ID: 1198718419

View in Genome Browser
Species Human (GRCh38)
Location X:139588065-139588087
Sequence TATTAAGCAGAGTCACCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198718418_1198718419 7 Left 1198718418 X:139588035-139588057 CCATCATTATAGAGCAATGATTA 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1198718419 X:139588065-139588087 TATTAAGCAGAGTCACCTCATGG 0: 1
1: 0
2: 1
3: 5
4: 115
1198718416_1198718419 13 Left 1198718416 X:139588029-139588051 CCCATTCCATCATTATAGAGCAA 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1198718419 X:139588065-139588087 TATTAAGCAGAGTCACCTCATGG 0: 1
1: 0
2: 1
3: 5
4: 115
1198718417_1198718419 12 Left 1198718417 X:139588030-139588052 CCATTCCATCATTATAGAGCAAT 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1198718419 X:139588065-139588087 TATTAAGCAGAGTCACCTCATGG 0: 1
1: 0
2: 1
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198718419 Original CRISPR TATTAAGCAGAGTCACCTCA TGG Intronic
901258609 1:7854687-7854709 TATTAATCAGAGTCACCCTGAGG - Intergenic
907536141 1:55159845-55159867 GATTAAGCAGAGTCAGTTAAGGG - Intronic
908091954 1:60695832-60695854 GTTTAAGCAGAGTCACACCATGG - Intergenic
908283127 1:62563789-62563811 TATTCAGGAGACCCACCTCATGG + Intronic
908919659 1:69173938-69173960 TACTCAGCATAATCACCTCAGGG + Intergenic
916520098 1:165555901-165555923 TATTAAGCAGGCTCAGCTCTAGG + Intronic
918253679 1:182727590-182727612 TATTAAGCAAAGTAACCTTTCGG - Intergenic
922004992 1:221521355-221521377 TATTCTGGAGAGTCTCCTCAAGG + Intergenic
1063587486 10:7365688-7365710 TCTTAAGCATAGTGTCCTCAGGG - Intronic
1069608570 10:69757010-69757032 TCTCAAGGAGACTCACCTCAGGG + Intergenic
1070361741 10:75697107-75697129 TGTTCAGCAGAGTCACCTCAAGG + Intronic
1071700442 10:87927094-87927116 CATTAAACTGAGTCACTTCAGGG + Intronic
1071825187 10:89318308-89318330 TATTCAGGAGAGCCATCTCATGG + Intronic
1072201534 10:93163777-93163799 TATTTATCAGAGTTACTTCAAGG + Intergenic
1073661870 10:105484938-105484960 TATGAAGCAAAATCACCTGATGG - Intergenic
1076418390 10:130309154-130309176 CATTTAGCAGAGTCTCCTCTGGG - Intergenic
1078178386 11:8988249-8988271 TATTCTGCAGAGGCGCCTCATGG - Exonic
1078940035 11:15992521-15992543 AATTAAGGAGAGTGACCTCCTGG - Intronic
1079121800 11:17690871-17690893 TATAAAGTAGAATCACATCATGG - Intergenic
1090596058 11:128322502-128322524 CAGAAAACAGAGTCACCTCACGG - Intergenic
1090870029 11:130736138-130736160 TATTAACTACAGTCACCTGATGG + Intergenic
1091233234 11:134001829-134001851 TAATGAGCAGAGGCAGCTCAGGG - Intergenic
1095336867 12:41039050-41039072 TATGATTCAGATTCACCTCATGG - Intronic
1095862712 12:46936255-46936277 TATTAAGCATGGTCTCCTCTAGG + Intergenic
1101104955 12:101431460-101431482 TAATGAGCAGGGTGACCTCAAGG - Intergenic
1106970213 13:35131141-35131163 TATTAAACAGAGTAACGGCAAGG + Intronic
1114695273 14:24621621-24621643 TATTCAGGAGATTCATCTCACGG - Intergenic
1117237036 14:53789135-53789157 TATTTAGTAGACTCATCTCAAGG + Intergenic
1117870449 14:60195088-60195110 AATAAAACAGAGCCACCTCAGGG + Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1123482845 15:20650010-20650032 TATTAAACAGAGTAACGGCAAGG - Intergenic
