ID: 1198731326

View in Genome Browser
Species Human (GRCh38)
Location X:139733129-139733151
Sequence GAGGACTCTGTAGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198731326_1198731330 6 Left 1198731326 X:139733129-139733151 CCTGTTTTTCCTACAGAGTCCTC 0: 1
1: 0
2: 2
3: 17
4: 231
Right 1198731330 X:139733158-139733180 AAGATAGGCTAAATTTTACCTGG 0: 1
1: 0
2: 2
3: 6
4: 159
1198731326_1198731331 7 Left 1198731326 X:139733129-139733151 CCTGTTTTTCCTACAGAGTCCTC 0: 1
1: 0
2: 2
3: 17
4: 231
Right 1198731331 X:139733159-139733181 AGATAGGCTAAATTTTACCTGGG 0: 1
1: 1
2: 1
3: 12
4: 161
1198731326_1198731332 12 Left 1198731326 X:139733129-139733151 CCTGTTTTTCCTACAGAGTCCTC 0: 1
1: 0
2: 2
3: 17
4: 231
Right 1198731332 X:139733164-139733186 GGCTAAATTTTACCTGGGTAAGG 0: 1
1: 0
2: 2
3: 12
4: 107
1198731326_1198731328 -9 Left 1198731326 X:139733129-139733151 CCTGTTTTTCCTACAGAGTCCTC 0: 1
1: 0
2: 2
3: 17
4: 231
Right 1198731328 X:139733143-139733165 AGAGTCCTCTTTAGAAAGATAGG 0: 1
1: 0
2: 1
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198731326 Original CRISPR GAGGACTCTGTAGGAAAAAC AGG (reversed) Intronic
901556405 1:10034713-10034735 AAGTACTCTGTAGCTAAAACTGG - Intronic
903371413 1:22838493-22838515 TAAGACTCTGTAGGGAGAACAGG - Intronic
904051688 1:27643621-27643643 GAGGATTCTGAAGGACAAACAGG + Intergenic
904248846 1:29207942-29207964 GAGGACTGTGTAGGAAAAAGGGG - Intronic
905193365 1:36254229-36254251 AAGGACTTAGTTGGAAAAACTGG - Intronic
906781475 1:48576551-48576573 GAGGACTCTGTGCCAAAACCAGG - Intronic
911379487 1:97094578-97094600 GAGGACTCAGGAGGAAGAGCAGG + Intronic
912449415 1:109760073-109760095 GAGGACTCTGGAGGAAGGACAGG + Intronic
913548508 1:119894064-119894086 GAAGAATCTGAAGCAAAAACTGG - Exonic
914853973 1:151336495-151336517 GAGGACATTACAGGAAAAACGGG - Intergenic
915545580 1:156595508-156595530 GAGGACGCTGCAGGAACAAGTGG - Exonic
917869916 1:179232254-179232276 GAGGAATCTCTAGGAAGAAAGGG - Intergenic
918674911 1:187271433-187271455 AAGAACTCTGGAGGAGAAACTGG + Intergenic
919091603 1:192984201-192984223 AAGGACACTGTGGGAAGAACAGG + Intergenic
919343124 1:196339046-196339068 GAGTATTTTGTGGGAAAAACTGG - Intronic
921752233 1:218809010-218809032 GTGCACACTGAAGGAAAAACAGG - Intergenic
921946624 1:220890210-220890232 GAGGAGTGTGCAGGAAAAAGCGG + Intergenic
922576665 1:226665449-226665471 GAGGACTAGGTAGGAAAACACGG + Intronic
923485661 1:234428525-234428547 GGGAAATCTGTATGAAAAACTGG - Intronic
924141426 1:241027739-241027761 GAGAAGTATGGAGGAAAAACAGG + Intronic
1063487358 10:6432516-6432538 GAGGACTCTCTAGGGAAACTTGG + Intronic
1063579424 10:7292116-7292138 GGGGTCTCTGGAGGAAAAAGAGG + Intronic
