268 CCTGCTGATTCAGTCCTGTTGAC No data
Right 1198708939 X:139480259-139480281 TCCTGTTGACTAATCGGTTTGGG No data
1198708935_1198708939 -9 Left 1198708935 X:139480245-139480267 CCCTGCTGATTCAGTCCTGTTGA No data
Right 1198708939 X:139480259-139480281 TCCTGTTGACTAATCGGTTTGGG No data
1198708933_1198708939 28 Left 1198708933 X:139480208-139480230 CCTTTAAGGAGGAAGAGTTGCAA No data
Right 1198708939 X:139480259-139480281 TCCTGTTGACTAATCGGTTTGGG No data
1198708934_1198708939 -1 Left 1198708934 X:139480237-139480259 CCTGAAAGCCCTGCTGATTCAGT No data
Right 1198708939 X:139480259-139480281 TCCTGTTGACTAATCGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198708939 Original CRISPR TCCTGTTGACTAATCGGTTT GGG Intergenic
No off target data available for this crispr