ID: 1198714743

View in Genome Browser
Species Human (GRCh38)
Location X:139545073-139545095
Sequence TGGTGGTGATTAGCTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198714743_1198714750 17 Left 1198714743 X:139545073-139545095 CCACCCAGAGCTAATCACCACCA 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1198714750 X:139545113-139545135 GGTGAAGCTGAGAAGAATGAAGG 0: 1
1: 0
2: 2
3: 35
4: 374
1198714743_1198714751 20 Left 1198714743 X:139545073-139545095 CCACCCAGAGCTAATCACCACCA 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1198714751 X:139545116-139545138 GAAGCTGAGAAGAATGAAGGTGG 0: 1
1: 0
2: 3
3: 59
4: 624
1198714743_1198714748 -4 Left 1198714743 X:139545073-139545095 CCACCCAGAGCTAATCACCACCA 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1198714748 X:139545092-139545114 ACCATGCTGGAAAAAGACACAGG 0: 1
1: 0
2: 0
3: 29
4: 366
1198714743_1198714752 28 Left 1198714743 X:139545073-139545095 CCACCCAGAGCTAATCACCACCA 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1198714752 X:139545124-139545146 GAAGAATGAAGGTGGTGCATAGG 0: 1
1: 0
2: 3
3: 20
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198714743 Original CRISPR TGGTGGTGATTAGCTCTGGG TGG (reversed) Intronic
905357578 1:37395415-37395437 TGGTGCTGATTGGCTCTGGCAGG - Intergenic
906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG + Intronic
911693334 1:100860403-100860425 GGGAGGTGATTGGCTCTTGGGGG - Intergenic
912000809 1:104832550-104832572 TGGAGGTGATTAGATCATGGGGG - Intergenic
917170910 1:172173006-172173028 AGGTGGTGAATAGCTCTGGAAGG + Intronic
918433886 1:184490828-184490850 TAGTAATGATTATCTCTGGGTGG + Intronic
918613875 1:186522669-186522691 TGGAGGTGATTGGCTCATGGTGG + Intergenic
918622385 1:186620453-186620475 AGGTGGTGATTAAATTTGGGGGG + Intergenic
919898466 1:202025172-202025194 TGTTAGTGGTTATCTCTGGGTGG + Intergenic
920445111 1:206010425-206010447 TGGTGGTGGCTGGCACTGGGTGG + Intronic
921665418 1:217864615-217864637 TAATGGTGGTTATCTCTGGGTGG + Intronic
922176990 1:223204640-223204662 TGGTCGTGATGACCTCTGAGTGG + Intergenic
923231231 1:231988478-231988500 TGGTGGTGATTAGGTCACGAGGG + Intronic
1063427750 10:5963025-5963047 TGCTGGTGTTTAGGTCTGGTGGG + Intronic
1067202578 10:44186065-44186087 TGGTGGTATTTATCTGTGGGTGG + Intergenic
1069047810 10:63761641-63761663 GGGTGGTGAGTAGATCTGAGGGG - Intergenic
1071042746 10:81334306-81334328 TGGAGGTGATTGGATCTTGGGGG - Intergenic
1071592749 10:86891162-86891184 TGGTGGTGGTGGGCTCTGCGTGG + Intronic
1071737910 10:88322429-88322451 TGGGGGTGATTAGGTCATGGGGG + Intronic
1074858890 10:117494551-117494573 TGATGGTGATTATCAGTGGGTGG - Intergenic
1075722251 10:124593905-124593927 TGGTGTTCAATAGCTGTGGGAGG - Intronic
1076105661 10:127820816-127820838 TGGTGGTGACAAGATATGGGAGG - Intergenic
1076596452 10:131625586-131625608 TGGGGGTGATGAGGTCAGGGGGG - Intergenic
1076887119 10:133267994-133268016 TGGTGGGGACCAGCTCTTGGGGG + Exonic
1077187823 11:1243354-1243376 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077188206 11:1244854-1244876 TGGTGGTGGTCAGCACTGTGGGG - Exonic