1064448918 10:15423983-15424005 AAAGAATCTGTAGGAAATACTGG + Intergenic
1064902920 10:20314111-20314133 GACAACTCTGTAAGAAAAAAAGG + Intergenic
1065589465 10:27250831-27250853 GAGGACTCTGGAGGCAGAGCTGG + Intergenic
1067289242 10:44929421-44929443 GTGGACCCTGTAGGCAGAACAGG - Intronic
1071458824 10:85872384-85872406 GAGGGCACTGTAGGAATAACAGG + Intronic
1073337956 10:102724758-102724780 AAGGACTCTGAAGGGAAAAGTGG - Intronic
1073603473 10:104869702-104869724 CAGGACTCTGTTGGAATATCAGG + Intronic
1073617471 10:105011075-105011097 GATGACTTTGTATGAAAAGCCGG + Intronic
1073942024 10:108710471-108710493 GTGGACTGTGCAGGAAACACAGG - Intergenic
1076222306 10:128744273-128744295 CAGGACTCTGCAGGGAAGACAGG + Intergenic
1076317244 10:129551167-129551189 GAGGTATCTTTAGTAAAAACAGG + Intronic
1079129441 11:17738770-17738792 GCGGACTCTGAGGGAAAAGCTGG + Intronic
1081751439 11:45513992-45514014 GAGGCTTGTGTAGGAAAAACAGG + Intergenic
1084006790 11:66327229-66327251 GAGGACCCTGGAGGAGACACTGG - Intergenic
1084480672 11:69418099-69418121 GAAGACTTAGTAGGAAAAAGGGG + Intergenic
1085933352 11:81113298-81113320 GAGTACTATGTATGAAAACCTGG - Intergenic
1086058692 11:82677847-82677869 GAGGACACAATTGGAAAAACTGG - Intergenic
1087784944 11:102343959-102343981 GATGAAGCTGTGGGAAAAACAGG + Intergenic
1088728545 11:112660293-112660315 GAGGAGTCTGTAGCATAAACAGG - Intergenic
1089936485 11:122369675-122369697 GAAGCCTGTGTAGGAAACACAGG + Intergenic
1090100393 11:123789363-123789385 CAGGACACAGTTGGAAAAACTGG - Intergenic
1090541223 11:127708325-127708347 CAGGACTCTATAGGGAAAATTGG + Intergenic
1090640727 11:128726769-128726791 GAGGACACGGTTGTAAAAACAGG + Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095602669 12:44031833-44031855 CAGGACACAATAGGAAAAACTGG + Intronic
1096539342 12:52296260-52296282 GAGGACAGTGGAGGAAAAATGGG + Intronic
1096836742 12:54355965-54355987 TAGGCCTCTGAAGGAAAACCTGG + Intergenic
1097245796 12:57607043-57607065 GAGGACCCTGTGGGGAAAGCTGG - Exonic
1098219969 12:68258869-68258891 GTGGACTATGTTGGGAAAACTGG - Intergenic
1100619176 12:96255275-96255297 GAGGACCCTGCAGGAAATTCGGG + Intronic
1100955521 12:99903725-99903747 GGGGACTCCGGAGGAAAAATGGG + Intronic
1101964317 12:109271926-109271948 GAATACTGTGTAGGAAACACAGG + Intergenic
1103289465 12:119832858-119832880 GATGTCTCTGTAAGAAAATCAGG + Exonic
1104329984 12:127835715-127835737 GGGGACTCTGGAGGAAAAAAAGG - Intergenic
1105204354 13:18207628-18207650 GAGGACTATGTGTGAAACACAGG + Intergenic
1105484412 13:20812644-20812666 GAGGACATTGGGGGAAAAACTGG + Intronic
1106190484 13:27448727-27448749 AAAGACTCTGTATTAAAAACTGG + Intronic
