ID: 1198733509

View in Genome Browser
Species Human (GRCh38)
Location X:139760322-139760344
Sequence CAGGCCAAACACTGTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198733509_1198733515 3 Left 1198733509 X:139760322-139760344 CCTCCTCCACAGTGTTTGGCCTG 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1198733515 X:139760348-139760370 ACCAGCAGATACTGGCTACCAGG 0: 1
1: 0
2: 0
3: 12
4: 100
1198733509_1198733519 27 Left 1198733509 X:139760322-139760344 CCTCCTCCACAGTGTTTGGCCTG 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1198733519 X:139760372-139760394 TCTTAGAAAATTTGTGAAACTGG 0: 1
1: 0
2: 2
3: 26
4: 338
1198733509_1198733520 28 Left 1198733509 X:139760322-139760344 CCTCCTCCACAGTGTTTGGCCTG 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1198733520 X:139760373-139760395 CTTAGAAAATTTGTGAAACTGGG 0: 1
1: 0
2: 4
3: 28
4: 327
1198733509_1198733513 -5 Left 1198733509 X:139760322-139760344 CCTCCTCCACAGTGTTTGGCCTG 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1198733513 X:139760340-139760362 GCCTGGCTACCAGCAGATACTGG 0: 1
1: 0
2: 0
3: 16
4: 142
1198733509_1198733517 4 Left 1198733509 X:139760322-139760344 CCTCCTCCACAGTGTTTGGCCTG 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1198733517 X:139760349-139760371 CCAGCAGATACTGGCTACCAGGG 0: 1
1: 0
2: 0
3: 12
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198733509 Original CRISPR CAGGCCAAACACTGTGGAGG AGG (reversed) Intronic
900677490 1:3896955-3896977 CAGGCTGAACACTGTGGCAGGGG + Intronic
901150285 1:7096787-7096809 CAGGCAAACCAATGGGGAGGAGG - Intronic
901790758 1:11652740-11652762 CAGGCCAGGCACTGGGGAAGGGG + Intronic
903570984 1:24304779-24304801 AAGGCCAAATACTGTTGTGGGGG + Intergenic
904694597 1:32321823-32321845 CAGGCCAAACTCTGTGCAGGAGG + Intronic
905567124 1:38974274-38974296 CAGCCCACACCCTGTGAAGGGGG + Intergenic
907389669 1:54150117-54150139 CGGGCCAGTCACTGTGGTGGTGG - Intronic
908720307 1:67118540-67118562 CATGCCAAACAGTGTGGTGCAGG - Intronic
909782282 1:79561745-79561767 CAGGCCAGCAGCTGTGGAGGGGG - Intergenic
910026688 1:82663208-82663230 CAGGCTAAATACAGTGCAGGTGG - Intergenic
911124296 1:94326057-94326079 CACACCAAACACTGTGGGGGTGG - Intergenic
911479495 1:98419908-98419930 CAAGACAAAGACTGTTGAGGAGG + Intergenic
915307461 1:154988794-154988816 CATGCCCAACGCTGTGGAGCAGG + Exonic
915691509 1:157695548-157695570 CAGGGCCCACACTGTGGTGGGGG - Exonic
921079423 1:211726677-211726699 CAGGTCAATCACTGTGGCTGGGG + Intergenic
921507357 1:215988842-215988864 CAGCACAGACACTGTGGAGCAGG + Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922157154 1:223049448-223049470 CAGGAAAGACACTGTGAAGGAGG + Intergenic
1065004680 10:21368545-21368567 TAGGCCAATCACTGTGGTGAAGG + Intergenic
