ID: 1198734990

View in Genome Browser
Species Human (GRCh38)
Location X:139775696-139775718
Sequence CCCTAGGTAAGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198734990_1198735000 12 Left 1198734990 X:139775696-139775718 CCCTCTGCCCTCCTTACCTAGGG 0: 1
1: 0
2: 3
3: 46
4: 262
Right 1198735000 X:139775731-139775753 TGGCGATATAGGAGCTTCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1198734990_1198735002 26 Left 1198734990 X:139775696-139775718 CCCTCTGCCCTCCTTACCTAGGG 0: 1
1: 0
2: 3
3: 46
4: 262
Right 1198735002 X:139775745-139775767 CTTCCCAGGGACAGAGATCCAGG 0: 1
1: 2
2: 5
3: 50
4: 409
1198734990_1198734998 1 Left 1198734990 X:139775696-139775718 CCCTCTGCCCTCCTTACCTAGGG 0: 1
1: 0
2: 3
3: 46
4: 262
Right 1198734998 X:139775720-139775742 AATGCCATCAGTGGCGATATAGG 0: 1
1: 0
2: 2
3: 2
4: 51
1198734990_1198735004 29 Left 1198734990 X:139775696-139775718 CCCTCTGCCCTCCTTACCTAGGG 0: 1
1: 0
2: 3
3: 46
4: 262
Right 1198735004 X:139775748-139775770 CCCAGGGACAGAGATCCAGGTGG 0: 1
1: 1
2: 2
3: 69
4: 1118
1198734990_1198734996 -8 Left 1198734990 X:139775696-139775718 CCCTCTGCCCTCCTTACCTAGGG 0: 1
1: 0
2: 3
3: 46
4: 262
Right 1198734996 X:139775711-139775733 ACCTAGGGCAATGCCATCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 121
1198734990_1198735001 13 Left 1198734990 X:139775696-139775718 CCCTCTGCCCTCCTTACCTAGGG 0: 1
1: 0
2: 3
3: 46
4: 262
Right 1198735001 X:139775732-139775754 GGCGATATAGGAGCTTCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198734990 Original CRISPR CCCTAGGTAAGGAGGGCAGA GGG (reversed) Intronic
900512327 1:3066617-3066639 CCCTAGGGAAGAAGGGCAGGAGG - Intergenic
900526652 1:3132578-3132600 CCCTCGGTAAGGAGGAAGGAAGG - Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
903115420 1:21175886-21175908 CCTTAGGGGAGGAGGGGAGAAGG + Intronic
903185260 1:21625184-21625206 GCCTAGGCTGGGAGGGCAGATGG - Intronic
903580660 1:24368156-24368178 CCCTAGACCTGGAGGGCAGAAGG + Intronic
904563172 1:31412335-31412357 CCCTAGCTAAGGAGGTCAGAAGG - Intronic
904924913 1:34039809-34039831 CCCTGGGTAATTAGGGCAGGGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907495732 1:54843097-54843119 CCCTGGGGAAGGAGGGCACAGGG - Intergenic
908455094 1:64296252-64296274 CCCTGGGTCATGAGGGCACAGGG - Intergenic
908780886 1:67688640-67688662 CCCTAGTTACAGAGGGCAAAGGG + Intergenic
911038598 1:93574736-93574758 CCCTAGGGCAGGAGGGAAAAAGG + Intronic
911070103 1:93825635-93825657 CCCTGGGGAAGGAGGGTGGAAGG - Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912716063 1:111984488-111984510 CCCGTGGGAAGGAGGCCAGAGGG - Intronic
914730746 1:150368092-150368114 CCCGAGGTAGGCAGAGCAGATGG - Intronic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
920285315 1:204874647-204874669 GCCTAGGTGGGGAGGGTAGAAGG - Intronic
920555185 1:206899322-206899344 CGCCAGCAAAGGAGGGCAGAAGG - Exonic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921369028 1:214402866-214402888 CCACAGGTAAGGCAGGCAGAGGG - Exonic
921601318 1:217109678-217109700 CCCTTGGTGAGGAGAGCAGGTGG - Intronic
