ID: 1198734928

View in Genome Browser
Species Human (GRCh38)
Location X:139775101-139775123
Sequence CTCATTCTGAGTGTTGTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198734923_1198734928 11 Left 1198734923 X:139775067-139775089 CCTTATCACGGTTGACTTTCATA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1198734928 X:139775101-139775123 CTCATTCTGAGTGTTGTCTCGGG 0: 1
1: 1
2: 1
3: 11
4: 161
1198734922_1198734928 18 Left 1198734922 X:139775060-139775082 CCTGACACCTTATCACGGTTGAC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1198734928 X:139775101-139775123 CTCATTCTGAGTGTTGTCTCGGG 0: 1
1: 1
2: 1
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198734928 Original CRISPR CTCATTCTGAGTGTTGTCTC GGG Intronic
900531840 1:3157753-3157775 GTCCATCTGGGTGTTGTCTCTGG - Intronic
903310348 1:22450796-22450818 GTCGTTCTGAGAGCTGTCTCTGG - Intergenic
906951547 1:50338137-50338159 TTCACTCTTGGTGTTGTCTCTGG + Intergenic
910429631 1:87148264-87148286 TTCACTCTTAGTGTTGTCTTAGG - Intronic
912378936 1:109236085-109236107 CACATTGTGAATATTGTCTCAGG + Exonic
913705247 1:121415034-121415056 CTTTGTCTGAGTGTTTTCTCTGG + Intergenic
914337249 1:146726177-146726199 CTCTCACTGAGTGTTGGCTCTGG - Intergenic
915955638 1:160217905-160217927 CCCATTCTGTGTATTGTCTGTGG - Intronic
916844066 1:168630461-168630483 CTTTTTCTGAGTGTTTTCTGGGG + Intergenic
917442195 1:175077938-175077960 CTCATTCTGGGTTTTCTCTAGGG + Intronic
917994137 1:180417398-180417420 AGCATTCTGAGTGATTTCTCTGG + Intronic
918219877 1:182427177-182427199 GTCATTCTGAAAGTTGACTCAGG - Intergenic
918365678 1:183805280-183805302 TTCATTCTCAGTTTTCTCTCCGG - Intronic
919181067 1:194082859-194082881 ATCATTCTGAGTGTTGTGTAGGG + Intergenic
921092090 1:211853786-211853808 CCTTTTCAGAGTGTTGTCTCTGG + Intergenic
922898921 1:229121475-229121497 CTCATCCAGAATGTTCTCTCAGG - Intergenic
924472933 1:244359311-244359333 CCCATTCTGTGGGTTGCCTCTGG - Intronic
1063179313 10:3583645-3583667 CTCATTCTGCCTTTTGTCTACGG - Intergenic
1063337781 10:5233258-5233280 CTCATTCTGTGGGTTGCCTTCGG - Intergenic
1063872698 10:10435891-10435913 TTCATTCTAAGTGTTCACTCTGG - Intergenic
1065112694 10:22455364-22455386 TTCTTTCTGAGGGTTGTTTCCGG - Intergenic
1065185628 10:23168404-23168426 CTCAATCTGAGTGGTATCACTGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065726522 10:28672515-28672537 CTCTTTCTGTGTGTTCTTTCTGG + Intergenic
1069313838 10:67073056-67073078 CTTATTCTGAGTGTGGTCTGAGG - Intronic
1073337347 10:102719583-102719605 CCCATTCTGTGTGTTCTCACTGG + Intronic
1079141919 11:17816754-17816776 CTGATTCTGGATCTTGTCTCAGG - Intronic