1065219272 10:23479538-23479560 CTTGCCAAATACTGTGGAGTTGG - Intergenic
1067340313 10:45396011-45396033 CAGGCCATACACTGTGGAAAGGG - Intronic
1068738711 10:60444614-60444636 AATTCCAAACACTGTGGAGATGG - Intronic
1068927035 10:62551182-62551204 CTGACCAAACATTGTTGAGGAGG - Intronic
1075396777 10:122133316-122133338 CAGGCCAAGCACAGTGTAGACGG - Intronic
1076691288 10:132224984-132225006 CAGGCCAGCCTCTGTGGGGGTGG - Intronic
1077128243 11:954318-954340 CAGGCCAGCCCCTGAGGAGGGGG - Intronic
1080976136 11:37342531-37342553 CATGCCAAATACTCAGGAGGTGG + Intergenic
1081545057 11:44065994-44066016 CAGGCCACCCAGAGTGGAGGTGG + Intronic
1083603331 11:63962116-63962138 CAGGCCTAACACTGGGGTGCTGG - Intergenic
1083742833 11:64720278-64720300 CAGGCCCATCAGTGTGGAAGGGG + Intronic
1083814443 11:65124699-65124721 GAGGCCAACCTCTGGGGAGGAGG - Intronic
1084196241 11:67524693-67524715 CAGGCAGAACACTGCGGGGGAGG - Intergenic
1085349550 11:75789819-75789841 CAGCCCAGACACTGTGGATAAGG - Intronic
1087607883 11:100399090-100399112 CATGCCAAGCACTGTGGAAGAGG - Intergenic
1088115161 11:106304679-106304701 CAGGCCAAACAGTCAGGAGGAGG + Intergenic
1089390517 11:118098713-118098735 CAGGCAAGACACGGGGGAGGTGG + Intronic
1089401382 11:118166526-118166548 CAGGCCAAGCACTGGGCAGGTGG + Exonic
1090811249 11:130245768-130245790 CAGGCCATACTCTTTCGAGGAGG + Intronic
1091597481 12:1887896-1887918 AAGTCTAACCACTGTGGAGGAGG - Intronic
1092152619 12:6261427-6261449 CAGGTCAAATGCTGTGGATGGGG + Intergenic
1092908037 12:13119947-13119969 CAGGACAAACATCTTGGAGGAGG + Intronic
1093443770 12:19230577-19230599 CAGGCCAGCAGCTGTGGAGGGGG - Intronic
1094240786 12:28221957-28221979 CAGGCCAAAGAGTATGGTGGGGG - Intronic
1095268370 12:40186836-40186858 AAATCCAAACACTGTGGATGTGG + Intergenic
1096252267 12:50040811-50040833 CAGGCCAGCCACTCTGGAGAGGG + Intergenic
1096522525 12:52192199-52192221 CAGGCCTAGCTCTGGGGAGGGGG + Intergenic
1099991150 12:89721694-89721716 CAGGGCAAACAATGTGGACCTGG - Intergenic
1100781188 12:98028335-98028357 CAAAACAAACACTGTGGTGGAGG - Intergenic
1101862618 12:108495306-108495328 CAGGTCAAAGACTGGGGAGCTGG + Intergenic
1101907826 12:108840801-108840823 CAGGCTAAGCCCTGCGGAGGAGG + Intronic
1102876056 12:116449628-116449650 CAGCCCAAACACTGAGGCGGCGG - Intergenic
1103532341 12:121611339-121611361 CAGGCCCAACACTGGGGTGTGGG - Intergenic
1103909014 12:124341783-124341805 AAGGCCAAACCCAGCGGAGGTGG + Intronic
1103942704 12:124509650-124509672 CAGGCCAGACTCAGTGTAGGGGG + Intronic
1104890345 12:132136406-132136428 CTGGCCACACACTCGGGAGGTGG - Intergenic
1106488450 13:30193525-30193547 CTTGCAAAACCCTGTGGAGGAGG + Intergenic
1111023644 13:82489540-82489562 CAGGCCAAATAATATGGAGTGGG - Intergenic