1077188245 11:1245025-1245047 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077188778 11:1247125-1247147 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077189161 11:1248625-1248647 TGGTGGTGGTCAGCACTGTGGGG - Exonic
1077189199 11:1248796-1248818 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077402286 11:2365152-2365174 TGGAGGTGATTGGCTCATGGGGG - Intergenic
1077514739 11:2994599-2994621 TGGTGGTGTTTTTCTCTTGGTGG + Intergenic
1078130797 11:8612626-8612648 TGGTGGTGATCAGCACAGGTGGG + Exonic
1081899053 11:46612164-46612186 TGGTAGTGATTAGCTGGGTGTGG + Intronic
1083172575 11:60931727-60931749 TGGTGGAGAATAGCACTGGTGGG + Exonic
1085478289 11:76801599-76801621 TGGTGGAGATTAGGTATGAGTGG - Intergenic
1086581215 11:88401208-88401230 TAGTGGTGAATAGTTCTGTGTGG - Intergenic
1088274783 11:108073848-108073870 TGCTGGTGATGAGCTGTGGAGGG - Intronic
1088981508 11:114868453-114868475 TGGCTGTGAGTGGCTCTGGGAGG - Intergenic
1089523389 11:119080695-119080717 AGGTGGTGATAAGTTCTGAGTGG + Intronic
1092365086 12:7871221-7871243 TGGTGGTGAGCAGCTCCTGGAGG - Intronic
1092769219 12:11881632-11881654 GGGAGGTGATTAGGTCTTGGGGG - Intronic
1096467391 12:51854571-51854593 TACTGGTGGTTATCTCTGGGTGG - Intergenic
1098302095 12:69064603-69064625 TAATGGTGGTTATCTCTGGGTGG + Intergenic
1103332180 12:120161986-120162008 TGGTGCTGATGAGCTGTGGGAGG + Exonic
1104609882 12:130219388-130219410 TGGACGTGATCAGCACTGGGTGG + Intergenic
1105450408 13:20494379-20494401 TGGCGGTGGTTAGTTCTGGAGGG - Intronic
1107616663 13:42175349-42175371 TAATAGTGATTATCTCTGGGTGG - Intronic
1108503216 13:51086568-51086590 CGGTGATGATTATCTCTGGGTGG + Intergenic
1108529414 13:51315038-51315060 AGGTAGTGATTACCTGTGGGTGG - Intergenic
1108695093 13:52896087-52896109 TGGTGGAGCTTACCTCTGTGGGG - Intergenic
1109803256 13:67403997-67404019 TGGTTATCATTAGCTCTGAGGGG - Intergenic
1112697865 13:101970862-101970884 TGGTGGTGACAGGCTATGGGAGG - Intronic
1113062492 13:106338194-106338216 TGGAGGTGATTGGCTCATGGGGG + Intergenic
1117898707 14:60511739-60511761 TGGTGGTGATGGGTTCTGTGTGG + Exonic
1118926150 14:70191151-70191173 TGGTAGTGGTTATCTCTTGGTGG + Intergenic
1119178037 14:72583932-72583954 TGGTGGTGATTAGCAGAGGGTGG - Intergenic
1122801496 14:104232330-104232352 TGGTGGTGATATGCTCATGGTGG - Intergenic
1123875405 15:24618823-24618845 TGGAGGTGATTAGATCATGGAGG - Intergenic
1123920655 15:25067527-25067549 TGCTGGTGAGTGGCTCAGGGTGG + Intergenic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1125109432 15:36013741-36013763 GGGTGGAGAGTAGCTCTGGACGG + Intergenic
1126591761 15:50347134-50347156 GGGAGGTGATTAGCTCAGGTGGG - Intronic
1128506236 15:68274890-68274912 TAGTGTTGAATAGATCTGGGTGG - Intergenic
1130667685 15:85883665-85883687 TGGTGGTGATGAGGTGTGGTGGG + Intergenic
1131829579 15:96345434-96345456 TGGTGGTCATTGGGTCTGTGCGG - Intergenic
1132321850 15:100931123-100931145 TGGGGGTGATGAGCTCAGGAAGG - Intronic
1135129474 16:19840415-19840437 TAATAGTGATTATCTCTGGGTGG + Intronic