1106193946 13:27477278-27477300 CAGGACAGTGTAGGAAAAAAGGG - Intergenic
1107212869 13:37878808-37878830 CAGGAATCTGTTGGGAAAACTGG - Intergenic
1107976453 13:45693138-45693160 GAGGACTCTGTGGGACCGACTGG + Intergenic
1108212599 13:48153434-48153456 GAGGACTCTGAAGTTTAAACAGG - Intergenic
1111162129 13:84408414-84408436 GGGGACTCTGTAGCATAAAAAGG - Intergenic
1111469664 13:88662061-88662083 TTTGACTCTATAGGAAAAACAGG - Intergenic
1111529617 13:89519805-89519827 AAGTACTCTATATGAAAAACAGG - Intergenic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116348781 14:43831976-43831998 GATGACTCTGTAGGATTATCTGG - Intergenic
1116899825 14:50350847-50350869 GTGGGCTCTGGAGGAACAACTGG - Intronic
1117025797 14:51618713-51618735 GAGGAATCTATAGGAGAAACAGG + Intronic
1117404232 14:55386384-55386406 GTGCACACTGTAGGAAAATCAGG - Intronic
1118085981 14:62417901-62417923 GGGGACTCTGTAGGAAATAGAGG - Intergenic
1118347451 14:64950463-64950485 GCAGACTCTGTAGGGAAAATTGG - Intronic
1118961981 14:70542305-70542327 GAGGACACAATTGGAAAAACTGG + Intergenic
1121582504 14:95041382-95041404 GAGGACTCTCAAGGAAAGGCAGG + Intergenic
1124048206 15:26170772-26170794 GAGGAATCTGTAGAAATCACTGG - Intergenic
1127530312 15:59837332-59837354 GAGCACTCTGGAGAAAAACCTGG + Intergenic
1129520699 15:76184160-76184182 GTGGCCTCTGTAGGAAAAGAAGG - Intronic
1131334828 15:91538643-91538665 AAGAACTCTGTAGGAAAGATTGG + Intergenic
1136352044 16:29716926-29716948 CAGGACACAGTTGGAAAAACTGG + Intergenic
1138135369 16:54516811-54516833 GAGAAATTTGTATGAAAAACTGG + Intergenic
1142127230 16:88416217-88416239 GAGGTCTCTGCATGAGAAACCGG - Intergenic
1145779812 17:27555037-27555059 GAGGACAGTAAAGGAAAAACTGG - Intronic
1146223962 17:31050076-31050098 GAGGACTCTGGAGGCAGAGCTGG + Intergenic
1146341362 17:32022056-32022078 GAGGACTCTGGAGGCAGAGCTGG - Exonic
1147037235 17:37690851-37690873 GAGCACTCAGTAGGGAAGACCGG + Intronic
1148174137 17:45549530-45549552 GAGGACTCTGGAGGCAGAGCTGG + Intergenic
1148231760 17:45940374-45940396 GAGGACTCTGAAGCACAGACAGG - Intronic
1148275127 17:46295917-46295939 GAGGACTCTGGAGGCAGAGCTGG - Exonic
1148297233 17:46513496-46513518 GAGGACTCTGGAGGCAGAGCTGG - Exonic
1148312816 17:46662660-46662682 GAGGAATCTGTAGGGAAGTCTGG - Intronic
1148361790 17:47017976-47017998 GAGGACTCTGGAGGCAGAGCTGG - Intronic
1148440241 17:47708478-47708500 GAGGACTCTGTTGCAGGAACAGG + Exonic
1149380064 17:56084624-56084646 GAGGAATTTGTAGGAAAAGGTGG + Intergenic
1149442576 17:56687123-56687145 CAGGACACTGCAGGAAAAAATGG + Intergenic
1149643991 17:58226030-58226052 TTGGACACTGTAGGGAAAACAGG - Intronic
1149695376 17:58612161-58612183 CAGGCCTCTATAGAAAAAACTGG + Intronic