1113056273 13:106271317-106271339 CAGGCCACACAGTTTTGAGGTGG - Intergenic
1113783864 13:112991842-112991864 TAGGCCAAGCCCTGTGGAGTCGG - Intronic
1114082460 14:19213248-19213270 CACTCCAGACCCTGTGGAGGGGG + Intergenic
1115890839 14:38026775-38026797 TAGTCCAAAAACTGAGGAGGAGG + Intronic
1117072214 14:52067987-52068009 CAGGCCCAGCACTGCGGGGGAGG + Exonic
1118391834 14:65302414-65302436 CAGGCCAAACACTACATAGGAGG + Intergenic
1119427977 14:74548094-74548116 CAGGCTAAACCCTGTGGATCAGG - Intronic
1119563869 14:75612356-75612378 CAGGACAAACCCTGTGACGGGGG + Intronic
1119775073 14:77243165-77243187 CAGTGCGAACATTGTGGAGGTGG + Intronic
1121015859 14:90548653-90548675 CAGGCCTGACACTGGGCAGGTGG + Intronic
1121882466 14:97513317-97513339 GTGGCCAAACACTGTGGGTGTGG + Intergenic
1122856077 14:104560871-104560893 CAGCTCAGACCCTGTGGAGGGGG - Intronic
1125616805 15:41021680-41021702 CAGGCCATAAACTGGGGAAGGGG + Intronic
1129230839 15:74196423-74196445 CAGACCAATTAGTGTGGAGGTGG - Intronic
1129857976 15:78838405-78838427 CAGGCAAAGCACTGTGCCGGGGG - Intronic
1132113838 15:99121258-99121280 CAGGGCCAGCACTGTGGAGGGGG + Intronic
1133879210 16:9764549-9764571 CAACCCTAACACGGTGGAGGTGG - Exonic
1133978710 16:10618338-10618360 CATGCCAGACACTGTGCTGGAGG + Intergenic
1134226833 16:12397841-12397863 CTGACCCCACACTGTGGAGGTGG - Intronic
1137609642 16:49810032-49810054 CAGGCCAAAGAGTGGGGAAGGGG - Intronic
1137944500 16:52720775-52720797 TAGGACAAACACTCAGGAGGAGG - Intergenic
1138520362 16:57567597-57567619 CAGGCCCAGCACTGTGGCAGCGG - Intronic
1139472467 16:67185472-67185494 CAGGACAGACACTGAGGAGCTGG + Exonic
1140782604 16:78310310-78310332 CATGCCAAACACTGGCCAGGAGG - Intronic
1141344137 16:83229859-83229881 CAGACCAAACACTCTGAAGCTGG + Intronic
1141945144 16:87304609-87304631 CAGGCCATGCACTGGGAAGGGGG - Intronic
1141994739 16:87629053-87629075 CAGGGCTAACGCTGTGGGGGGGG + Intronic
1143206039 17:5139653-5139675 CAGGCTGAACACTGCGGAGAGGG + Exonic
1144628742 17:16858841-16858863 CAGGTCACACACTGTGTTGGGGG - Intergenic
1144652665 17:17017249-17017271 CAGGTCACACACTGTGTTGGGGG + Intergenic
1145160318 17:20569414-20569436 CAGGTCACACACTGTGTTGGGGG - Intergenic
1145906782 17:28520767-28520789 CAGGCCAGACCCTCAGGAGGTGG + Intronic
1145978522 17:28998012-28998034 CAGGCCAGACACTCAGCAGGTGG + Intronic
1148071770 17:44912675-44912697 CAGGAAAGACACTGTAGAGGGGG - Intronic
1148158645 17:45437526-45437548 CTGCCCAAACACTGTGGAAAGGG - Exonic
1149738957 17:59024859-59024881 CAGTCAAAATACTTTGGAGGAGG + Intronic
1150390065 17:64784925-64784947 CTGGCCAAACACTGTGGAAAGGG - Intergenic
1153278759 18:3394707-3394729 CAGGCCAGATACTGTGGTGTCGG - Intergenic
1155343776 18:24838657-24838679 CAGGCCAGGCAGTGAGGAGGTGG + Intergenic