1136508531 16:30721861-30721883 TGGTGGTGATTAGCTCAGTCTGG + Intronic
1137783240 16:51115289-51115311 TGGGAGTGATTAGCTCTGTAGGG + Intergenic
1139048979 16:63099516-63099538 TGGTGGTGACAAAATCTGGGGGG + Intergenic
1141027269 16:80560347-80560369 TGGTGCTGGTTAGATCTGGGAGG - Intergenic
1141575550 16:84961278-84961300 TGGTGGTAATGGGCTCAGGGAGG - Intergenic
1142266483 16:89066329-89066351 GGGTGGTGAGCAGTTCTGGGAGG + Intergenic
1143602973 17:7961192-7961214 TGGTGGTGCACACCTCTGGGAGG + Intergenic
1144535676 17:16087679-16087701 TGGAGGTTATTAGCTTTGCGAGG + Intronic
1144718298 17:17449804-17449826 TGGTGGTGGTTATGTTTGGGAGG - Intergenic
1146617975 17:34371811-34371833 TAGTTGAGATTAGCTCTGGCTGG - Intergenic
1147386245 17:40084023-40084045 GGGTGGGGATGAGTTCTGGGAGG + Intronic
1151283830 17:73095705-73095727 TGGTGGGGCTTAGATTTGGGAGG - Intergenic
1153152654 18:2112201-2112223 GGTTAGTGATTGGCTCTGGGAGG - Intergenic
1158173730 18:54629411-54629433 TGGTGGTGGTTATCTCTCAGGGG - Intergenic
1161680172 19:5676216-5676238 TGGAGGTGATTAGCTGGGTGCGG - Intronic
1161734729 19:5984611-5984633 TGGTGGAGATGAGCTCAGGGAGG + Intergenic
1164027682 19:21367806-21367828 TGGTGGTGCCTAGTCCTGGGAGG - Intronic
1164634257 19:29781091-29781113 TGGTGGAGATGAGGTGTGGGTGG - Intergenic
1165424528 19:35738640-35738662 TGGGGGTGAGATGCTCTGGGAGG - Exonic
1168552535 19:57309594-57309616 GGGTGGTGATTAGATCATGGGGG + Intergenic
926094609 2:10073105-10073127 TGGTGCAGATGGGCTCTGGGGGG + Intronic
926882586 2:17563376-17563398 TGGGGGTGTTTAGCTATGTGTGG + Intronic
928154518 2:28864587-28864609 TGGTGATGATAAGGACTGGGAGG + Intronic
928658491 2:33477523-33477545 AGCTGATGATTAACTCTGGGAGG + Intronic
928688276 2:33772686-33772708 TGGGGATGATTACGTCTGGGTGG + Intergenic
929673752 2:43903552-43903574 TTGTGGTGATGTGCTCAGGGAGG + Intronic
931746097 2:65293227-65293249 TGTTGGTGGCTAACTCTGGGTGG - Intergenic
931920490 2:67009888-67009910 GGGAGGTGATTAGCTCATGGGGG - Intergenic
932635641 2:73385847-73385869 TGTTGGTGTCTCGCTCTGGGCGG - Exonic
933358220 2:81242345-81242367 AGGTGATGATTAGCTTTTGGGGG - Intergenic
934615719 2:95769431-95769453 TGGTGGTGCTGGGCTCTGGGAGG + Intergenic
934645178 2:96055126-96055148 TGGTGGTGCTGGGCTCTGGGAGG - Intergenic
934838582 2:97611215-97611237 TGGTGGTGCTGGGCTCTGGGAGG - Intergenic
935353712 2:102178255-102178277 TGGTGGTGAGCACATCTGGGAGG + Exonic
937490820 2:122365543-122365565 TGGGGGTGATTAGGTCTTGAGGG - Intergenic
937951608 2:127392177-127392199 TGGAGGTGATTGGCTCATGGGGG + Intergenic
938861038 2:135369976-135369998 TGGGGGTGTATAGCTCTGTGTGG - Intronic
939643444 2:144668205-144668227 TGTTGGTAATTAGCTCAGGGAGG + Intergenic
940289275 2:152062586-152062608 GGGAGGTGATTAGGTCTAGGTGG - Intronic
941901146 2:170679681-170679703 TGCTGCTGAGTAGCTCAGGGCGG + Intergenic
943153835 2:184148678-184148700 GGGTGGTGATTAGATCTCGGAGG - Intergenic
943511744 2:188835489-188835511 TGGTGGTGATTGGGGCTGGTGGG - Intergenic
944216271 2:197259313-197259335 TCTTAGTGTTTAGCTCTGGGAGG - Intronic
944331297 2:198469503-198469525 TGGGGGTGATTAGATCATGGGGG - Intronic