1150405353 17:64896452-64896474 GAGGACTCTGGAGGCAGAGCTGG + Exonic
1150754052 17:67895051-67895073 GTGGACTCTGTAGAAAAGATTGG - Intronic
1152987919 18:336264-336286 GAGGTCTCTGTGGGAAAGCCTGG + Intronic
1154025645 18:10705062-10705084 GTTGTCTCTGAAGGAAAAACAGG - Intronic
1154303565 18:13215331-13215353 GAGGACTGAGTAGGAAACACAGG + Intergenic
1154507251 18:15053964-15053986 GAGAATTCTGTGGGAGAAACTGG + Intergenic
1155380856 18:25220398-25220420 GAGGATGCTGTAGAAAAGACGGG + Intronic
1156457472 18:37302859-37302881 GACCACTCTGAAGGAAAAAGTGG - Intronic
1157346264 18:46837737-46837759 AAGGATTATGTAGGAAAACCTGG - Intronic
1158210653 18:55046003-55046025 GAGGAGTCCGTATGATAAACAGG + Intergenic
1165925041 19:39321175-39321197 GAGGTCTCTGTAGGGAGATCCGG - Intergenic
1168356051 19:55700678-55700700 GAGGAGGCTGTAGGTGAAACAGG - Intronic
926524104 2:13954837-13954859 GAGAAATCTTTAGGAAAAAAAGG - Intergenic
928246099 2:29628811-29628833 GACAACTCTGTAAGAAAAAAAGG + Intronic
930115365 2:47713454-47713476 AGGGACTTTGTAGGAAAAATTGG - Intronic
932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG + Intergenic
932446797 2:71786499-71786521 CAGGCCTCTGTAGGGAAAAGCGG + Intergenic
933917255 2:87008188-87008210 AAGGACACTGAAGGAAAGACTGG - Intronic
934005741 2:87761726-87761748 AAGGACACTGAAGGAAAGACTGG + Intronic
934522129 2:95026098-95026120 CAGGACTATGGAGGAAAAACTGG + Intronic
935319414 2:101871478-101871500 CTGTACTCTGTAGAAAAAACAGG - Intronic
935702492 2:105824647-105824669 GAGGTCTCTGGAGGAATCACTGG + Intronic
935768697 2:106395826-106395848 AAGGACACTGAAGGAAAGACTGG + Intronic
935911403 2:107900102-107900124 AAGGACACTGAAGGAAAGACTGG - Intergenic
936133186 2:109865160-109865182 AAGGACACTGAAGGAAAGACTGG - Intergenic
936211511 2:110506325-110506347 AAGGACACTGAAGGAAAGACTGG + Intergenic
936420649 2:112360900-112360922 AAGGACACTGAAGGAAAGACTGG + Intergenic
938400645 2:130988126-130988148 AAGGACTCTGGCAGAAAAACAGG + Intronic
941158135 2:162003331-162003353 GAGGAGCCTATAGGAAAGACTGG + Intronic
943419883 2:187657167-187657189 GAGGACACAATTGGAAAAACTGG + Intergenic
943526089 2:189019461-189019483 GGGGACTCTGCAGGAAACTCTGG + Intergenic
943530211 2:189070399-189070421 CAGAACTTTGTAGGAAAAGCAGG + Intronic
943666158 2:190610596-190610618 GAGGACACAGTTGGAAAAACTGG - Intergenic
944489522 2:200243688-200243710 GAGGTCTCTGTAGGAAATTTTGG - Intergenic
944959084 2:204849238-204849260 GAATACTCTGTAGGACATACAGG + Intronic
945383818 2:209173350-209173372 GAGAAATCTGTAAGAAATACAGG - Intergenic
947140811 2:227017985-227018007 GAAGATTCTGAAGGGAAAACAGG + Intronic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
