ID: 1198719454

View in Genome Browser
Species Human (GRCh38)
Location X:139600158-139600180
Sequence CTGCTTAGATTGGGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198719446_1198719454 30 Left 1198719446 X:139600105-139600127 CCAGAATAGGCAAATCTATTGAA 0: 2
1: 26
2: 302
3: 1121
4: 2361
Right 1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198719454 Original CRISPR CTGCTTAGATTGGGGAAAAA AGG Intronic
900666689 1:3820408-3820430 CTGCTTCTATTGGGTAGAAAAGG + Intronic
901468089 1:9436079-9436101 ATGCTTAGTTTGGGGGGAAAGGG + Intergenic
901680234 1:10908894-10908916 CTCTTTAGTTTGGGGAAAACGGG - Intergenic
901725040 1:11235084-11235106 CTGCTATGACTGGGGAAAACAGG - Intronic
905523892 1:38622194-38622216 CTGCTAAGATAGGGGATGAAAGG - Intergenic
905934300 1:41811465-41811487 ATGCTTAGAATAGTGAAAAATGG - Intronic
906899259 1:49815649-49815671 CTGGTGAGAATGTGGAAAAAAGG - Intronic
907483897 1:54763800-54763822 CTGATTAGATTGGGGGGCAATGG - Intronic
907965587 1:59325451-59325473 CTGCTGAGGTTGGTAAAAAAGGG - Intronic
908020263 1:59891436-59891458 GTGATCTGATTGGGGAAAAATGG + Intergenic
908303707 1:62789251-62789273 CTGCATAGATTTTGAAAAAAAGG - Intronic
908710698 1:67011098-67011120 GGGCTTAGATTGGGCAAAATAGG - Intronic
911671847 1:100616378-100616400 GTGCATAGATGGGGGAGAAAAGG + Intergenic
911737816 1:101356826-101356848 CTGCTGAGAATGTGGAAAAAAGG - Intergenic
916062793 1:161112460-161112482 CTGCTCAGACTGGTGAAAAGTGG + Intronic
917179603 1:172281455-172281477 ATGCTTATGTTGGGGAAAATGGG - Intronic
919576744 1:199319524-199319546 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
920976749 1:210792967-210792989 CTACTTGGATAGGGGAAAAATGG + Intronic
921397008 1:214679283-214679305 CTGGTTAGATGGGGGAGAGAGGG - Intergenic
924900865 1:248397695-248397717 CTGCTGAGGTTGTGGAGAAAAGG + Intergenic
1063257873 10:4349197-4349219 CTGCTGGGATTAGAGAAAAATGG - Intergenic
1063794509 10:9496943-9496965 CTGTTGGGATTGGGTAAAAATGG + Intergenic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1069075185 10:64031830-64031852 CTACTTAGTTTGGCTAAAAATGG + Intergenic
1069234552 10:66054361-66054383 CTGATGAGAATGTGGAAAAAGGG - Intronic
1071405077 10:85322068-85322090 CTATTTAGATTGATGAAAAATGG + Intergenic
1071864475 10:89711980-89712002 CTGGTTTGATAGGTGAAAAATGG + Intronic
1075677625 10:124307106-124307128 TTGCTTAGAATGCGGAAAAAAGG - Intergenic
1075818303 10:125283567-125283589 CTGCTTAAAATGGGGAGTAAAGG - Intergenic
1075915640 10:126164091-126164113 CTGCTTAAATGAGGGAAACAGGG + Intronic
1078087783 11:8244531-8244553 CTAATTAGTTTGGGGAAGAAAGG + Intronic
1078548307 11:12262409-12262431 GAGCTTAGTGTGGGGAAAAAAGG - Intronic
1079879484 11:25907075-25907097 CTGGTGAGGTTGTGGAAAAAGGG + Intergenic
1080951669 11:37040926-37040948 ATGCTTAGGTTGGAGAAAACTGG - Intergenic
1081109432 11:39116384-39116406 TTGGTTAGATTGTGGAGAAAGGG + Intergenic
1081402106 11:42655510-42655532 CTGGTGAGGTTGTGGAAAAATGG + Intergenic
1085398649 11:76221247-76221269 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
1085914184 11:80865020-80865042 CTGATGAGATTGTGGAGAAAAGG + Intergenic