1079311121 11:19366776-19366798 CACATTCTCAGTGTTTTCTCAGG - Intronic
1081206874 11:40285752-40285774 CTCAATCTGAATGTTTTCACTGG - Intronic
1087457756 11:98408722-98408744 CTCATTTTCAGTTTTGTCTGTGG - Intergenic
1087850523 11:103023091-103023113 CTCATTCTGAATGTTATGCCAGG - Intergenic
1089293745 11:117455551-117455573 CTCAGTCTGAGCGTGGTTTCAGG - Intronic
1090265933 11:125352931-125352953 CTCCTTCTGAACTTTGTCTCGGG - Intronic
1091067426 11:132529140-132529162 CTCATTCACAGTGATGTCTGAGG + Exonic
1092520900 12:9271781-9271803 CTCCTTCTCAGTATTGTCCCTGG - Intergenic
1093290179 12:17310008-17310030 CTCATTCTGTGTGCTGCTTCAGG + Intergenic
1093363133 12:18257040-18257062 CTCTTTCTGATAGTTGTGTCAGG - Intronic
1095611112 12:44129114-44129136 CTCAGCATGAGTGTTGTCCCTGG + Intronic
1096844962 12:54401409-54401431 CTCCTTCTGAGGCTGGTCTCGGG + Exonic
1100586611 12:95986418-95986440 CTAATTCTGAGTGGTGGCTAAGG - Intronic
1106778096 13:33027758-33027780 GCCATTCTGAGTGTTGTGTAGGG - Intronic
1112896425 13:104305437-104305459 CTGAGTCTGAGAATTGTCTCAGG + Intergenic
1117923410 14:60749777-60749799 CTCATTCTATTTGCTGTCTCAGG - Intronic
1122313437 14:100811819-100811841 CTCAAGCTGTGTGTTGTCTGAGG + Intergenic
1124409190 15:29421956-29421978 CTCATTCTGAGTTCTCTTTCAGG - Intronic
1125095985 15:35852175-35852197 CTCATTCTGTGTGAAGTCACAGG + Intergenic
1126225935 15:46269135-46269157 CACATTCTGTGTGTAGTCTGTGG + Intergenic
1126788181 15:52196194-52196216 CTGATTCTGTGTGTACTCTCGGG - Intronic
1127080773 15:55377334-55377356 CTAATTCTGAGAGTTGTCAAGGG - Intronic
1129006145 15:72375398-72375420 CCAATTTTGAGTGTTTTCTCTGG + Intronic
1129997338 15:80017824-80017846 CTCTTTTTCAGTGTTGTGTCCGG - Intergenic
1131345309 15:91642180-91642202 CTCATTCTGATTTTTTTTTCTGG + Intergenic
1131578667 15:93618426-93618448 CTCATTCTGAATTTTGCCTTTGG - Intergenic
1131717566 15:95130080-95130102 TTCATTCTGAGTATTTCCTCTGG - Intergenic
1136027682 16:27480343-27480365 CACATTCTGGGTTTTGTTTCTGG - Intronic
1139676598 16:68528156-68528178 CTCACAGTGAGTGTTGTGTCCGG - Intergenic
1139997024 16:70991142-70991164 CTCTCACTGAGTGTTGGCTCTGG + Intronic
1140261070 16:73380289-73380311 CTAATTCTGAGAGATGTCTATGG - Intergenic
1140709317 16:77661932-77661954 GGCTTTCTGAGTGTGGTCTCAGG + Intergenic
1141099847 16:81189216-81189238 GTTATTCTGAGTGTTGGCTCGGG + Intergenic
1141873157 16:86803489-86803511 CTCATTCTGACAGTGGTCTCTGG - Intergenic
1143280710 17:5752245-5752267 CACATTTCGAGTGTTATCTCTGG + Intergenic
1145985431 17:29042880-29042902 CTCATTATGATCTTTGTCTCAGG - Exonic