922352790 1:224748017-224748039 CCCAAGGGAAGCAGGGGAGAAGG + Intergenic
922852388 1:228744568-228744590 TCCTAGGTAACGAGGGCAACAGG + Exonic
923147758 1:231209892-231209914 ACCTCTGTTAGGAGGGCAGATGG + Intronic
923347317 1:233066863-233066885 TCCTGGGTAAGGAGGCCACATGG + Intronic
923521148 1:234735789-234735811 GCCTTGGTATGGAAGGCAGAAGG - Intergenic
924455517 1:244216096-244216118 GCCTAGGCAAGGTTGGCAGAAGG + Intergenic
1062978529 10:1702661-1702683 CCCTGGGGAATGGGGGCAGAAGG - Intronic
1062979805 10:1712646-1712668 CCCCAGGGAAGGAGGGCACTGGG + Intronic
1063786691 10:9393217-9393239 ACCTAGGTAAGAAGCCCAGAAGG + Intergenic
1065811508 10:29447734-29447756 CCCTAGGAAAGGAGAGGGGAAGG - Intergenic
1066668598 10:37812731-37812753 CTCTAGATGAGGAGGGCATAAGG + Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1069855838 10:71440598-71440620 GGCCAGGAAAGGAGGGCAGAGGG - Intronic
1072944598 10:99798481-99798503 CCCCAGCTCAGGAGGCCAGAAGG + Intronic
1075346063 10:121682689-121682711 CCTTAGGAATGGATGGCAGAGGG - Intergenic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076891858 10:133288615-133288637 CCCTGGGCAAGGAGGGGAGCTGG + Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077384631 11:2263152-2263174 CCCTCCGAAAGGAGGGAAGAGGG - Intergenic
1077469908 11:2752636-2752658 CCCTTGGAAAGGAGGCCTGAGGG - Intronic
1077581275 11:3418802-3418824 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1078067671 11:8089038-8089060 CCCCACTTAAAGAGGGCAGAGGG - Intronic
1079348408 11:19672614-19672636 CCCAAGGGATGGAGGGCAGGAGG + Intronic
1079523334 11:21354924-21354946 CCCCAGGTAAGAAGGTCAGAAGG - Intronic
1080578771 11:33623982-33624004 CCCTAGGTCAAGAGGGTAGGAGG - Intronic
1080643003 11:34168789-34168811 CCCTGGGTTAGGTGGGCAGTTGG + Intronic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1083228748 11:61301692-61301714 CTCTAGCCAAGGAGGGCTGATGG - Intronic
1083764601 11:64835900-64835922 TCCATGGTAAGGTGGGCAGAGGG - Intronic
1083765108 11:64837981-64838003 GCCCTGGGAAGGAGGGCAGAAGG - Intronic
1083958288 11:65999251-65999273 CCCTATGTAAGGAGGAAAGAAGG + Intronic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084110926 11:67013764-67013786 CCCCAGGAAAGGAACGCAGACGG - Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085386861 11:76162607-76162629 CCCTGGAGAAGGAGGGCAGGTGG - Intergenic
1088827327 11:113506925-113506947 CCTTGGGGAATGAGGGCAGAAGG + Intergenic
1089007115 11:115101480-115101502 CCCGAGGAAAGAAGAGCAGAAGG - Intergenic
1089809800 11:121122268-121122290 CCCTTAGAAAGGAGGCCAGAGGG + Intronic
1091037085 11:132244098-132244120 CCCGAGCTCAGGATGGCAGAGGG - Intronic
1093131802 12:15400510-15400532 AACTAGGTAAGGATGGCAGTGGG - Intronic
1093253991 12:16842824-16842846 CCCTGGGTAAGCAGGGAAGCAGG + Intergenic
1094752573 12:33428981-33429003 ACCTAGGGAAGGAGGAGAGAGGG + Intronic
1096121027 12:49089659-49089681 TCCTAGGTAGGTAGGGCTGATGG - Exonic
1096215691 12:49796497-49796519 CCCTAGCTGGAGAGGGCAGAAGG + Exonic
1098883287 12:75938253-75938275 CCCTAAGTAAGGAGGGAACCAGG + Intergenic
1098952362 12:76654116-76654138 CCCTTGTTAAGGAGAGCAGATGG - Intergenic
1100404810 12:94263719-94263741 TCCAAGGTAGGGAGGGCAGCAGG - Intronic
1101945652 12:109134400-109134422 CCCCAGGAAAGGAGGGCATACGG - Intronic
1101985570 12:109443925-109443947 CGCTAGGGGAGGAGGGCAGATGG - Intronic
1102807141 12:115791989-115792011 CCACAGGAAAGGAGGGCTGAAGG + Intergenic
1102955937 12:117059049-117059071 GCCCAGGTAGGGAAGGCAGAGGG + Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103467834 12:121156142-121156164 CCCGAGGTAAGGAGGGGACCTGG + Exonic
1103507896 12:121453843-121453865 CCCTAGGAGAGGACGACAGAGGG + Intronic
1104074968 12:125380864-125380886 CCCTAGGCCAGAAGGACAGAAGG - Intronic
1107445830 13:40469750-40469772 CCCTAGGAAAGGTGGGCACAAGG + Intergenic
1116688972 14:48080678-48080700 GCCAAGATAAGGAGGGCAGACGG - Intergenic
1117094213 14:52281226-52281248 CACTAGGTAAGGAGGTGAGTTGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414784 14:55484739-55484761 CCTTAGGCAAGGAGGGGAGTGGG - Intergenic
1117638232 14:57769968-57769990 CCCTTGGCAAAGAAGGCAGATGG - Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118890694 14:69906138-69906160 CCCAAGGTAAGAAGGGCATGTGG - Intronic
1118964440 14:70567058-70567080 CCCTAGGTCATGAGGACAGAGGG - Intergenic
1119903346 14:78280771-78280793 CCCTTTGAAAGGATGGCAGAAGG - Intronic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122973456 14:105161676-105161698 CCCTAGGGAAGAAGGGGAGCTGG - Intronic
1124338303 15:28873593-28873615 CCCTAGAGAAGCAGGACAGATGG + Intergenic
1125221185 15:37337127-37337149 CCCATGGTAAGGAGGCCTGAAGG + Intergenic
1127224630 15:56917165-56917187 CCCCAGATACGGAGGGCGGACGG - Intronic
1127303775 15:57682657-57682679 CCCTGGCTAAGGAGTTCAGAAGG - Intronic
1127855423 15:62949931-62949953 CCCCAGGTAAGAAGGACTGAGGG + Intergenic
1127927017 15:63556571-63556593 CCCTAGGTGTTGAGGGCAGCTGG + Intronic
1128249909 15:66156673-66156695 CCCTGGTTAACGAAGGCAGAAGG - Intronic
1128328323 15:66739503-66739525 CCCTTGGTGAGGGGTGCAGAAGG + Intronic
1128347039 15:66860870-66860892 GCCTGGGGAAGGAGGGCAAAGGG + Intergenic
1129702170 15:77774330-77774352 CCCTGGGAGAGGTGGGCAGAGGG - Intronic
1132562232 16:601352-601374 CCCTAGGTGGGCTGGGCAGAAGG + Intronic
1132606523 16:795868-795890 ACCTAGGACAGGAGGGCAGCAGG - Intronic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1133873215 16:9708986-9709008 ACCTAGGTCAGGAGGCCAGAAGG + Intergenic
1134060738 16:11198132-11198154 TCCTAGGGTCGGAGGGCAGAAGG - Intergenic
1135149520 16:19993332-19993354 CACTAGGTACTGAGGGAAGATGG + Intergenic
1135469923 16:22721292-22721314 CCCTGGGGAAGGAGGCCAGGTGG + Intergenic
1135633581 16:24055356-24055378 CACTAGGGAAGGAAGGGAGATGG + Intronic
1138510177 16:57504096-57504118 CCCTTGGGACTGAGGGCAGAGGG + Intergenic
1139590879 16:67932116-67932138 CCCTCGGTACTGAGGACAGATGG + Exonic
1141312717 16:82930778-82930800 CCCTAGGTGAGAAGGGCAGTGGG + Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142967910 17:3592443-3592465 CCCTTGGCAAGGAGGGCAGGTGG - Intronic
1145065757 17:19760171-19760193 CCCTTGGGAAGGAGGGCCGCAGG - Intergenic
1145756575 17:27396210-27396232 CCAGAGCCAAGGAGGGCAGAGGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147161410 17:38571489-38571511 CCCCCAGTTAGGAGGGCAGAGGG + Intronic
1147459294 17:40558083-40558105 CCCCAGGTCTGGAGGCCAGAGGG - Intronic
1147685873 17:42286674-42286696 ACCCAGGTCTGGAGGGCAGAGGG - Intergenic
1148443673 17:47725239-47725261 CCCTAGGTGAGAAGGTAAGAAGG + Intergenic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1151141130 17:71993193-71993215 CTCTAGGAAAGGCTGGCAGATGG - Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1152094160 17:78263488-78263510 CCCTCGGCAGGGAGGACAGAGGG + Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152300835 17:79494687-79494709 GCCCAGGCAAGGAGGCCAGAGGG + Intronic
1153103206 18:1497650-1497672 CCCTGGGTCACAAGGGCAGAGGG + Intergenic
1154496976 18:14968816-14968838 CCATAGGAAAGGAGGTCAGTGGG + Intergenic
1156030184 18:32704269-32704291 CCCAAGTTATTGAGGGCAGAAGG + Intronic
1157086692 18:44587424-44587446 CCCTTTGAAAGGAGGGGAGATGG - Intergenic
1157337525 18:46752551-46752573 CCCTTGGTCAGGAGGGGAGAAGG - Intronic
1160070847 18:75626490-75626512 CCTTAGCTATGGAGGGCAGCTGG - Intergenic
1160491164 18:79337582-79337604 CCCTAAGGAAGGAGGGGAGCTGG - Intronic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160976608 19:1796025-1796047 CCCAAGGTGGGGCGGGCAGACGG - Intronic
1161281367 19:3447544-3447566 CCCTCGGAAAGCAGGGCTGAAGG + Intronic
1161285100 19:3464543-3464565 CCCTAGGCATGGAGGTCAGTTGG - Intronic
1161378952 19:3954438-3954460 CCAGAGGTCAGGAGGCCAGAAGG + Intergenic
1161567797 19:5013101-5013123 CCCCAGAGAGGGAGGGCAGAAGG + Intronic
1161945764 19:7435527-7435549 CCCGAGGTGATGAGGGCAGCGGG + Intronic
1163187978 19:15653005-15653027 CCCCAGGTAGGGAGGGGAGAAGG + Intronic
1164590837 19:29505985-29506007 CCCTAAGTGAGGAGGGTAGCAGG + Intergenic
1164768707 19:30791642-30791664 TGCTAGAGAAGGAGGGCAGAAGG - Intergenic
1166328328 19:42064903-42064925 CCCCAGGCATGGAGGGCAGGAGG - Intronic
1166533996 19:43560518-43560540 CACAAGCTGAGGAGGGCAGATGG + Intronic
1167918381 19:52761030-52761052 TCCATGGTTAGGAGGGCAGAAGG - Intergenic
1168417101 19:56176069-56176091 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417117 19:56176119-56176141 GCCTAGGCCAGGAGGGCACAGGG + Intronic
1168417130 19:56176169-56176191 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417144 19:56176219-56176241 GCCTAGGCCAGGAGGGCACAGGG + Intronic
1168417158 19:56176269-56176291 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417174 19:56176319-56176341 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417190 19:56176369-56176391 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417206 19:56176419-56176441 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417220 19:56176469-56176491 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417236 19:56176519-56176541 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417250 19:56176569-56176591 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417265 19:56176619-56176641 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168417279 19:56176669-56176691 GCCTAGGCCAGGAGGGCAGAGGG + Intronic