948454379 2:238097978-238098000 GAGAACTCTGCAGGGAGAACGGG + Intronic
1169233755 20:3911946-3911968 GAGGTCACTTCAGGAAAAACAGG + Intronic
1172091083 20:32433461-32433483 AAGGAATCTGTACAAAAAACAGG + Exonic
1173895431 20:46547163-46547185 GAGAACTCTGTGGTCAAAACAGG + Intronic
1175541945 20:59753460-59753482 GAGGACTCTGGAGGGAGAAACGG + Intronic
1177061796 21:16384752-16384774 CAGAACTCTGTAAGAAAAAGAGG + Intergenic
1177964816 21:27714737-27714759 CATGATTCTGTAGGCAAAACTGG + Intergenic
1179226718 21:39460191-39460213 GAGGAATCTGTGGGAGAAAAGGG + Intronic
1181837375 22:25621997-25622019 CAGGACACAGTTGGAAAAACTGG - Intronic
1184045265 22:41969236-41969258 GGGGAGTCTGCAGTAAAAACAGG - Intergenic
949531018 3:4955167-4955189 GAGGACTCTGGGGGAAAAGCTGG - Intergenic
950951282 3:17002699-17002721 AAAGTCCCTGTAGGAAAAACAGG - Intronic
953549660 3:43891723-43891745 GGGGACTCAGCAGGAAAAAGTGG - Intergenic
957464447 3:80569069-80569091 GAGAACTCTGTAAGAAAGATGGG + Intergenic
957836891 3:85605994-85606016 GAGGACTCTGCTTGAAACACAGG - Intronic
960581047 3:119279250-119279272 CAGGACTGAGTAGGAAAACCAGG + Intergenic
960596248 3:119410630-119410652 GAGGACCCTGTAGGAATGAATGG + Intronic
960742524 3:120850787-120850809 GAGGACTGCTTAGGAAAAATGGG + Intergenic
962522442 3:136209869-136209891 GGGAACTCAGTAGGAAAAATAGG + Intergenic
962762700 3:138530665-138530687 GAGGCCTAAGTAGGATAAACAGG - Intronic
964507725 3:157417882-157417904 TTGGACTCTGTAGAGAAAACAGG + Intronic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965190674 3:165524249-165524271 GAGGACATTGATGGAAAAACTGG + Intergenic
965243549 3:166234227-166234249 GAGTAAGCTGTATGAAAAACTGG + Intergenic
966977329 3:185096603-185096625 GAGGACTCTGCAGGAGGAAGGGG + Intronic
967322610 3:188209556-188209578 GAGAGCTCTGTAGGAAAAGAGGG - Intronic
968267483 3:197373520-197373542 GTGGACTCTGAAGGACAAATAGG - Intergenic
969219292 4:5749084-5749106 AAGAACTCTGCAGGCAAAACAGG - Intronic
969385133 4:6839853-6839875 GAAGACCTAGTAGGAAAAACAGG + Intronic
971893649 4:32560915-32560937 GAAGAATCTGTAGGAAAAACAGG - Intergenic
972778182 4:42262845-42262867 GACTACTCCATAGGAAAAACAGG + Intergenic
974721369 4:65743286-65743308 GAGGACACAATTGGAAAAACTGG + Intergenic
975450855 4:74524923-74524945 GAGGGCTGTGTAAGAGAAACCGG + Intergenic
977066910 4:92329765-92329787 GAGGTCTATGAAGAAAAAACAGG + Intronic
978423380 4:108557392-108557414 CAGTACTCTCAAGGAAAAACAGG - Intergenic
978634332 4:110785712-110785734 GATGGCTGGGTAGGAAAAACTGG + Intergenic
981210672 4:142100360-142100382 GAGGACTGTCTAGCAAAACCTGG - Intronic
982557793 4:156890520-156890542 GAGGACTGTTCAGGAAAGACTGG - Intronic
