ID: 1198725866

View in Genome Browser
Species Human (GRCh38)
Location X:139676295-139676317
Sequence GAGGGTGAACTGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2473
Summary {0: 4, 1: 175, 2: 458, 3: 742, 4: 1094}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198725866_1198725875 24 Left 1198725866 X:139676295-139676317 CCACCCTGCTTCAGTTCACCCTC 0: 4
1: 175
2: 458
3: 742
4: 1094
Right 1198725875 X:139676342-139676364 AAGTCCCAGTGAGATGAACCAGG 0: 32
1: 768
2: 1125
3: 1547
4: 3239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198725866 Original CRISPR GAGGGTGAACTGAAGCAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr