ID: 1198734060

View in Genome Browser
Species Human (GRCh38)
Location X:139767002-139767024
Sequence TGTACATTCTGCACTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198734060_1198734062 -1 Left 1198734060 X:139767002-139767024 CCAACAGGAGTGCAGAATGTACA 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1198734062 X:139767024-139767046 ACCAGAGAAAGGAGTGATAGTGG 0: 1
1: 0
2: 2
3: 23
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198734060 Original CRISPR TGTACATTCTGCACTCCTGT TGG (reversed) Intronic
900287087 1:1906990-1907012 TGTACATTCTGGACTCCCTGAGG - Intergenic
902994901 1:20216792-20216814 TGCCCTTTCTGCACTCCTCTGGG + Intergenic
903255226 1:22093310-22093332 TGTTCAAGCTGCACTCCAGTTGG - Intergenic
905379991 1:37555055-37555077 TGAACTTTCTGCAATGCTGTTGG + Intergenic
908246435 1:62230954-62230976 TGTACCTTCTGCAAGGCTGTGGG + Intergenic
910059757 1:83075910-83075932 TTTAAAATGTGCACTCCTGTGGG + Intergenic
910114485 1:83716945-83716967 TGGACCTGCTGAACTCCTGTTGG - Intergenic
911116390 1:94250181-94250203 TGTCCACTCTGCTCCCCTGTGGG - Intronic
911573866 1:99550967-99550989 TGTAGATTCTCATCTCCTGTGGG + Intergenic
911860211 1:102937626-102937648 TTTAAAGTCAGCACTCCTGTAGG + Intronic
916289530 1:163149124-163149146 TGTACTTTATGCAGGCCTGTTGG + Intronic
916599406 1:166277170-166277192 TTTCCATTCTGCAGTCTTGTAGG + Intergenic
919372128 1:196740902-196740924 TGAATATTCTGGACTGCTGTGGG + Intronic
919868739 1:201804087-201804109 TGTTCATTCTAGACTCCTGGAGG + Intronic
920340804 1:205274093-205274115 TGGACATTCTGCAGTTCTGTGGG + Intergenic
923789457 1:237099586-237099608 TGTACATTATGCCCTCCCCTTGG - Intronic
1064486048 10:15791589-15791611 TGTACATACTGTAATGCTGTTGG + Intronic
1068018102 10:51543597-51543619 TGCACATTCTGCACAACTGGTGG - Intronic
1069091245 10:64201321-64201343 TGTATATACTGCACTACTGAGGG + Intergenic
1072199870 10:93148945-93148967 TGTCCGTTCTGCTCTCCTTTGGG + Intergenic
1072700497 10:97637710-97637732 TGTACATTCTACACTTTTGAAGG + Intronic
1073175903 10:101557568-101557590 TGTAAATTCTGCATTCAGGTTGG - Intergenic
1080811601 11:35709753-35709775 TGTTCACTCAGCACTCCTGGGGG + Intronic
1082255280 11:50027239-50027261 TTTACCTTCTGTACACCTGTAGG - Intergenic
1082698928 11:56403233-56403255 TGTTCACTCAGCACTCCTGCGGG + Intergenic
1083430160 11:62610158-62610180 TGTACATTCTCGACTCCCTTTGG - Intronic
1084848978 11:71923128-71923150 TGCGCATCCTGCACTTCTGTGGG + Intronic
1087513352 11:99126722-99126744 TGAAAATTCTACATTCCTGTCGG + Intronic
1088335257 11:108696614-108696636 TCTGCATTCTGTGCTCCTGTGGG + Intronic
1088692494 11:112339619-112339641 TGTACAGGCTGCCCTGCTGTTGG + Intergenic
1089643362 11:119862202-119862224 TGTACATTCTACCCTCTTCTTGG - Intergenic
1090330077 11:125924523-125924545 AATACATCCTGCTCTCCTGTAGG - Intergenic
1094376354 12:29792800-29792822 TGTGCATGCTGCACGCATGTAGG - Intergenic
1098157530 12:67615003-67615025 TTCACAGTCTGCACTTCTGTGGG - Intergenic
1101064192 12:101002344-101002366 TGTGCATTATTCACTCCTGCAGG - Intronic
1103184148 12:118941806-118941828 TGTACAGTCTGCAGAACTGTGGG + Intergenic