1155671305 18:28375056-28375078 CAGGCATAACTCTGTGAAGGAGG - Intergenic
1156199661 18:34815954-34815976 CAGACCAGACACTGCGGGGGAGG - Exonic
1156545789 18:37962507-37962529 CAGGCCATACACAGAGGGGGTGG + Intergenic
1157121094 18:44911824-44911846 AGGGACAAACATTGTGGAGGAGG + Intronic
1157586321 18:48803681-48803703 CAGCCCAATCACTGTGGCTGTGG - Intronic
1158158925 18:54457753-54457775 CAGGGCAATGACTGGGGAGGTGG + Intergenic
1158693858 18:59685620-59685642 CATGCCAGAAACTCTGGAGGTGG - Intronic
1161056279 19:2192048-2192070 CAGCCTAGACACTGTGGAGAAGG - Intronic
1161114421 19:2488855-2488877 CTGGCCAGACACTCTGGGGGTGG + Intergenic
1161229334 19:3165066-3165088 CAGACCAAACTCAGTGGAGAGGG - Intergenic
1166523928 19:43499283-43499305 CAAGACAAACAGTGTGGAGAAGG + Intronic
1166658397 19:44628830-44628852 CAGGACAAAGATTGTGGAGTGGG + Intronic
1168725812 19:58581356-58581378 CAGGCCCGACACGGTGGAGCGGG - Intergenic
926440346 2:12882535-12882557 GAAGCCAAACACTTTGCAGGAGG + Intergenic
927690526 2:25204763-25204785 CTGGCCTGACACTGTGCAGGCGG + Intergenic
927887184 2:26725723-26725745 CTGGCCCGACGCTGTGGAGGGGG + Intronic
929885087 2:45871179-45871201 CAGGCCACCCACTGAGGAAGGGG - Intronic
932230735 2:70082241-70082263 CTGGCCAAGTACTGTGGATGAGG - Intergenic
933748811 2:85590141-85590163 CAGGCAAACCACTGTAGGGGAGG - Intronic
934090067 2:88543416-88543438 CACAGCAATCACTGTGGAGGTGG + Intergenic
937103365 2:119288755-119288777 CAGGCCAGAGACTGGAGAGGAGG + Intergenic
938494124 2:131783355-131783377 CACTCCAGACCCTGTGGAGGGGG - Intergenic
939045998 2:137250884-137250906 CAGAACAAACTCTGTGGAGGGGG - Intronic
939098129 2:137859979-137860001 CATGCCAAACACTGTGGCACTGG - Intergenic
939182109 2:138815725-138815747 GAGTCCAATCACTGTGGAAGTGG + Intergenic
939745413 2:145960788-145960810 CAGGCCAGCAGCTGTGGAGGGGG - Intergenic
948259797 2:236595152-236595174 CAGGCCAATCACTCTGGTGATGG - Intergenic
1169630233 20:7622666-7622688 CAGGCCAGAAGCTGTGGATGGGG - Intergenic
1170063841 20:12289117-12289139 CAAGGCAAACATTATGGAGGAGG - Intergenic
1170110399 20:12798449-12798471 CAGGCCAAATGCTATGGTGGGGG - Intergenic
1170204274 20:13781573-13781595 CAAGCCATGCACTCTGGAGGGGG + Intronic
1173616967 20:44409583-44409605 CAGGCCACACGCAGTGGAGGTGG - Intronic
1174036141 20:47669369-47669391 CAGATCAAACTCTGTGGTGGGGG + Intronic
1174084072 20:47992775-47992797 CTGGCCAAAAACTGTGGCAGCGG + Intergenic
1175219491 20:57408834-57408856 CTCCCCAAACACTGTGGAAGGGG + Exonic
1176386793 21:6142026-6142048 CAGGCCACAGGCAGTGGAGGGGG - Intergenic
1176613791 21:9011023-9011045 CATTCCAGACACTGTGGAAGGGG + Intergenic
1176711401 21:10152866-10152888 CACTCCAGACCCTGTGGAGGGGG - Intergenic