1148663025 17:49351600-49351622 CTCATATTGAGAGATGTCTCAGG + Intronic
1148860787 17:50603346-50603368 CGTAATCTGAGTGTTGTCTGGGG - Intronic
1149592893 17:57845428-57845450 CTTATTCTTACTGTTGTTTCAGG - Intronic
1154076980 18:11213007-11213029 CTCATTCTGATTGTCCTCCCTGG + Intergenic
1159713058 18:71787245-71787267 CTCATTCTGATTATTGACTTGGG - Intronic
1159845498 18:73454747-73454769 CGCATTCTGTGTCTTTTCTCAGG + Intergenic
1159968316 18:74618520-74618542 CTGATTCTGAGTTTAGTCTGAGG + Intronic
1161036542 19:2088091-2088113 CTCATACTGGGTGATGTCTGGGG + Intronic
1161303476 19:3554725-3554747 CTGATTCTGAGGGTCGTCTCGGG + Intronic
1164453223 19:28384484-28384506 CTCGTTCTGAGGGCTGTCTTGGG + Intergenic
1167061077 19:47146846-47146868 CTGCTTCTGTGTGCTGTCTCCGG - Intronic
1168037879 19:53734661-53734683 ATCCTCCTGAGTTTTGTCTCTGG - Intergenic
1168039522 19:53746902-53746924 ATCCTCCTGAGTTTTGTCTCTGG - Intergenic
1168040732 19:53756528-53756550 ATCCTCCTGAGTTTTGTCTCTGG - Intergenic
1168041274 19:53760915-53760937 ATCCTCCTGAGTTTTGTCTCTGG - Intergenic
925293467 2:2763260-2763282 CTCAGCCTGAGGTTTGTCTCTGG - Intergenic
928604439 2:32932480-32932502 CGAGTTATGAGTGTTGTCTCTGG + Intergenic
929664706 2:43824708-43824730 CTCATTCTGATAGTCATCTCTGG + Intronic
930356906 2:50332790-50332812 CTCAGCCTGAGTGTTTTCTTGGG + Intronic
933740120 2:85526708-85526730 CTCCTTCTGAGTGTTCCCTTGGG + Intergenic
934092460 2:88564696-88564718 CACATTCTAGGTGTTGTTTCAGG + Intronic
938703811 2:133902305-133902327 CTTATCCTGAGTGTTGTTGCTGG + Intergenic
940011485 2:149059809-149059831 TTTATTCTGAGTGTTCTCCCAGG - Intronic
942746195 2:179235996-179236018 CTCACCTTGAGTGTTGTGTCAGG - Intronic
943371230 2:187018673-187018695 CTCATTTTAAATATTGTCTCTGG - Intergenic
944220895 2:197303120-197303142 CACATCCTGAGTTTTGTCTAAGG - Intronic
946011625 2:216569221-216569243 CTCACTCTGGCTGTTGTCTGGGG + Intronic
948366038 2:237455399-237455421 CTCAGTCTGAGAGCTCTCTCTGG + Intergenic
1171220122 20:23388955-23388977 CTCATTCTGTGGGTTGTCTCTGG - Intronic
1171429743 20:25074925-25074947 CTCATTATGGGTGCAGTCTCAGG + Intronic
1171429768 20:25075162-25075184 CTCATTGTGAGGGCTTTCTCTGG - Intronic
1175317337 20:58058196-58058218 CTAATACAGAGTGTTTTCTCTGG - Intergenic
1176225875 20:63998934-63998956 CTCCTTCTGACTGCTCTCTCAGG + Intronic
1177383387 21:20375031-20375053 TCAATTCTGAGTGTTGTCTATGG + Intergenic
1178448294 21:32665624-32665646 CACATACTGACTGATGTCTCAGG + Intronic
1184658573 22:45954790-45954812 CCCATTCTGAGGGTTAACTCTGG + Intronic
949962132 3:9321169-9321191 CTGATTCTGACTGTTGGCTGAGG - Intronic
950051491 3:9994006-9994028 ACCATTCTGAGTTTTCTCTCAGG - Intronic