1110406571 13:75157243-75157265 TGTGAATTATGCACTCCTTTAGG - Intergenic
1110635970 13:77767388-77767410 TGTACACTCTGCAGAACTGTGGG - Intergenic
1112975633 13:105314172-105314194 TGGCCATTCTGAAATCCTGTGGG - Intergenic
1113077198 13:106478657-106478679 TGTACAATGTGTACTCCTCTTGG + Intergenic
1113286504 13:108854967-108854989 TTTAGATTCTGCATTCATGTAGG - Intronic
1113697649 13:112357584-112357606 TATTCATTCTGCATTGCTGTAGG + Intergenic
1114065278 14:19054552-19054574 TCTACAGTCTGCGCTCCTGCTGG + Intergenic
1114096984 14:19345450-19345472 TCTACAGTCTGCGCTCCTGCTGG - Intergenic
1114975649 14:28094746-28094768 TTTACATTCTTGACTCCAGTGGG + Intergenic
1115676047 14:35675906-35675928 TGTACATTCTTTACTCCTAATGG + Intronic
1115898352 14:38116760-38116782 CTTACATTCTCCTCTCCTGTAGG - Intergenic
1116049728 14:39788202-39788224 TCTACATTCTACAGACCTGTAGG - Intergenic
1119632719 14:76247919-76247941 TGCACATCCTGAGCTCCTGTAGG + Intronic
1120530099 14:85621755-85621777 TGTACATTGTGCAGTTCTGCAGG - Exonic
1121467774 14:94127118-94127140 TGTACAGTCTGCAGAACTGTGGG + Intergenic
1125523212 15:40359336-40359358 TGTACATTCTGTACCCCAGAGGG + Intronic
1125896143 15:43303589-43303611 TGTCCATTCAGCACTCCTGGAGG + Intergenic
1127704882 15:61536745-61536767 TGTACGTTCACCTCTCCTGTTGG + Intergenic
1132704036 16:1234197-1234219 TGAACATTTTGCATTACTGTGGG + Intergenic
1132707485 16:1252223-1252245 TGAACATTTTGCATTACTGTGGG - Intergenic
1132918146 16:2365862-2365884 TGTTCCTTCTGCAGTCTTGTTGG + Intergenic
1140628814 16:76827575-76827597 TTGACATTCAGCACTTCTGTGGG + Intergenic
1140682569 16:77399906-77399928 TGTACAATCTGGAATCCTATAGG + Intronic
1144456633 17:15424036-15424058 TGTCCATTCTGCTCTGGTGTGGG + Intergenic
1144867372 17:18345183-18345205 TGTGCAGGCTGCAGTCCTGTGGG - Intronic
1146830688 17:36066566-36066588 TGTACATCCTGAACCCCTGGGGG - Intronic
1147961049 17:44167815-44167837 TGCCCAATCTGCACTCCTGAAGG - Intergenic
1149595137 17:57860873-57860895 TGTGCCTCCTGCACTCCTGCAGG - Intergenic
1150954260 17:69839108-69839130 TGTAAATTCTGCATTCCTCCTGG + Intergenic
1152384757 17:79965639-79965661 TGTCCATCCTGCCCTGCTGTGGG - Intronic
1153512322 18:5869251-5869273 GGTATCTTCTGCACTCTTGTCGG - Intergenic
1153842704 18:9021355-9021377 TGTACAATGTCCTCTCCTGTTGG + Intergenic
1157555508 18:48610560-48610582 TGTACCTTCCACACTCCTGCGGG + Intronic
1160172327 18:76565526-76565548 TGTGCATGCGGCACTCATGTGGG + Intergenic
1161302046 19:3547532-3547554 TGTACAGTATGCCCACCTGTGGG + Exonic
1165701810 19:37943973-37943995 TCTACATACTGCTCTGCTGTTGG - Intronic
925141874 2:1556530-1556552 GGCACATTTTGCATTCCTGTTGG - Intergenic
926404763 2:12539942-12539964 TGTACATAATTCACTCCTCTTGG + Intergenic
926521554 2:13922240-13922262 TGTTCACTCTGCACACCTGGGGG - Intergenic
929022082 2:37563451-37563473 TTTTCATTCTGCACACTTGTAGG + Intergenic
930005301 2:46891883-46891905 AGTAGATTCTTCAGTCCTGTGGG + Intergenic
930255764 2:49088466-49088488 TCTAGATTCTGCACCCCGGTTGG + Intronic
932965685 2:76472334-76472356 TGTTCACTCAGCACTCCTGGGGG - Intergenic
933445752 2:82377876-82377898 TTTCCCTTCTGCACTCCTCTAGG - Intergenic
