ID: 1198715652

View in Genome Browser
Species Human (GRCh38)
Location X:139555461-139555483
Sequence CAGCGCCGTTCCGGAACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 14}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198715652_1198715664 24 Left 1198715652 X:139555461-139555483 CCTATGGTTCCGGAACGGCGCTG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1198715664 X:139555508-139555530 CCTAAAGCCAAAGGCACTGGCGG 0: 1
1: 0
2: 1
3: 10
4: 184
1198715652_1198715666 29 Left 1198715652 X:139555461-139555483 CCTATGGTTCCGGAACGGCGCTG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1198715666 X:139555513-139555535 AGCCAAAGGCACTGGCGGGCCGG 0: 1
1: 0
2: 1
3: 10
4: 159
1198715652_1198715667 30 Left 1198715652 X:139555461-139555483 CCTATGGTTCCGGAACGGCGCTG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1198715667 X:139555514-139555536 GCCAAAGGCACTGGCGGGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 166
1198715652_1198715665 25 Left 1198715652 X:139555461-139555483 CCTATGGTTCCGGAACGGCGCTG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1198715665 X:139555509-139555531 CTAAAGCCAAAGGCACTGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 171
1198715652_1198715660 15 Left 1198715652 X:139555461-139555483 CCTATGGTTCCGGAACGGCGCTG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1198715660 X:139555499-139555521 TTGCTACCTCCTAAAGCCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 124
1198715652_1198715662 21 Left 1198715652 X:139555461-139555483 CCTATGGTTCCGGAACGGCGCTG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1198715662 X:139555505-139555527 CCTCCTAAAGCCAAAGGCACTGG 0: 1
1: 0
2: 0
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198715652 Original CRISPR CAGCGCCGTTCCGGAACCAT AGG (reversed) Intronic
901594458 1:10373724-10373746 CACAGCCGTTCAGGAACCCTGGG + Intronic
1090540320 11:127695394-127695416 CTGCTCCATTCCTGAACCATTGG - Intergenic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1123942160 15:25221873-25221895 CAGGGTCGTACCGGGACCATGGG - Intergenic
1137597594 16:49735118-49735140 CAGAGCCGTTGCTGAACCTTAGG - Intronic
1138384480 16:56626736-56626758 CAGCTCTGTTCTGAAACCATAGG - Intronic
1142659919 17:1421164-1421186 CAGGGCCGTTCATGAACCACTGG - Exonic
1163637963 19:18446135-18446157 CAGGGCCGGGCCAGAACCATGGG + Intronic
932496296 2:72147441-72147463 CAGCGCGGTTCCGGGACCACTGG - Intronic
937066337 2:119020661-119020683 GAGCACCCTTCTGGAACCATGGG - Intergenic
1019471624 7:1224326-1224348 CAGCTCCGTTCCCGCCCCATCGG + Intergenic
1019625903 7:2015499-2015521 CAGCTCAGTTCCCGACCCATGGG - Intronic
1029913683 7:104183360-104183382 CAGCTCCGTTCTGGCACCAAGGG + Intronic
1036504512 8:9343254-9343276 CAGGGCTGTTCGGGAATCATAGG - Intergenic
1043815938 8:84801319-84801341 CAGCTCAGTTCATGAACCATCGG + Intronic
1198715652 X:139555461-139555483 CAGCGCCGTTCCGGAACCATAGG - Intronic