1087350515 11:97026071-97026093 CTGCTGAGAATGTGGAGAAAAGG + Intergenic
1095494861 12:42773501-42773523 CTTCTTAGATGGGAGAGAAATGG + Intergenic
1095541054 12:43308900-43308922 CTGATGAGGTTGGGGAGAAAAGG - Intergenic
1096334415 12:50742527-50742549 CTGTTTAGCATGGGGAAAAGTGG - Intronic
1096861902 12:54535195-54535217 CTGGTAAGATTGGGGAAAGGGGG + Exonic
1097007761 12:55931446-55931468 GTCCTTAGACTGGGGAAAATAGG + Intronic
1098536476 12:71599173-71599195 TTGCTTGGATGGGGGAAATAGGG - Intergenic
1100219066 12:92484206-92484228 CTACGTAGATTTGGGAAACAAGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101778866 12:107817739-107817761 CTGCTGAGATTTGGGAAACAAGG - Intergenic
1103104173 12:118208304-118208326 TAGCTTAGCTGGGGGAAAAAAGG + Intronic
1103221903 12:119253200-119253222 CTGCTATGTTTGGGGAAACAAGG - Intergenic
1103259984 12:119578425-119578447 CTGCTAAGTTTGGGGATAATTGG + Intergenic
1104594398 12:130110964-130110986 CTCCTTAGAGGGGGAAAAAAAGG - Intergenic
1106415526 13:29543217-29543239 CTACTTTCATGGGGGAAAAAAGG + Intronic
1106987070 13:35366666-35366688 CTGCTTACATTGGGGGAAAGAGG - Intronic
1107585652 13:41845328-41845350 CTGGCGAGATTGTGGAAAAAAGG + Intronic
1109398725 13:61796041-61796063 CTACTTATTTTGTGGAAAAAAGG - Intergenic
1110418614 13:75279358-75279380 CTGCAGGGATTGGGGAAAAGGGG + Intergenic
1111156145 13:84328963-84328985 CAGGGTAGACTGGGGAAAAAAGG - Intergenic
1111625814 13:90785267-90785289 TTGGCTAGATTAGGGAAAAAAGG - Intergenic
1112178126 13:97048934-97048956 CTGGCGAGATTGGGGAGAAAAGG - Intergenic
1113239334 13:108318872-108318894 CTGGTGAGATTGAGGAGAAAAGG - Intergenic
1114305004 14:21414800-21414822 CTGTTTTTAATGGGGAAAAATGG - Intronic
1115021095 14:28682712-28682734 TTGCTGAGATTGTGGAGAAAAGG - Intergenic
1115616640 14:35101638-35101660 CTAATTTGATAGGGGAAAAATGG + Intronic
1115659529 14:35478616-35478638 AAGCTTAGATGGGGGAAAAAAGG + Intergenic
1115890982 14:38028656-38028678 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1117855948 14:60033786-60033808 CTCCATAGATTGGAGAAAGAGGG - Intronic
1119373618 14:74169329-74169351 CTTCTTGGAATTGGGAAAAAGGG - Intronic
1119765340 14:77184158-77184180 CTGCCTTGATGGGGGAAACATGG + Intronic
1122558744 14:102595947-102595969 CTGCTTAGGTTGGCAAAACAAGG - Intronic
1126203379 15:46014904-46014926 CTGCTGAGATTAGGGGAATAAGG + Intergenic
1126464886 15:48952774-48952796 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1126975305 15:54171610-54171632 CTGGTGAGAATGTGGAAAAAAGG + Intronic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1129979645 15:79856151-79856173 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1130424499 15:83781926-83781948 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1133785942 16:8973421-8973443 CTGAAAAGAGTGGGGAAAAAGGG + Intergenic
1133931219 16:10233591-10233613 ATGCTTAGATTGGGACTAAAGGG + Intergenic
1135878463 16:26228106-26228128 ATGCTTGGATTGAGGAACAAGGG + Intergenic
1140159963 16:72479343-72479365 CCTCTAAGATTGGGGAACAAGGG + Intergenic
1141447591 16:84072013-84072035 CAGCTTAGATGGGGGTAAAACGG - Intronic
1143710489 17:8731262-8731284 CTGCTGAGGTTGTGGAGAAAAGG + Intronic