1178365611 21:31986740-31986762 CAGGGAAAACACTCTGGAAGAGG - Intronic
1178472626 21:32907010-32907032 CAGGGCATTCACTGTGGAGGAGG - Intergenic
1178827467 21:36028733-36028755 CAGCCCAAACACTCTGGACACGG + Intergenic
1179381363 21:40902441-40902463 GAGACCAAACACTGTCAAGGTGG - Intergenic
1179505291 21:41835922-41835944 GCGGCCAAACCCTGTGGGGGAGG - Intronic
1179736680 21:43396226-43396248 CAGGCCACAGGCAGTGGAGGGGG + Intergenic
1180498317 22:15909422-15909444 CACTCCAGACCCTGTGGAGGGGG - Intergenic
1180801425 22:18633883-18633905 CAGGCGACGCACCGTGGAGGGGG - Intergenic
1180852659 22:19029423-19029445 CAGGCGACGCACCGTGGAGGGGG - Intergenic
1181220296 22:21361378-21361400 CAGGCGACGCACCGTGGAGGGGG + Intergenic
1182442050 22:30370423-30370445 CAAGCCTAGCACTGGGGAGGAGG - Exonic
1182463190 22:30496572-30496594 CAACCCTAACACTGTGCAGGTGG - Intronic
1182507245 22:30792821-30792843 CCAGCCTAACACTGGGGAGGTGG + Intronic
949180214 3:1120346-1120368 CATGCCAAACACTGATGACGAGG - Intronic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950557792 3:13705800-13705822 CTGGCCTACCACTGTGGTGGGGG + Intergenic
955520603 3:59772070-59772092 CAAGCCAGTGACTGTGGAGGGGG - Intronic
955688190 3:61564753-61564775 GAGGCCGACCAGTGTGGAGGTGG - Intronic
957301474 3:78397359-78397381 CAGTCCTAAGACTGTGGGGGTGG + Intergenic
958865656 3:99498765-99498787 CAGGCCAGGAACTGTGCAGGAGG + Intergenic
959344051 3:105170533-105170555 CAGGCCAATCATTGTGCAGAGGG + Intergenic
960785804 3:121372010-121372032 CTGGCAAAGCAATGTGGAGGTGG + Intronic
962385627 3:134930094-134930116 CAGGCTATGCACTGTGGATGGGG - Intronic
966121840 3:176530009-176530031 CAGCACAGACACTGTGGTGGTGG + Intergenic
966425471 3:179775734-179775756 CAGGCCAGCATCTGTGGAGGGGG - Intronic
968604089 4:1523439-1523461 CACGTCAAAGACTGTGGACGTGG + Intergenic
970294190 4:14610881-14610903 CATCCCCAACACTTTGGAGGAGG + Intergenic
970299659 4:14667994-14668016 CAGGGCTAATACTGTGGTGGTGG - Intergenic
979865220 4:125745133-125745155 CAGGCCAGCAGCTGTGGAGGGGG + Intergenic
981551860 4:145949837-145949859 CAGGTCACACACTGTTGAGCAGG + Intergenic
982842818 4:160213540-160213562 CTGGACAAACACTGTAGAGAGGG + Intergenic
984860416 4:184232657-184232679 CAGGCCAGATTCTGTGGGGGTGG - Intergenic
985944040 5:3162907-3162929 CAAACCAAAAGCTGTGGAGGAGG - Intergenic
986417853 5:7546471-7546493 CAGGGCACACAGTGTGGAAGTGG + Intronic
988465843 5:31491001-31491023 CAGGCCAAACCTTGTGCTGGGGG + Intronic
994768635 5:103954033-103954055 CAGGCCAGCAGCTGTGGAGGGGG - Intergenic
1001617394 5:173054077-173054099 CAGGTTAAACACTTTGGAAGTGG + Intergenic
1001843976 5:174904471-174904493 GAGTCCAAACAGTCTGGAGGAGG + Intergenic
1002866797 6:1129130-1129152 CAGTCCAAACACAGGGGAGAGGG + Intergenic