944407192 2:199398484-199398506 GGGTGGAGAATAGCTCTAGGGGG + Intronic
947866730 2:233402998-233403020 TGGTGGTGGTTAGCCTTGGGAGG + Intronic
947967350 2:234292255-234292277 TGGTGGTGATAAAGTCTGGAGGG + Intergenic
948277275 2:236718821-236718843 GGGAGGTGATTAGCGGTGGGAGG - Intergenic
1168983778 20:2029879-2029901 TGATTGTGATGATCTCTGGGTGG - Intergenic
1169806304 20:9562943-9562965 TGTCGGCGATGAGCTCTGGGTGG - Exonic
1170964179 20:21051979-21052001 TGGAGGTGGTGATCTCTGGGAGG + Intergenic
1172658083 20:36549096-36549118 TGGTGGTGAGCAGCTCCCGGAGG - Exonic
1175063111 20:56261781-56261803 TCGTGGTGATTAGTTCAGGCTGG - Intergenic
1175134583 20:56813445-56813467 GGGAGGTGATTAGCTCGTGGCGG - Intergenic
1175539520 20:59739633-59739655 TGGAGGTGATTGGATCAGGGAGG - Intronic
1179161147 21:38900436-38900458 TGGAGGTGATTTGCTCTTGAAGG + Intergenic
1179284873 21:39968640-39968662 TGGAGGTGATTAGGTCATGGGGG - Intergenic
1179983142 21:44906854-44906876 TGCTGGTTATTGGCTCTGGCTGG - Intronic
1181084722 22:20434476-20434498 TGGTGGGCATTAGCTCTGCTGGG - Intronic
1181592892 22:23895677-23895699 TGGCAGTGAGTGGCTCTGGGTGG - Intronic
1181779845 22:25184762-25184784 GGGTGGTGATTCGATCTTGGGGG + Intronic
1182069019 22:27450382-27450404 TGCTGTTAATTAGATCTGGGTGG - Intergenic
1182676688 22:32044385-32044407 TGGAGGTGATAAGCCCAGGGAGG + Intronic
1185331695 22:50254921-50254943 TGGTGGAGATGACCTCTGGCTGG - Intronic
949315998 3:2756283-2756305 TGGTGGTGATTAGGTCATGAGGG + Intronic
949474270 3:4428301-4428323 TTGTGATGATTATTTCTGGGTGG + Intronic
950305749 3:11914578-11914600 TGGTAATGATTTGCTGTGGGTGG - Intergenic
952907933 3:38155416-38155438 AGTTAGTGATTAGCTCTAGGGGG - Intergenic
953071225 3:39521954-39521976 TGGTGGTGAGTGGGTATGGGAGG + Intronic
954374899 3:50188951-50188973 TGGATGTAATTAGCTCTGGGGGG + Exonic
954594138 3:51810976-51810998 TGGTGAGGATGAGCTATGGGTGG - Intergenic
955484869 3:59425280-59425302 TGGTGGTAAGGAGCTCTGGGAGG - Intergenic
955636547 3:61036317-61036339 AGGGGGTGATTAGATCAGGGGGG - Intronic
961517385 3:127446413-127446435 TGGAGATGACAAGCTCTGGGTGG + Intergenic
962074282 3:132064377-132064399 TGGGGATGGTTAGATCTGGGTGG - Intronic
962391370 3:134975451-134975473 TGGTGGGAATTTGCTGTGGGGGG + Intronic
964658445 3:159093882-159093904 TGGAGGTGATTAGGTCATGGAGG - Intronic
965844346 3:172945033-172945055 TGATAGTGATTACCTCTGGAGGG + Intronic
966207319 3:177418299-177418321 TGGTGGTGATTACCCCGGGGGGG + Intergenic
966457346 3:180132882-180132904 TGCTGGTCAGTAGATCTGGGTGG + Intergenic
967277914 3:187794901-187794923 AGTTGGGGGTTAGCTCTGGGAGG - Intergenic
968628728 4:1639334-1639356 TTGTGGAGATCAGCTCCGGGTGG - Intronic
970034865 4:11721905-11721927 TAATAGTGATTATCTCTGGGTGG + Intergenic
970198727 4:13579660-13579682 TGATAATGATTAGCTCTGGAGGG - Intronic
970464394 4:16308175-16308197 TGGTGGTGATTGGCTCTGTGGGG - Intergenic
970962362 4:21887415-21887437 AGGAGGTGATTAGGTCTTGGGGG - Intronic
971294150 4:25374390-25374412 TAATAGTGATTATCTCTGGGTGG - Intergenic