1144092264 17:11868751-11868773 CTGCTTGAGTTGGAGAAAAATGG - Intronic
1144279886 17:13715600-13715622 CTGCCTAGTTTGAGGAAAAGAGG - Intergenic
1146284871 17:31567649-31567671 ATGCTTAGATTGGAGGAAGAAGG + Intergenic
1149063870 17:52457352-52457374 CTGCTGAGGTTGTGGGAAAATGG + Intergenic
1149160228 17:53685013-53685035 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
1149948097 17:60953247-60953269 CTCCTTAGGTTGTGGAGAAAAGG - Intronic
1150582604 17:66488694-66488716 CTGCTTAGAATTGGGAATACTGG + Intronic
1153048691 18:880955-880977 CTGCATTGATTGGGAAGAAATGG + Intergenic
1154324802 18:13382175-13382197 CTACTTTGATTTTGGAAAAAAGG + Intronic
1156451698 18:37270122-37270144 CGGCTAAGTTTGAGGAAAAAAGG + Intronic
1156667464 18:39425384-39425406 CTGCTTGGATTGGGGCAAGGTGG + Intergenic
1160050032 18:75424720-75424742 CTGCTGAGATTGGGGAGGCAGGG - Intronic
1161531784 19:4793903-4793925 CTGCTGAGATGGGGGAAATCCGG + Exonic
1163071179 19:14843188-14843210 CTGCTGAGGTTGTGGAGAAAAGG + Intergenic
1163140298 19:15343354-15343376 ATGCTGAGATTGGGGAAAATGGG - Intergenic
1164420177 19:28084131-28084153 CTGGTGAGAATGTGGAAAAAAGG - Intergenic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1167838404 19:52094549-52094571 GAGCTTAGATGGGGGAAAAGAGG - Intronic
1168445355 19:56406917-56406939 CTCCTGAGGTTGGGGAAAGAAGG + Intronic
925265239 2:2562352-2562374 CTGCTTAATTTGGAGCAAAATGG - Intergenic
926277541 2:11416222-11416244 CTGCTTAGTTTAGGGATAATTGG - Intergenic
926898541 2:17722793-17722815 TTGCTGAGATAGGGGAAAAGTGG - Intronic
927020372 2:19010476-19010498 CTGCTTAGAATGAAGAAAAGAGG + Intergenic
927067054 2:19482566-19482588 CTGGTGAGAATGTGGAAAAAGGG - Intergenic
928842020 2:35620715-35620737 CTGCTTAGGTTGCCTAAAAAAGG - Intergenic
929033351 2:37669560-37669582 CTGCTCAGATTGAGGGAAAGAGG + Intronic
929122259 2:38493369-38493391 CTGCTTAGATTAAGTAGAAAGGG - Intergenic
929131471 2:38578289-38578311 CTAATTAGATTTGGGAAAATTGG - Intronic
929267622 2:39936958-39936980 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
931541813 2:63337640-63337662 CTGGTGAGATTGTGGATAAAGGG - Intronic
933361895 2:81297448-81297470 CTGATAAGTTTGGGTAAAAATGG - Intergenic
933498741 2:83085535-83085557 CTGCTTTGATCTGGGAGAAAGGG - Intergenic
935553079 2:104479018-104479040 CTGCTCATGTTGGGGAGAAATGG - Intergenic
936468900 2:112780191-112780213 TTGCTTATAATGGTGAAAAACGG + Intronic
938046832 2:128129072-128129094 CTGCATAGATTGGGAATAGAAGG + Exonic
938591549 2:132741847-132741869 GTAATTAGATTGGGGGAAAAAGG - Intronic
939801316 2:146713586-146713608 CTGGTGAGGTTGTGGAAAAAAGG + Intergenic
940374269 2:152939896-152939918 CTGGTGAGATTGCGGAGAAAAGG + Intergenic
941536454 2:166728135-166728157 ATGCTGAGATTGTGGAGAAAAGG + Intergenic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
942776785 2:179591303-179591325 GTTCTTAGATTAAGGAAAAATGG + Intronic
944453428 2:199868249-199868271 CTGATTATTATGGGGAAAAAAGG + Intergenic
945502602 2:210595432-210595454 CTGCTAAAATGGGGGAAATAAGG - Intronic
948428480 2:237902959-237902981 CAGCCTGGATTGGGGTAAAATGG - Intronic