982975909 4:162059786-162059808 GTGGACTCTGTGGGAAAAGATGG + Intronic
986964149 5:13250494-13250516 GAGAACTGTGTTGGAAAAATAGG - Intergenic
989469364 5:41797087-41797109 GAGGAATTTGTAGGACAAAAAGG + Intronic
990120380 5:52443915-52443937 GGGGAATCTTTAAGAAAAACGGG - Intergenic
991312056 5:65254535-65254557 GAGGCCAGTGTAGGAAGAACAGG + Intronic
991435682 5:66595958-66595980 GAGGGCTCTATAGGGAAAAAAGG - Intergenic
991480714 5:67076335-67076357 GAGAAAGCTGTGGGAAAAACTGG - Intronic
992964440 5:81985559-81985581 GAGGTCTCTGGAGGAAGAGCAGG - Intronic
993382480 5:87223715-87223737 AAGCAGTCTGTAAGAAAAACTGG + Intergenic
993699479 5:91100891-91100913 AAGGACACTGCAAGAAAAACTGG + Intronic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
995393702 5:111665365-111665387 CAGGACACAGTTGGAAAAACTGG - Intronic
995512045 5:112920045-112920067 GAGGAGACTCAAGGAAAAACGGG - Intronic
996761111 5:126986762-126986784 GAGGCACCTGTATGAAAAACTGG + Intronic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
997043369 5:130283490-130283512 GAGTCCTCTTTAGGAAAAAGAGG - Intergenic
997422505 5:133780337-133780359 AAGGACATTGTAGGAAAAAGAGG - Intergenic
1000069690 5:157728335-157728357 CAGGACACAGTTGGAAAAACTGG - Intergenic
1000745700 5:165030839-165030861 GAGGATTATGTAGGAGAAAAAGG - Intergenic
1001303625 5:170555731-170555753 GAAGACTCTGTGGGACAGACAGG - Intronic
1002256266 5:177960512-177960534 GAGGACTCTGTCTCAAAAAAAGG + Intergenic
1003173238 6:3736479-3736501 GAGGATTTTGTAGGGAAAAGAGG - Intronic
1004101828 6:12620355-12620377 TAGGAGTCTGTAGGAAGACCAGG - Intergenic
1004176467 6:13344326-13344348 GATGACTCCATAGGAAAAATGGG + Intergenic
1004557154 6:16710254-16710276 AATGTCTCTGCAGGAAAAACAGG + Intronic
1004715759 6:18215060-18215082 GAGGACCCTGGATGACAAACAGG + Exonic
1006998168 6:38282849-38282871 GGGGAATCAGGAGGAAAAACCGG - Intronic
1013302575 6:108818317-108818339 CAGGCCTCAGTAGGAAAAGCTGG + Intergenic
1014042925 6:116850576-116850598 GAGGCCTTAGGAGGAAAAACTGG + Intergenic
1014045003 6:116875834-116875856 GAGGACTGGGTAGAGAAAACTGG + Intergenic
1016811129 6:148262336-148262358 GATGACTCAGGAGGAAAAATGGG - Intergenic
1018081918 6:160266495-160266517 GAGGAGTCTTTAGTAAAAATGGG + Intronic
1020576008 7:9929368-9929390 GAGAATTCTGAAGGAAAAAAAGG + Intergenic
1021052943 7:16011964-16011986 GAAGACTCTGTATGAAAGAATGG - Intergenic
1022047499 7:26633866-26633888 GGGGACTCTGGAGGAAAGGCTGG + Intergenic
1022777131 7:33538732-33538754 GTATTCTCTGTAGGAAAAACAGG - Intronic
1022791957 7:33698263-33698285 GATGGCTCTGTAGTAAATACCGG + Intergenic
1032398969 7:131610496-131610518 GAGGCCTCTGAAGAAAAGACTGG + Intergenic