951109557 3:18785961-18785983 CTCCTTCAGAGAGTTTTCTCTGG - Intergenic
951804309 3:26627649-26627671 CTCAGTCTGCGTTTTGTGTCAGG + Intronic
953338849 3:42117118-42117140 CACATTCTGAGGGCTGTGTCTGG - Intronic
954914793 3:54139528-54139550 CTCATTCTTAGAGTTGTGTATGG + Intronic
958684693 3:97378127-97378149 CCCATTCTGTGTGCTGTCTAGGG + Intronic
964734835 3:159906343-159906365 CTCATTCTTCTTGTTTTCTCGGG + Intergenic
966967742 3:185012626-185012648 ATCATTCTTATTGTTGTCTTTGG - Intronic
967604676 3:191431474-191431496 CTCATTCTCAGTCTTGATTCTGG - Intergenic
967822945 3:193855122-193855144 CTCCTGCTGAGTTTTGGCTCAGG + Intergenic
970431787 4:15995488-15995510 TTCATTCTGAGTGTTGTCTCAGG + Intronic
977700766 4:100020297-100020319 CTCATTATGATGGTTGGCTCAGG - Intergenic
978232985 4:106423408-106423430 CCAAGGCTGAGTGTTGTCTCGGG + Intergenic
978971880 4:114817982-114818004 CTTATTCTCAGTGTTTACTCAGG + Intergenic
987145977 5:14992269-14992291 GACATTCTGACTTTTGTCTCAGG + Intergenic
987227050 5:15853153-15853175 GTGATTCTGAGTGTGGACTCTGG - Intronic
987673066 5:21038733-21038755 CTCATTCTGAGTCTTGTGAAAGG - Intergenic
989351219 5:40488921-40488943 CTACTTCTGAGTGTTGTCCTGGG + Intergenic
989973527 5:50553845-50553867 CTTTGTCTGAGTGTTTTCTCTGG - Intergenic
994590734 5:101768892-101768914 CTCCTGCTGTGTGTAGTCTCAGG + Intergenic
995925833 5:117372243-117372265 CTCATTCTGATTTTAGTCTTAGG + Intergenic
995956569 5:117783806-117783828 TTCATTATCAGTGCTGTCTCAGG - Intergenic
996518420 5:124399358-124399380 CTCTCTCTGTGTGTAGTCTCAGG + Intergenic
997264600 5:132487807-132487829 GTAATTCTGCATGTTGTCTCAGG + Intronic
997742875 5:136272980-136273002 CTCTTTCTGAGTCTTTTCCCAGG + Intronic
998690341 5:144580833-144580855 CTGATGCTAAGTGTTGCCTCTGG - Intergenic
999000476 5:147916262-147916284 CTCATTCTGATTTTGGCCTCAGG - Intergenic
999293028 5:150439895-150439917 TTCTTTCTGAGGGTTTTCTCTGG + Intergenic
1000945241 5:167414600-167414622 CTCTATCTGATTGTTGTGTCTGG + Intronic
1004140874 6:13015702-13015724 GTCATTATGAGTGCTGTCACTGG + Intronic
1005254495 6:23986252-23986274 CTCATTGTGAGTGCTGGCTATGG - Intergenic
1005919872 6:30391617-30391639 CTCATTCTGAGTTTGGGCTCTGG + Intergenic
1006714631 6:36108710-36108732 TTCTTTCTGAGAGTTGGCTCAGG + Exonic
1012499303 6:99871133-99871155 CTCATTCTGAGATATGGCTCGGG - Intergenic
1013483121 6:110569105-110569127 CTCATTCTGACTTTTGTCCGAGG + Intergenic
1015715948 6:136191930-136191952 CACTTTCTGAGTGTTGTCCTGGG + Exonic
1016940510 6:149479511-149479533 CTCATTCTGTCTGTAGGCTCCGG - Intronic
1017433964 6:154398230-154398252 GTCATCCTGAATGTTGTTTCTGG - Exonic