933493289 2:83016344-83016366 TGTACATTTTGCACCCATATGGG - Intergenic
935844444 2:107149511-107149533 GGTACCTACTGCACTCCAGTAGG - Intergenic
942271097 2:174276174-174276196 TGTACATTTTTCCATCCTGTTGG + Intergenic
942412646 2:175727218-175727240 TGTGCATTCTGCATTCCAGATGG - Intergenic
942672539 2:178391241-178391263 TGTCCATAGTGCCCTCCTGTTGG - Intronic
943140983 2:183980858-183980880 TTTACATTCAGCACTCAGGTGGG - Intergenic
944401373 2:199329867-199329889 TTTCCATTCTGCACACTTGTTGG + Intronic
946495864 2:220194735-220194757 TTGTCATTCTGCACTCCTGTGGG + Intergenic
946515006 2:220402328-220402350 CTTACATTCTGCACACCTGCAGG - Intergenic
948914120 2:241022153-241022175 GGTACATTCTCCCATCCTGTGGG + Intronic
1171192850 20:23171803-23171825 GGAACATTCTACACTGCTGTTGG - Intergenic
1171902124 20:30867961-30867983 TGAACATTCTGCAGGCCTCTAGG + Intergenic
1172513580 20:35517057-35517079 TCTACATTCCCCTCTCCTGTTGG + Exonic
1178233179 21:30811124-30811146 TGTACCTCCTGTACTCCTTTGGG + Intergenic
1180103704 21:45602699-45602721 TGTATATTCTGTACAGCTGTTGG + Intergenic
1180335500 22:11573896-11573918 TGAACATTCTGCAGGCCTCTAGG + Intergenic
1180483769 22:15777172-15777194 TCTACAGTCTGCGCTCCTGCTGG + Intergenic
1184318874 22:43723648-43723670 CTTACATTCTGCACACCTGCAGG + Intronic
949632542 3:5944171-5944193 TGTACAGACTCCACTTCTGTGGG - Intergenic
951186793 3:19722953-19722975 TGTTCATTCAGCACTTCTGGGGG - Intergenic
951804766 3:26632034-26632056 TGGACACTCTGCAGTCCTGAGGG + Intronic
953423562 3:42773471-42773493 TGCCCATTCCGCTCTCCTGTTGG + Intronic
955171421 3:56569306-56569328 TGTACAGTCTGCAAAACTGTGGG - Intronic
955224450 3:57049560-57049582 AGAACATTCTGCATCCCTGTAGG - Intronic
957909997 3:86608096-86608118 CATGCATTCTGCACACCTGTAGG + Intergenic
959148816 3:102583303-102583325 TGTTTGATCTGCACTCCTGTTGG - Intergenic
959480010 3:106860159-106860181 TGTGCATTTTGCCCTCATGTTGG + Intergenic
962507298 3:136060650-136060672 TGTACAGTCTGCAGAACTGTGGG + Intronic
962968516 3:140376715-140376737 TGTAGATACTGCTCTCCTGTTGG - Intronic
963952230 3:151215589-151215611 TGTATATTCTTCACTGATGTCGG + Intronic
964844217 3:161028309-161028331 TCTACATTCTGTTTTCCTGTAGG - Intronic
965952222 3:174324008-174324030 TGTAGATTCTGCAATCATGATGG - Intergenic
966413318 3:179665166-179665188 TGTGCACTCTGCACTGCAGTTGG + Intronic
967992308 3:195140524-195140546 TGTACAGTCTGCAGAACTGTGGG - Intronic
970007622 4:11426856-11426878 TGTTATTTCTGCAATCCTGTGGG + Intronic
971971481 4:33626154-33626176 TCCACATTCCGCACTCCAGTAGG - Intergenic
972818772 4:42675362-42675384 TGTTCATTCAGCACTGCTGGGGG - Intergenic
974074509 4:57156484-57156506 TGCACTTGCTGTACTCCTGTGGG - Intergenic
976794383 4:88915990-88916012 TGTACATCCTGCAGAACTGTGGG + Intronic
976946842 4:90780909-90780931 TGTACAGTCTGCAGAACTGTGGG - Intronic
977349847 4:95869108-95869130 TGTAGATTCTGTATTCCTTTCGG + Intergenic
978511554 4:109525268-109525290 TGTAGAATCTGTACTACTGTTGG + Intronic
978612543 4:110559450-110559472 AGTACACTCTGCACTTCTTTTGG - Intronic
984789250 4:183599885-183599907 TGTACATTGGGCACACCTTTAGG + Intergenic
986421667 5:7590745-7590767 TTTACATTATGGATTCCTGTGGG - Intronic