1032825924 7:135567825-135567847 TTAGACTCTGAAGGAAAAACTGG - Intronic
1032872648 7:136002650-136002672 GAGGGCTCTGTTGGAAAAGGAGG + Intergenic
1033091508 7:138390330-138390352 GAAGACCCTGTAGGAAATAAAGG + Intergenic
1033473815 7:141671742-141671764 TTGGACTCTGAAGGAAAAAATGG + Intronic
1033485183 7:141781977-141781999 GAAGACAGTGTAGGACAAACAGG - Intronic
1033928052 7:146488442-146488464 CAGGACTCTGTAGGTATACCTGG + Intronic
1034224141 7:149469919-149469941 CAGGGGTCTGTGGGAAAAACAGG + Intergenic
1034781111 7:153883679-153883701 GAGGTCTCTGTAAGAAAGACAGG - Intergenic
1039042444 8:33421005-33421027 GAAGACACTATAGGAAAGACAGG + Intronic
1041524503 8:58790127-58790149 GAGGGCTGTGGGGGAAAAACTGG + Intergenic
1042277646 8:67022335-67022357 CAGAACTCAGTAGGAAAAATGGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045741822 8:105369367-105369389 GTGTACTCAGTAGGAAAAAATGG + Intronic
1046917796 8:119695526-119695548 GAGGAGGCTGAAGGAAAAATAGG - Intergenic
1047514869 8:125545109-125545131 GAGGATTCTGTGGGAAAACAAGG + Intergenic
1047851243 8:128859844-128859866 GAGGACTGTGAAGGAGAATCTGG + Intergenic
1049832715 8:144712699-144712721 GACTTCTCTGTAGGAAAAATAGG - Intergenic
1052772916 9:32706074-32706096 GAGGACTCTGGAGGGAACCCTGG - Intergenic
1056999148 9:91491667-91491689 CAAGTCTCTGTAGGAAAAAGAGG - Intergenic
1057288355 9:93779494-93779516 GAGGAATCTGTATTAAATACAGG + Intergenic
1057672911 9:97110860-97110882 AAGGACTCTGTTGAAATAACAGG + Intergenic
1058228193 9:102392992-102393014 GAGATTTCTGTAGGAATAACTGG - Intergenic
1059043198 9:110837032-110837054 GAGGACTATGTAAGAAAAATTGG - Intergenic
1059108296 9:111530829-111530851 GAGGAATCTGTATGAACGACTGG + Intronic
1060079407 9:120628327-120628349 GAGGCTTCTGGAGGAAAAAAAGG + Intronic
1060244096 9:121929507-121929529 AAGGAATATGTATGAAAAACGGG + Intronic
1186433894 X:9527307-9527329 AAGGAATCTGTAGGGCAAACGGG - Intronic
1186582035 X:10830393-10830415 AAGTACTCTGGAGGAAAAATGGG - Intronic
1187210354 X:17224456-17224478 GAGGACTCTGTACCAGCAACTGG - Intergenic
1191017351 X:55823851-55823873 GAGGAGTCTGTGGGAAAAGTGGG - Intergenic
1191901109 X:66041355-66041377 GAGGACCCGGTGGGAAAAAATGG - Intergenic
1195869093 X:109467340-109467362 GAGGATACTGTTGGACAAACTGG - Intronic
1196328136 X:114433283-114433305 GAGGACTATATAGGAAATGCAGG + Intergenic
1197087786 X:122499448-122499470 GAGAACACTGTAGAAGAAACAGG - Intergenic
1198090925 X:133329110-133329132 GAGGACACAGTGGGAAAAACAGG + Intronic
1198149955 X:133898415-133898437 AAGTACTGTTTAGGAAAAACGGG + Intronic
1198731326 X:139733129-139733151 GAGGACTCTGTAGGAAAAACAGG - Intronic
1200383664 X:155866348-155866370 TAGCACTTGGTAGGAAAAACAGG + Intergenic