971716170 4:30179694-30179716 TGGGGGTGATTAGGTCATGGTGG + Intergenic
972041456 4:34605912-34605934 TGGTGGAGATGAGATTTGGGTGG + Intergenic
972888052 4:43517530-43517552 GGGTGGTGATTAGATCATGGGGG - Intergenic
972930007 4:44060857-44060879 TGGTGGTGATTAGATCATGGGGG - Intergenic
973087389 4:46082611-46082633 TGGTGTTGATTAGCTTTGTTAGG - Intronic
973097263 4:46217842-46217864 TGGAGGTGATTAGATCTTGGGGG - Intergenic
973195042 4:47429951-47429973 TGGTGGTCCTCAGCTTTGGGTGG + Intergenic
973997733 4:56476329-56476351 TAGTAGTGTTTATCTCTGGGTGG + Intronic
974563713 4:63555629-63555651 GGGAGGTGATTAGATCTTGGGGG - Intergenic
977144321 4:93417591-93417613 AGGAAGTGATTATCTCTGGGTGG - Intronic
977189493 4:93981790-93981812 TGGTAGGGTTTGGCTCTGGGAGG - Intergenic
982211127 4:153037359-153037381 TAGTGGTTATTACCTCTGGGAGG - Intergenic
982547621 4:156754993-156755015 GGGAGGTGATTAGATCTTGGGGG + Intergenic
984056886 4:174941625-174941647 TGGTGGTGATTTGATCATGGGGG - Intronic
985902178 5:2805168-2805190 GGGAGGTGATTAGGTCAGGGGGG + Intergenic
986481957 5:8198492-8198514 TGGTGGTAAACAGATCTGGGTGG - Intergenic
989770595 5:45140079-45140101 GGGAGGTGATTAGATCTTGGGGG + Intergenic
994854452 5:105099047-105099069 AGGAGGTGATTAGCTCATGGGGG + Intergenic
996384354 5:122895431-122895453 TGGTGTGGATTATCTCAGGGGGG - Intronic
997732267 5:136190463-136190485 TGGTGGGTATTAGTTCTGGAAGG + Intergenic
998481950 5:142470121-142470143 TTGTGGTGGCTGGCTCTGGGTGG + Intergenic
1000456137 5:161451863-161451885 AGGTGGTGGTTATCTCTGTGTGG + Intronic
1001061441 5:168493132-168493154 TGGTGGTGATGAGTGCTGGGAGG + Intronic
1002558417 5:180062408-180062430 TGGTGGTGATTAGGTCATGAGGG - Intronic
1003516422 6:6822489-6822511 TGGCTGTGACTAGGTCTGGGAGG - Intergenic
1003663972 6:8092126-8092148 TGGGGGTGATTAGGTCCTGGAGG - Intronic
1003863571 6:10343674-10343696 TGGAGGTGATTAGGTCTTGAGGG - Intergenic
1003970222 6:11292017-11292039 AGATAGTGATTAGGTCTGGGTGG + Intronic
1007789184 6:44299224-44299246 AGATGGTGATGAGGTCTGGGGGG - Intronic
1011352770 6:86440727-86440749 TGATAGTGATTATTTCTGGGTGG - Intergenic
1013993597 6:116281156-116281178 TGGTGGAGAATAGGTGTGGGAGG + Intronic
1014993690 6:128114686-128114708 GGGAGGTGATTAGTTCTTGGGGG - Intronic
1015659090 6:135554009-135554031 TGATGGTGATTATCTCTAAGTGG - Intergenic
1017706000 6:157123313-157123335 TAGTACTGATTAGCTCTGGGCGG - Intronic
1018946732 6:168352529-168352551 TGGAGGTGATTAGATCTTGGGGG - Intergenic
1019513271 7:1429035-1429057 AGGTGGACATGAGCTCTGGGTGG - Intronic
1019779243 7:2929873-2929895 TGGTGGGGATGAGCTCTGGAGGG + Intronic
1020247810 7:6443691-6443713 TGGTGGTGAGGTGCACTGGGAGG - Intronic
1020866898 7:13575766-13575788 CAGTGGTAATTAGCTCTGAGAGG - Intergenic
1021382605 7:19985554-19985576 GGGTGGTGATTGGCTCAGAGGGG + Intergenic
1025775609 7:64558305-64558327 TGGTGGTGCCTAGTCCTGGGAGG + Intronic
1026011411 7:66639224-66639246 TGGTGGTGAGTAGCCCCGGTAGG + Exonic
1027430949 7:78112088-78112110 TGGAGGGGCTTAGCTCTGTGGGG + Intronic
1028795438 7:94896593-94896615 TGGAACTGACTAGCTCTGGGAGG - Intergenic