948769310 2:240240240-240240262 CTGCTGAGGTAGGGGAAAGAGGG + Intergenic
949048932 2:241886736-241886758 CTGCAGAGAATGAGGAAAAATGG + Intergenic
1171895144 20:30751752-30751774 GTGCTGAGTTTGTGGAAAAAAGG + Intergenic
1175743879 20:61439873-61439895 ATGGTGATATTGGGGAAAAAAGG + Intronic
1177071514 21:16514504-16514526 CTGCTAAGACTGCGGGAAAAGGG - Intergenic
1179053011 21:37905318-37905340 CTGCTTTGATTGGGGGCAAGTGG - Intronic
1184971144 22:48021057-48021079 CTGCTAAGTTTGGGGAAATTTGG + Intergenic
949242380 3:1888393-1888415 CTGGTGAGAATGTGGAAAAAAGG + Intergenic
949364644 3:3267697-3267719 CTGCTTACATTTGGGACAAAGGG + Intergenic
949374828 3:3377412-3377434 CTCCATTGAGTGGGGAAAAAAGG - Intergenic
949388543 3:3533218-3533240 TTGCTTTGATAGGTGAAAAATGG + Intergenic
949587020 3:5451403-5451425 TTGGTTAGATTCGGGAAAAGAGG + Intergenic
949762831 3:7490566-7490588 GTGATTTGAGTGGGGAAAAATGG + Intronic
950821186 3:15760711-15760733 TAGCTGAGTTTGGGGAAAAAAGG + Intronic
952544223 3:34401187-34401209 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
952742402 3:36747416-36747438 GAGCTTATATGGGGGAAAAAAGG + Intergenic
953598461 3:44339184-44339206 CTTCTTAGAGTAGGGGAAAAAGG - Intronic
955747775 3:62157049-62157071 CTTCTCTGTTTGGGGAAAAAGGG - Exonic
957508445 3:81155876-81155898 CGGCTTAGCTTTGGGAAAGAAGG - Intergenic
957655550 3:83069546-83069568 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
958589486 3:96136293-96136315 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
958687656 3:97420657-97420679 TTCCTAAGAATGGGGAAAAAAGG + Intronic
959482752 3:106893500-106893522 CTGGTGAGATTGGGTAGAAAAGG + Intergenic
959789701 3:110344370-110344392 ATGCTTAGAATGGGGAGAACTGG + Intergenic
959831283 3:110865624-110865646 CTTCTTAGTTTGGGGAGAAGAGG + Intergenic
961986619 3:131141345-131141367 CTGCTCAGGATGGGGAAAAATGG + Intronic
962073940 3:132060691-132060713 CTGCTGAGGTTGTGGAAAAAAGG - Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962421380 3:135232195-135232217 CTCATTAGATTGAGGAAAATGGG + Intronic
963459959 3:145599568-145599590 ATGCTTAGATTGGGGATTCATGG - Intergenic
963750597 3:149175483-149175505 CTCCCTAAAATGGGGAAAAAGGG - Intronic
964360526 3:155891270-155891292 ATACTTAGATTTGGTAAAAATGG + Intronic
964493017 3:157257214-157257236 CTTCTTAGATCGGGAAGAAATGG + Intergenic
964890931 3:161533557-161533579 CTGCTTTGAATGGAAAAAAATGG - Intergenic
966666296 3:182475098-182475120 CTGCTTATATTAAGGAAATATGG - Intergenic
969061124 4:4436041-4436063 TTACTGAGATTGAGGAAAAAAGG - Intronic
969163595 4:5283438-5283460 TTCCTTAGATTTGGGAAATATGG - Intronic
970359473 4:15294048-15294070 TTGCTCAGATGGGGGCAAAAGGG + Intergenic
970637485 4:18024564-18024586 CTGTTTAGAAAGGAGAAAAATGG + Intergenic
971710929 4:30111631-30111653 CTGCCAAGAGTGTGGAAAAATGG + Intergenic
971868847 4:32209253-32209275 CTGCTGAGATTGTGGAGAAAAGG - Intergenic
972651828 4:41025363-41025385 CTGGTGAGATTGCGGAGAAAAGG + Intronic
973948256 4:55983421-55983443 CTGGTTAGATAGTGGAATAATGG - Intronic
974088008 4:57281697-57281719 CTGCTTGGATTGGGCACCAAGGG - Intergenic
974270063 4:59639110-59639132 CTGGTTAGGTTGTGGAGAAAAGG + Intergenic
