ID: 1198725112

View in Genome Browser
Species Human (GRCh38)
Location X:139668395-139668417
Sequence CCGTGAGATGGAACTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198725112_1198725117 8 Left 1198725112 X:139668395-139668417 CCTGGAGCAGTTCCATCTCACGG No data
Right 1198725117 X:139668426-139668448 TAACTCCTTATGTTTGTTTCAGG No data
1198725112_1198725120 26 Left 1198725112 X:139668395-139668417 CCTGGAGCAGTTCCATCTCACGG No data
Right 1198725120 X:139668444-139668466 TCAGGCTTTGAGAAGATAGAGGG No data
1198725112_1198725119 25 Left 1198725112 X:139668395-139668417 CCTGGAGCAGTTCCATCTCACGG No data
Right 1198725119 X:139668443-139668465 TTCAGGCTTTGAGAAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198725112 Original CRISPR CCGTGAGATGGAACTGCTCC AGG (reversed) Intronic