1006094664 6:31648573-31648595 AAGGCCAAACCCTGTGGATGTGG + Intronic
1006401178 6:33818377-33818399 CAGACCAAGCACTGTGCACGTGG + Intergenic
1007068675 6:39018718-39018740 CATGTCAAACAGTGTGGAAGAGG + Intronic
1007511292 6:42376111-42376133 CAGCCCAATCAGTGTGAAGGGGG + Intronic
1008726968 6:54433105-54433127 TAGGCCAAAGAAGGTGGAGGTGG - Intergenic
1010351427 6:74879626-74879648 CATGCCAAAAACTGTGGAATAGG + Intergenic
1016350079 6:143157295-143157317 GAGGCCACACAATGTGGTGGAGG - Intronic
1019938787 7:4273337-4273359 CAGGCCAAACATATTGGTGGCGG - Intergenic
1020700294 7:11473712-11473734 CAGGGCAAACACTTTGCTGGAGG - Intronic
1022214312 7:28243247-28243269 CAGGCCAAGCCCTGTGCAGATGG + Intergenic
1024239576 7:47423960-47423982 CATGCCAAAGACTGTGAAGGTGG - Intronic
1033595883 7:142857329-142857351 CAGGACAGACAGTGAGGAGGTGG - Intronic
1035644697 8:1210162-1210184 CAGGCCAGGCTCTGTGGAGTGGG + Intergenic
1036096835 8:5733821-5733843 CATGACACACACTTTGGAGGAGG + Intergenic
1036631250 8:10517568-10517590 CAGGCCCAACACCCTGGGGGAGG - Intergenic
1038071306 8:24017103-24017125 CATGCCAGAAACTGTGGAGATGG + Intergenic
1038122316 8:24631287-24631309 CAGACCTAGGACTGTGGAGGAGG - Intergenic
1040397837 8:47016458-47016480 CAGGCCAATGACTGTGGCTGTGG + Intergenic
1041145977 8:54876101-54876123 CAGGCCACACACTGTGTACCCGG - Intergenic
1042470869 8:69186378-69186400 TAGTCCAGCCACTGTGGAGGGGG - Intergenic
1043568283 8:81571498-81571520 CAGGCCATCCACAGTGGGGGAGG - Intergenic
1044872254 8:96630931-96630953 CAGGGCCAACACTGGGCAGGAGG - Intergenic
1046697792 8:117361200-117361222 CAGGGTAAACACTTTGGAGCAGG - Intergenic
1054329367 9:63736500-63736522 CACTCCAGACCCTGTGGAGGGGG - Intergenic
1055350759 9:75384722-75384744 CAGTCCATACAGTCTGGAGGAGG + Intergenic
1055719365 9:79154439-79154461 CAGGCTGTAGACTGTGGAGGAGG - Intergenic
1056552545 9:87663805-87663827 GAGGCTGAACACTGGGGAGGAGG - Intronic
1058896365 9:109404108-109404130 CATGCCAGAAACTGAGGAGGAGG - Intronic
1061903080 9:133683033-133683055 CAGGCCAAACACAGCGTGGGGGG - Intronic
1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG + Intergenic
1062607473 9:137354636-137354658 CAGGCCAAACTCTGTGGCTCAGG + Intronic
1202796154 9_KI270719v1_random:121855-121877 CACTCCAGACCCTGTGGAGGGGG - Intergenic
1185662572 X:1738986-1739008 GAGGCCAATCACTTTGGAGGGGG - Intergenic
1191872073 X:65755677-65755699 AAGAACAAACACTGGGGAGGAGG - Intergenic
1195211671 X:102656220-102656242 CAGGCCAGAAGCTGAGGAGGGGG + Exonic
1197094984 X:122583234-122583256 CAGTCCCAACACTGAAGAGGGGG + Intergenic
1198733509 X:139760322-139760344 CAGGCCAAACACTGTGGAGGAGG - Intronic
1199751847 X:150827063-150827085 TAGGCCTAACAATGTGGAAGAGG - Intronic
1200360527 X:155601007-155601029 GAGGCCACACCCTGTGGGGGAGG + Intronic