974980700 4:68953881-68953903 GAGCTTATATTTGGGAAAAAAGG - Intergenic
975114302 4:70662050-70662072 CTGCTTAGAACAGGAAAAAAAGG + Intronic
975474117 4:74802788-74802810 CTGCTTAGGGTGGGGATAACAGG + Intergenic
975767833 4:77687677-77687699 CTGGTTAGAGTAGGGAAAGAGGG - Intergenic
975971169 4:80039641-80039663 CTGGTGAGGTTGTGGAAAAAAGG + Intronic
977180066 4:93863199-93863221 CTGGTAAGAATGTGGAAAAAAGG + Intergenic
977367596 4:96090675-96090697 CTGCTGAGGTTGTGGAGAAAGGG + Intergenic
977442526 4:97087278-97087300 CTGCATAGACTGGGGAATACTGG - Intergenic
977578430 4:98699321-98699343 CTTCTAAGATTGGGAGAAAAGGG - Intergenic
977695612 4:99961786-99961808 CAGCTTAGCTGGGGAAAAAAGGG - Intergenic
977775127 4:100908855-100908877 TTGCTTTGATTGGAGTAAAATGG + Intergenic
977796959 4:101177502-101177524 CTGTTAAGCTTGGGAAAAAAAGG + Intronic
978365470 4:107976694-107976716 CTGCTTCTAGAGGGGAAAAAAGG - Intergenic
978637386 4:110825619-110825641 CTGGTAAGATTGTGGAGAAAAGG - Intergenic
979012055 4:115384613-115384635 CTGGTTAGGTTGCAGAAAAAAGG - Intergenic
979072457 4:116225705-116225727 CTGGTTAGGTTGTGGACAAAAGG + Intergenic
981116439 4:140996110-140996132 CTGATGAGGATGGGGAAAAAGGG - Intronic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982851777 4:160326500-160326522 CTGGTAAGATTGTGGAGAAAAGG - Intergenic
982956905 4:161781644-161781666 CTGCATGTGTTGGGGAAAAAGGG - Intronic
983166343 4:164481748-164481770 CTGCTCAGCTTGGGGGAAAAAGG + Intergenic
983624831 4:169791863-169791885 CTGCTTAGATCAGGGAAAACTGG + Intergenic
986157231 5:5188513-5188535 ATGATTAGCTTGGGGAAAAATGG - Intronic
986532325 5:8751389-8751411 CTGATGAGATTGTGGATAAAAGG + Intergenic
987354471 5:17050734-17050756 CTGCTGAGATTGTGGAGACAAGG + Intergenic
988056411 5:26103381-26103403 CTGGTGAGGTTGGGGAGAAAAGG + Intergenic
988419612 5:30989384-30989406 ATGCTTAGTTTGAGGAAGAATGG + Intergenic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
989403261 5:41032211-41032233 CTGCTAAGGTTGTGGAGAAAAGG - Intronic
989468686 5:41789099-41789121 TTGCTTATATTAGAGAAAAAAGG + Intronic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
991410217 5:66338415-66338437 CTGCTTAGACCGGGGAAAGGTGG + Intergenic
991974284 5:72171131-72171153 CTGCTCAGAATAAGGAAAAAGGG + Intronic
993562703 5:89431103-89431125 ATCCTTAGGTGGGGGAAAAAAGG + Intergenic
993631281 5:90288503-90288525 CTGCTGAGACTGTGGAGAAAAGG - Intergenic
993923563 5:93837644-93837666 CTGGTGAGATTGGGGAGAAAAGG - Intronic
994735861 5:103555080-103555102 CTGTTAAGATTGGGGGAAGAAGG - Intronic
996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG + Intergenic
997022278 5:130015594-130015616 CTGGTGAGATTGTGGAGAAAGGG + Intronic
998380993 5:141725318-141725340 ATGCTTAGATGTGGGAACAAAGG - Intergenic
1000104448 5:158045497-158045519 CAGCTTAGTTAGGGGAAAGAGGG - Intergenic
1000497093 5:161997936-161997958 ATGCTTATCTTGGGGAAAATGGG + Intergenic
1000703550 5:164482944-164482966 CTGCTTAGATGTGGAAAGAAAGG - Intergenic
1002844346 6:933957-933979 CTGTTTAGACTGCGGAGAAATGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003929603 6:10911176-10911198 ATGCCTAGACTGGGGTAAAAAGG + Intronic