1126232654 15:46344992-46345014 TACTAAGCAGAGCCAACTCCAGG + Intergenic
1140019144 16:71220679-71220701 TATTAAGAATAGTTACCTCTGGG + Intronic
1144760194 17:17702765-17702787 TATTAAGAGAAGCCACCTCATGG - Intronic
1154226222 18:12506923-12506945 TAGTGAGCAGAGTCACATAACGG - Intronic
1157332255 18:46712492-46712514 CATTCAGCAGAGTCAGCCCAGGG + Intronic
1163346803 19:16748510-16748532 TATTAATCAAAGACCCCTCAGGG - Intronic
930478301 2:51913518-51913540 TATTCAGGAGACTCATCTCATGG + Intergenic
936024433 2:109020711-109020733 TATAAACCACAGTCACCTCATGG - Intergenic
938949610 2:136244393-136244415 CACTCAGCAGAGTCCCCTCAAGG - Intergenic
940210228 2:151249178-151249200 TACAAAGCTGACTCACCTCATGG - Exonic
940917421 2:159272189-159272211 ATTAAAGCAGAATCACCTCAAGG + Intronic
941540321 2:166774035-166774057 TATTAAGCAAAGTCATCTGAAGG - Intergenic
943355913 2:186855256-186855278 TATTTAGCAGATTCATCTCTTGG + Intergenic
943530791 2:189077648-189077670 TAGTAAGCAGAGTGTCCTAAGGG - Intronic
943579768 2:189671685-189671707 TCTAAAGCAGAGACACCTTATGG + Intergenic
1168786085 20:541756-541778 TTTAAAGAAAAGTCACCTCACGG + Intronic
1169246446 20:4028709-4028731 TAGTAAGGAGAGTCACATGATGG - Intergenic
1169312506 20:4557280-4557302 TAATAATGAGATTCACCTCATGG - Intergenic
1171797574 20:29578273-29578295 TCTTAATCTGAGCCACCTCAAGG - Intergenic
1176744405 21:10638930-10638952 GATTAAGCAGAGTCAATTTATGG + Intergenic
1180156331 21:45979213-45979235 TGTGAAGCAGAGGCACCTCTGGG + Intergenic
1182065193 22:27426093-27426115 TATTAACCATAGTCACCTTGTGG - Intergenic
1182349457 22:29691085-29691107 AATGAAGCAGAAGCACCTCAGGG - Intronic
1184794090 22:46721528-46721550 TATTCAGCCGAGTCACCAAATGG + Intronic
1184907187 22:47496715-47496737 GATTAAACAGAGTCATCTCCTGG - Intergenic
957116517 3:76033868-76033890 TATTAAGGAGGGTAACCACACGG - Intronic
957891608 3:86365931-86365953 TATGAAACAGAGACACATCATGG + Intergenic
958154921 3:89744248-89744270 TATTAAGCAGTCTCATCTAATGG - Intergenic
958490022 3:94760880-94760902 TATTAAACAGTGTCTACTCAGGG + Intergenic
959186018 3:103049194-103049216 AATTATGCAAAGTAACCTCATGG + Intergenic
959421981 3:106139868-106139890 TATTTTGCAAATTCACCTCAGGG - Intergenic
962374262 3:134847137-134847159 TTTTAACCTGAGTCACCTCCGGG - Intronic
964131258 3:153289538-153289560 TAAAAAGCTGAGTCACTTCAGGG + Intergenic
967075188 3:185995558-185995580 CATTAAGCTGACTCACCTCTTGG + Intergenic
968752543 4:2397698-2397720 TTTTCAGCAGAGTGTCCTCACGG + Intronic
970788297 4:19826591-19826613 TTGTAAGCTGATTCACCTCACGG - Intergenic
971736171 4:30455610-30455632 TTTTAAGCAGAGTGATATCAGGG - Intergenic
972420168 4:38879314-38879336 CATGCTGCAGAGTCACCTCAAGG - Intronic
974279245 4:59770106-59770128 AAATAAGTAGAATCACCTCAAGG - Intergenic
978279351 4:106991432-106991454 TCTTAGGAAGAATCACCTCATGG - Intronic
978738602 4:112112619-112112641 AATTTAGCAGTGTAACCTCAGGG + Intergenic
979188281 4:117825850-117825872 AATTAAGCAGAGCTACCCCAGGG + Intergenic
979688455 4:123537521-123537543 TATGGAGCAGAGGCAGCTCATGG + Intergenic
985923185 5:2995543-2995565 TATTGTGCAGAGTCGGCTCAAGG + Intergenic
992190261 5:74285111-74285133 TATTAGGCAGTGTGGCCTCATGG - Intergenic
992392150 5:76339060-76339082 GTTTGAGCAGGGTCACCTCAAGG + Intronic