1019956856 7:4422687-4422709 GACATTCTGAGTATTGTATCAGG + Intergenic
1020400712 7:7774009-7774031 CTGATTCTCAGTGTTTTCTTAGG - Intronic
1020765921 7:12320914-12320936 CTCACTTTGAGGGTTGTCTCTGG - Intergenic
1021039679 7:15846493-15846515 CTCATTCTGATTGTTGCCTATGG - Intergenic
1021247757 7:18284812-18284834 CTCACTCTTACTGTTGTCCCAGG + Intronic
1023507855 7:40919091-40919113 CTCATTCTAAGTGTTCTTTCTGG + Intergenic
1024158638 7:46651648-46651670 CTGATTCTGAGTCTTTTCTTTGG + Intergenic
1024237033 7:47406627-47406649 CTCAGTCTGGGTGTTTTCTGAGG - Intronic
1025005073 7:55347459-55347481 GTCATTAAGAGTGTTGGCTCTGG - Intergenic
1028343206 7:89747839-89747861 CTCATTCTCTGTGTATTCTCGGG + Intergenic
1028396777 7:90378491-90378513 CTCATTCTTAGTTTTGTGACCGG + Intronic
1028676621 7:93471159-93471181 ATCATTCTTAGTGTTGTTTTTGG - Intronic
1030253052 7:107470124-107470146 CTGAATCTAAATGTTGTCTCTGG + Exonic
1031898920 7:127388741-127388763 CTTATTTTGAATGTTATCTCAGG - Intronic
1033029279 7:137809293-137809315 CTCATACTCATTGATGTCTCGGG + Intronic
1035608502 8:945320-945342 CTGATTCTGAGAATTGTTTCTGG - Intergenic
1037519408 8:19665430-19665452 CTCCTTCTGAGTTTTGGCCCCGG - Intronic
1040468058 8:47713533-47713555 CCCCTTTTGAGTGTGGTCTCTGG + Exonic
1048953370 8:139514308-139514330 CTCAACTTGAGTGTTGTCTCTGG - Intergenic
1050496527 9:6248007-6248029 CTAATACTGAGTGTGGACTCTGG - Intronic
1050639979 9:7657075-7657097 CTCAATCTGGGTGTTCTCCCTGG + Intergenic
1052101467 9:24451394-24451416 CTCATTCTGAACTTTGTCTATGG - Intergenic
1052396391 9:27943825-27943847 CTCCTTCTGTGGGCTGTCTCAGG + Intergenic
1054893891 9:70285314-70285336 CACATTCTGTGTGATTTCTCTGG - Intronic
1056214897 9:84397699-84397721 CTCTTTCTGAGGGGTCTCTCAGG + Intergenic
1056793315 9:89639996-89640018 CTCAGTCTGGGTGTTATCTTGGG + Intergenic
1056836200 9:89957574-89957596 CTCTTTCTGAATGGTGTCCCAGG + Intergenic
1058876562 9:109249878-109249900 GTCATTCTGCCTTTTGTCTCTGG - Intronic
1058949536 9:109890796-109890818 CTCACTCTGCGTGTGGCCTCAGG - Intronic
1203624560 Un_KI270750v1:626-648 ATCATTATGAGTGTTTTCTGAGG - Intergenic
1189180646 X:39001546-39001568 GTCATTGTGAGTGATGTCCCTGG + Intergenic
1190876700 X:54465237-54465259 CTCCTTCTGAATGTTCTCTTTGG - Intronic
1196691079 X:118559007-118559029 CTCTTTCTGAGTGCTCTTTCAGG + Intronic
1198096694 X:133386953-133386975 CTCCCTCTGAGTGTTGAATCAGG + Intronic
1198734928 X:139775101-139775123 CTCATTCTGAGTGTTGTCTCGGG + Intronic
1198968043 X:142248973-142248995 TTCCTTCTTAGTGTTGTCCCTGG + Intergenic
1200628695 Y:5554577-5554599 CCCATGCTGAGTGTTGCCTAGGG + Intronic