1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG + Intronic
1007024897 6:38561217-38561239 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1007506088 6:42336598-42336620 GGGCTTAGAGTGGGGAAAGAGGG - Intronic
1008189134 6:48432860-48432882 CTGTTTAGAAAGAGGAAAAATGG - Intergenic
1010995365 6:82525681-82525703 CTGCTTTGTTTGGGAGAAAATGG + Intergenic
1012537025 6:100311510-100311532 TTGCTAAGCTTGGGGTAAAATGG - Intergenic
1012559215 6:100558314-100558336 CTGCTTTGATTAGGAAGAAATGG + Intronic
1012656586 6:101830724-101830746 CTGGTGAGGTGGGGGAAAAAAGG + Intronic
1013639798 6:112062359-112062381 CTGCCTAGCTTGGGAAAAATGGG - Intronic
1013733930 6:113204369-113204391 CTACTAAGAATAGGGAAAAATGG + Intergenic
1013958762 6:115872330-115872352 ATGCTTTGAGTGAGGAAAAATGG - Intergenic
1015692200 6:135937662-135937684 CAACCTAGATTTGGGAAAAAGGG - Intronic
1015738639 6:136428936-136428958 CTGCTAAGATTGTAGAGAAAGGG - Intronic
1018161720 6:161051078-161051100 CTGTATAGTTTGGGGAATAATGG + Intronic
1020404053 7:7811673-7811695 ATGCTTTGATAGGGGAGAAAGGG + Intronic
1020901192 7:14005477-14005499 CGGCTTACTTTGGGGAAGAAGGG - Intergenic
1020995973 7:15264788-15264810 CTGGTGAGACTGGGGAGAAAAGG + Intronic
1023707699 7:42959518-42959540 CTATTTAGAGTGAGGAAAAATGG + Intergenic
1024689316 7:51782018-51782040 CTTCTGAATTTGGGGAAAAAAGG + Intergenic
1025776987 7:64568884-64568906 CTGCATATATTGGGGAAGCAGGG + Intergenic
1025997669 7:66538231-66538253 CTGCATACACTGGGGAAAAGGGG - Intergenic
1026937487 7:74266748-74266770 CAGCTTAGAATGGGGGAAGAGGG + Intergenic
1026990046 7:74579882-74579904 CTGCATACAGTGGGGAAAAGGGG + Intronic
1026990547 7:74582742-74582764 CTGCATACAGTGGGGAAAAGGGG - Intronic
1027551455 7:79602257-79602279 CTTCATAGATTTGAGAAAAAAGG - Intergenic
1027965132 7:84994598-84994620 ATGCTTAAATTGAGGAAAGAGGG - Intergenic
1028216268 7:88137569-88137591 CTGGTTAGATAGAGAAAAAAGGG - Intronic
1028262861 7:88686219-88686241 TTTCTTAGATGGGAGAAAAAAGG - Intergenic
1029630999 7:101750051-101750073 CTGTTTATAATGGTGAAAAATGG + Intergenic
1030408898 7:109149243-109149265 CTGGTGAGAATGAGGAAAAAGGG - Intergenic
1030695888 7:112584719-112584741 TTGTTTAGATTGGGGAGCAAAGG + Intergenic
1031109612 7:117592236-117592258 CTGGAGAGTTTGGGGAAAAAAGG + Exonic
1032142891 7:129349824-129349846 CTGCTTTGTTTTGGGAAAAGGGG + Intronic
1032660775 7:133981607-133981629 CTGGTAAGGTTGTGGAAAAAAGG + Intronic
1033197558 7:139340788-139340810 TTGTTTAGAAAGGGGAAAAAAGG - Intronic
1033482805 7:141758920-141758942 TGAGTTAGATTGGGGAAAAAGGG - Intronic
1035130079 7:156643350-156643372 ATGCTTATTTTGGGGAGAAAGGG - Intronic
1037406498 8:18548004-18548026 CTAATCAGATGGGGGAAAAAAGG - Intronic
1037617579 8:20533511-20533533 CTGCTGTGATGGGGGAAGAAGGG - Intergenic
1037728981 8:21507476-21507498 AGGCATAGAGTGGGGAAAAAGGG + Intergenic
1037995935 8:23352416-23352438 CTGGGTGGTTTGGGGAAAAAAGG - Intronic
1038378637 8:27070402-27070424 CTGATGAGATTGGAGTAAAAAGG + Intergenic
1042796253 8:72666322-72666344 CTGCTTAAAAGAGGGAAAAAAGG + Intronic