994132289 5:96244022-96244044 TCTTAAGCAGAGTGACGTTAAGG + Intergenic
995065548 5:107858011-107858033 TATTAAACTCAGTTACCTCAAGG + Intergenic
995227536 5:109718563-109718585 TATTAAACACACTCTCCTCATGG + Intronic
997402965 5:133616750-133616772 TATTATGATGGGTCACCTCAAGG + Intergenic
997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG + Intronic
1003544777 6:7050903-7050925 TATGAAGTTGAGTCACTTCAGGG - Intergenic
1005591196 6:27329356-27329378 TATTAAGGAGTGTAATCTCAGGG - Intergenic
1008793059 6:55262952-55262974 TATTAAGCATAAACACCTCTAGG - Intronic
1008845351 6:55956680-55956702 TATTTATCAGAATCACCTGAAGG - Intergenic
1011760920 6:90564310-90564332 TATTCAGGAGACTCATCTCACGG + Intronic
1013811699 6:114052055-114052077 TATCTAGCAGGGTCCCCTCAAGG + Intergenic
1015696877 6:135990415-135990437 TATTCATCAGAATCACCTGAAGG - Intronic
1016946984 6:149544609-149544631 TTCTAAGCAGAGTTACCTGAGGG - Intronic
1020149032 7:5667461-5667483 TTATCAGCAGAGTCACCTCCAGG - Intronic
1020740116 7:12005299-12005321 TAGCAAGCTGAGTCAGCTCAAGG + Intergenic
1021749682 7:23783615-23783637 GATGAAGCAGAGGCAGCTCAGGG - Exonic
1023527334 7:41118473-41118495 TTTTTGGCAGAGACACCTCAGGG + Intergenic
1033577427 7:142699420-142699442 AATTAAGCAGAGATAACTCAGGG + Intergenic
1033783684 7:144703842-144703864 CATTAAGCAGAGACACCTTGGGG - Intronic
1038892027 8:31736164-31736186 TCTGAAGCAGAGTGACCTGAGGG - Intronic
1041484788 8:58363256-58363278 GATTAAGCAGATTCATCCCAGGG + Intergenic
1042716824 8:71782977-71782999 TATAAAGCAGAGCCAGCACAAGG + Intergenic
1045785174 8:105912613-105912635 TAATAATCAGAATCATCTCATGG + Intergenic
1046318834 8:112543932-112543954 TATTTAGCATAGTGTCCTCAAGG - Intronic
1046403181 8:113734798-113734820 TATTCAGCAGAGTCATATCATGG + Intergenic
1046472229 8:114691247-114691269 TATTAAGGAGGGTAAACTCATGG - Intergenic
1048338704 8:133522630-133522652 TATCCAGCAGAGTCACCTGGTGG + Intronic
1049921006 9:364246-364268 TATTAAGAATAGTCACATTAGGG + Intronic
1049951886 9:653088-653110 TATTTAGCAACGTCAGCTCAAGG + Intronic
1051168194 9:14288570-14288592 TGTTAAGCAGAGTTTTCTCAGGG - Intronic
1053466192 9:38310402-38310424 TATCAAGCAGATTCAACGCAGGG - Intergenic
1056705638 9:88950406-88950428 TCTTGAGCAGAGTCAGGTCATGG - Intergenic
1057948037 9:99346846-99346868 AAATAAACAGAGTCACCTCCTGG - Intergenic
1058191013 9:101915624-101915646 TATTAAGCAAAGTACCCTCAGGG + Intergenic
1058371234 9:104270289-104270311 TATTTAGCAAATTTACCTCATGG - Intergenic
1061236888 9:129348564-129348586 CATTAACCAGAGTCATCTCCAGG - Intergenic
1185919241 X:4070952-4070974 TAAGAAGCAGAGTTACCTCATGG - Intergenic
1188398318 X:29713626-29713648 TATGAATCACAGTCACCTGAAGG - Intronic
1190362104 X:49659188-49659210 ATTTAAGCAGAATCACCTCTAGG + Intergenic
1190504012 X:51107971-51107993 TATTGAGAAGAGGGACCTCAAGG - Intergenic
1198718419 X:139588065-139588087 TATTAAGCAGAGTCACCTCATGG + Intronic
1201497039 Y:14599245-14599267 TATTAAGCAGTATGAACTCACGG + Intronic
1201922391 Y:19247488-19247510 TATTCAGTAGACCCACCTCATGG + Intergenic
1202341985 Y:23879527-23879549 TATTCAGGAGACTCATCTCATGG - Intergenic
1202528784 Y:25790558-25790580 TATTCAGGAGACTCATCTCATGG + Intergenic