1029665575 7:101992966-101992988 TGGTCATGCCTAGCTCTGGGTGG + Intronic
1030750698 7:113227969-113227991 GGGAGGTGATTAGCTCATGGGGG + Intergenic
1031078294 7:117233622-117233644 TGCTGGTGATTGGATCTTGGGGG + Intergenic
1031447262 7:121870854-121870876 TGGTTCTGATGATCTCTGGGAGG - Intergenic
1033425148 7:141237586-141237608 TGACAGTGATTATCTCTGGGTGG + Intronic
1035299778 7:157889303-157889325 TGGTGGTGATTAGTTGAGAGGGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1037754702 8:21703331-21703353 TGGGGGTGAGGAGCTTTGGGAGG - Intronic
1038154508 8:24975938-24975960 TGGAGGTGATTAGATCATGGGGG + Intergenic
1039370553 8:36979968-36979990 AGGAGTTGATTAGCTCTGAGGGG - Intergenic
1044587794 8:93884232-93884254 TGCTGTGGATTAGCTCTGTGTGG + Intronic
1045031886 8:98144822-98144844 TGATGGTGGTTATCTCTGTGAGG + Intronic
1045754007 8:105520688-105520710 GGGTGGAGATTATTTCTGGGTGG + Intronic
1047278899 8:123427702-123427724 GGGAGGTAATTAGCTCTGTGTGG + Intronic
1047568036 8:126067770-126067792 GGGTGGTGGTTAGCTCTATGGGG - Intergenic
1048280516 8:133102382-133102404 TGGTGGTGAGTAGCTCCAGGGGG - Intronic
1050416367 9:5421418-5421440 TAGTGGTGATGAGTTCTGTGAGG - Intronic
1050687313 9:8186330-8186352 TCTTGGTGATAAGCTCTGGCTGG - Intergenic
1051894314 9:21972018-21972040 TGGTGGTTACTAGAGCTGGGGGG - Intronic
1051925080 9:22315831-22315853 TGGAGGTGATTAGATCATGGGGG + Intergenic
1052821315 9:33139748-33139770 TGGTGGGGAGAAGCTCTGGGAGG + Intronic
1055520103 9:77072060-77072082 TGAGGGTGATCAGCTCTGAGTGG - Intergenic
1055603270 9:77941997-77942019 TGAAAGTGATTATCTCTGGGTGG + Intronic
1055611420 9:78029990-78030012 TATTGATGATTATCTCTGGGAGG - Intronic
1056059147 9:82864650-82864672 AGGTGGTGTTGAGCTATGGGTGG - Intergenic
1056063913 9:82913829-82913851 TGGTGCTGGTGAGCTGTGGGTGG - Intergenic
1056753195 9:89366256-89366278 TGGTGGTAACTACCTCTGGATGG + Intronic
1057394587 9:94668519-94668541 GGGTAATGATTACCTCTGGGTGG - Intergenic
1057561413 9:96130767-96130789 TGATGGTGATTTGGTTTGGGTGG + Intergenic
1061462230 9:130749448-130749470 TGGAGGGGATAGGCTCTGGGAGG - Intronic
1187577731 X:20576229-20576251 TGGTGGTGATTAGGGTTGGTAGG - Intergenic
1188594678 X:31884470-31884492 TGGTGGTTATTAGATCCTGGGGG + Intronic
1191618720 X:63193128-63193150 TGAGGGTGATTAGTTCTGAGAGG - Intergenic
1191734565 X:64375579-64375601 AGGTGGTGATTAGCTCATGAGGG + Intronic
1194187713 X:90793705-90793727 GGAAGGTGATTAGCTCTAGGAGG - Intergenic
1194802410 X:98289466-98289488 TGATGGTGCTTTTCTCTGGGTGG + Intergenic
1195064574 X:101229072-101229094 TAGTAATGATTATCTCTGGGTGG + Intronic
1196920815 X:120583499-120583521 GGGAGGTGATTAGATCTTGGGGG + Intergenic
1197569377 X:128130571-128130593 TGGAGGTGATTAGATCATGGGGG + Intergenic
1198406575 X:136318762-136318784 TAATGGTGATTATCTCTGAGTGG + Intronic
1198564925 X:137894586-137894608 TGGAGGTGATTGGCTCATGGGGG - Intergenic
1198714743 X:139545073-139545095 TGGTGGTGATTAGCTCTGGGTGG - Intronic
1200534300 Y:4375657-4375679 GGAAGGTGATTAGCTCTAGGAGG - Intergenic
1202147830 Y:21818928-21818950 TGATGGTGTTTGGCTCTGGTGGG + Intergenic