1043167112 8:76916973-76916995 CTGCTCAGATATGGGAAAAGGGG - Intergenic
1043189128 8:77194928-77194950 CTGGTGAGGTTGTGGAAAAAAGG + Intergenic
1044063602 8:87670474-87670496 CTATTAAGATTAGGGAAAAAAGG + Intergenic
1044189605 8:89299446-89299468 ATGCTTATATTGGGGAAAAAGGG + Intergenic
1044542403 8:93422490-93422512 CTGTTTATGTTGGGGAAGAATGG + Intergenic
1046117666 8:109803621-109803643 TTGGTTACTTTGGGGAAAAAGGG + Intergenic
1046736425 8:117780959-117780981 CTGGTGAGGTTGTGGAAAAAAGG + Intergenic
1048047887 8:130790673-130790695 CAGCATAGATGGGGGTAAAATGG - Intronic
1048101336 8:131355357-131355379 CTGCTGAGGTTGTGGAGAAAAGG - Intergenic
1050766123 9:9136508-9136530 CTACTTAGATTCTAGAAAAAAGG + Intronic
1052063091 9:23985105-23985127 CTGGTGAGAATGTGGAAAAAAGG - Intergenic
1052065456 9:24013290-24013312 TTGCCAAGAGTGGGGAAAAAGGG - Intergenic
1054353507 9:64041015-64041037 GTGCTGAGTTTGTGGAAAAAAGG - Intergenic
1055225747 9:73992539-73992561 CTGATGAGGTTGTGGAAAAAAGG + Intergenic
1055728950 9:79261112-79261134 CTGGTTGGATTTGGGGAAAAGGG - Intergenic
1056074239 9:83022047-83022069 CTGCTTAGGTTGGGGGTAAGAGG - Intronic
1057970100 9:99546711-99546733 CTGCTGAGAATGTGGAGAAAAGG - Intergenic
1058252854 9:102723382-102723404 CTGCTGAGAATGTGGAGAAAGGG + Intergenic
1058809172 9:108622746-108622768 TTGGTTAAAGTGGGGAAAAAGGG - Intergenic
1059806058 9:117801884-117801906 CTGCTAAGAGTAGGGAAAGAGGG + Intergenic
1060138709 9:121184501-121184523 CTGTTTGGAAGGGGGAAAAAGGG - Intronic
1061377712 9:130235999-130236021 CTGCTTAGATCATGGAAAATCGG - Exonic
1185816123 X:3157559-3157581 ATCCTTATAGTGGGGAAAAAGGG + Intergenic
1185891605 X:3827180-3827202 CTGCCAGGGTTGGGGAAAAAGGG + Intronic
1185896716 X:3865595-3865617 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1185901834 X:3904022-3904044 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1186739267 X:12500087-12500109 TTGCTCAGGTTGGAGAAAAAGGG - Intronic
1188295874 X:28447631-28447653 CTGGTGAGATTGGGAGAAAAGGG + Intergenic
1188378064 X:29457336-29457358 CTACTTAGGGTGGGGAAGAAGGG - Intronic
1188393493 X:29651129-29651151 TTGGTTAGATTGTGGAGAAAAGG + Intronic
1188859216 X:35237266-35237288 TTGGTGAGATTGTGGAAAAAAGG + Intergenic
1189261585 X:39682750-39682772 CTGCTTCTAATGGGGAAATACGG + Intergenic
1190682748 X:52842098-52842120 CTGGTTAGTTTAGGGAAAAAAGG + Intergenic
1190999292 X:55643076-55643098 CTGGTTAGTTTAGGAAAAAAAGG + Intergenic
1192901401 X:75501590-75501612 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1193259194 X:79385576-79385598 CTGGTGAGATTGTAGAAAAAAGG + Intergenic
1193523758 X:82563365-82563387 CTGCTAAGGTTGTGGAGAAAAGG + Intergenic
1194395870 X:93385452-93385474 CTGCTGAGAATGTGGAGAAAAGG - Intergenic
1195936612 X:110131559-110131581 CTGCTTAGGTAGTGGAACAAGGG - Intronic
1197152970 X:123240089-123240111 CTGCTTTGATTGGGAACAGATGG - Intronic
1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG + Intronic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199908063 X:152255799-152255821 CTGCTCAGATTGGTGGACAACGG - Exonic
1199974489 X:152884966-152884988 CTGCTCAGCTTGGGAAAAAGGGG - Intergenic