993863519 5:93165675-93165697 TTTAAAGACTGCACTCCTGTTGG - Intergenic
994400398 5:99272672-99272694 TGCACTCTCTGCACTCCCGTGGG + Intergenic
996604112 5:125300811-125300833 TGGATATTCTGCCATCCTGTTGG + Intergenic
999914895 5:156247765-156247787 TGTACTTTTTGCTCTCATGTTGG + Intronic
999940491 5:156537336-156537358 AGTACCTTCTGCATTCCTGGTGG + Intronic
1011283633 6:85702098-85702120 TGTACACACTGCATTCCTGGGGG - Intergenic
1012634516 6:101519767-101519789 TGTAAATTCTGAACTTCTCTTGG + Intronic
1012899438 6:104990268-104990290 TGTATATTCTGCAGTTCTGCAGG + Intronic
1013738775 6:113259240-113259262 TGTGCATTCTGCACCTCTGTGGG + Intergenic
1014829630 6:126087236-126087258 TGTTCTTCCTGCACTCCAGTGGG - Intergenic
1016006885 6:139098493-139098515 TGTAGAAGCTGCACCCCTGTGGG - Intergenic
1016854292 6:148651114-148651136 TGTTCACTCAGCACTCCTGGGGG - Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1020390208 7:7649664-7649686 TATACATTCTGTATTCTTGTTGG + Intronic
1020646795 7:10824539-10824561 TGTTCACTCAGCACTCCTGGGGG - Intergenic
1021510851 7:21430303-21430325 TGTGCATTCTGCATTCCATTAGG - Exonic
1024848767 7:53683877-53683899 TCCACATTCTGCACTCCATTTGG - Intergenic
1025707184 7:63876912-63876934 TGCACATTCTTCACTATTGTAGG - Intergenic
1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG + Intronic
1036074413 8:5478945-5478967 TGTACATGCTGGTCTCATGTAGG - Intergenic
1036455090 8:8899573-8899595 TGTGCTTTCTGAACTCCTGAAGG - Intergenic
1038003398 8:23409602-23409624 TGTACACTGTACACTGCTGTGGG - Intronic
1039190806 8:34971907-34971929 TGGTAACTCTGCACTCCTGTTGG - Intergenic
1039506501 8:38056373-38056395 TGTCCTTACAGCACTCCTGTGGG - Intronic
1039769050 8:40664373-40664395 TGTACACACTGCTCTCTTGTTGG + Intronic
1042501474 8:69514225-69514247 TGTACAGTCTGCAGAACTGTCGG - Intronic
1048464367 8:134652923-134652945 TGTACATTGTGCATTCACGTTGG - Intronic
1048962751 8:139594092-139594114 TGTACAGTCTGCATTCCCTTAGG - Intergenic
1052135376 9:24903070-24903092 TCTACATACTTCACTCCTCTAGG - Intergenic
1057741496 9:97715733-97715755 TATATATTGTGCACTCCTTTTGG + Intergenic
1057919465 9:99084993-99085015 AGTTCTTTCTGCCCTCCTGTGGG + Intergenic
1059406129 9:114099021-114099043 TGTACCATCTGCCCTTCTGTCGG - Exonic
1061158459 9:128879581-128879603 TGTATATTCTCCAATCCTGTTGG + Intronic
1186845375 X:13525499-13525521 TCTACATTCTGCCCGTCTGTAGG + Intergenic
1189251778 X:39605993-39606015 TGTGGATTCTGAGCTCCTGTTGG + Intergenic
1193979576 X:88165358-88165380 TGTTCACTCAGCACTCCTGGAGG - Intergenic
1194798862 X:98246369-98246391 TATACCTTCTGTACTACTGTTGG + Intergenic
1195175501 X:102311495-102311517 TGTGCATGCTGCACCCCTTTGGG - Intronic
1195183363 X:102375598-102375620 TGTGCATGCTGCACCCCTTTGGG + Intronic
1198149262 X:133892289-133892311 TGTACATTCTACTTTCCTCTTGG + Intronic
1198153456 X:133933816-133933838 TGTACAGTCTGCATAACTGTGGG + Intronic
1198498095 X:137214152-137214174 TGTTCACTCAGCACTCCTGGGGG - Intergenic
1198734060 X:139767002-139767024 TGTACATTCTGCACTCCTGTTGG - Intronic
1200848235 Y:7854243-7854265 GTTACATTCTTCACTCTTGTAGG + Intergenic