1168534589 19:57158457-57158479 CCCTAGGTAGAGAAGCCAGACGG - Exonic
925567481 2:5271918-5271940 CCCTAGTTAAGCAAGGCTGATGG + Intergenic
927721744 2:25387569-25387591 CCCTAGGTAGAGAGGGCAGAGGG - Intronic
927915641 2:26934373-26934395 ACTTAGGCAAGGAGGACAGAGGG - Intronic
931847853 2:66222801-66222823 CTCCAGGTAAGGATGGCAGTGGG + Intergenic
932895477 2:75635485-75635507 TCCTGGGTAAAGAGGGCTGAGGG - Intergenic
933395984 2:81731857-81731879 CACTAGGTATAGGGGGCAGAGGG - Intergenic
937093990 2:119224081-119224103 GCCTAGGGAAGGAAGGCACACGG - Intronic
937639573 2:124196218-124196240 CCCTAGGTGAGAAGGGCTAAGGG + Intronic
942791419 2:179765695-179765717 CCCTAGCAAGGGTGGGCAGATGG - Intronic
943046451 2:182866984-182867006 CCCAAAGTGAGGAGGACAGAGGG + Exonic
946061933 2:216950107-216950129 CTCTAGGGAATGAGGGCTGATGG + Intergenic
946360318 2:219215817-219215839 ACTTAGGTAATGCGGGCAGAGGG - Intronic
946967726 2:225055642-225055664 CCCTAGGTCAGAAGGGCAGTGGG - Intergenic
1170353309 20:15465794-15465816 CCAAAGGTAAGGTGGGCACATGG - Intronic
1170666710 20:18392992-18393014 CCCCATGTAAGAAGGGCAGGAGG + Intronic
1171134784 20:22686469-22686491 CCCTAGGCCAGGGGGGCAAAAGG - Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171430340 20:25079395-25079417 CCCGAGGAAAGGCAGGCAGAGGG + Intronic
1173151247 20:40568149-40568171 CCCTACGTAGGGAGTGCAGCTGG - Intergenic
1173234738 20:41234422-41234444 ACCAAGGTAAGGAGGATAGATGG - Intronic
1178627560 21:34230998-34231020 CCTCAGGCAAGGAAGGCAGATGG - Intergenic
1178883242 21:36465015-36465037 CCCTAGCAAAGCAGGGCAGTTGG - Intronic
1179503800 21:41826253-41826275 CCCCAGGGAAGGAAGGGAGATGG + Intronic
1180699307 22:17773132-17773154 CCCTGGGCAAGAGGGGCAGAAGG + Intronic
1181035699 22:20168837-20168859 CCCAAGGCCATGAGGGCAGAAGG + Intergenic
1181311796 22:21948925-21948947 CCCAAGGTCAGGAGGCAAGAAGG - Intronic
1181953648 22:26572549-26572571 CCCAAGATAAGGTGGGAAGAGGG - Intronic
1183433977 22:37782811-37782833 CCCTAGGTAGGGAGGGGATTTGG - Intergenic
1184382158 22:44151711-44151733 CCCCAGGAAAGGAAGACAGAGGG - Intronic
1184865147 22:47198107-47198129 CCCTCGGGAAGGAGGCCAGCAGG - Intergenic
1185172932 22:49304105-49304127 CCCTAGGTGAAGTGGGCTGAGGG + Intergenic
1185277780 22:49957174-49957196 CCCCAGGGAAGGAGGGAAGAGGG + Intergenic
951350328 3:21599758-21599780 CCATAGGTAGGGAGGGAGGAAGG - Intronic
952160988 3:30692841-30692863 CCCCAGGTAAGGATAGCAGATGG + Exonic
954044379 3:47916861-47916883 CCCTGGTTAAGGATGTCAGATGG - Exonic
955129969 3:56156534-56156556 CCCTAGGTAAGGGGTGGAGTTGG + Intronic
955691720 3:61597528-61597550 CCCTAGATAATGTGGGCAGCTGG - Intronic
956470930 3:69566200-69566222 GGCAAGGTGAGGAGGGCAGAAGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957054144 3:75431437-75431459 CCCTTGGAAAGGAGGGCAGAGGG + Intergenic
959921434 3:111872539-111872561 CCCTAGGCAATGAGAGCAGGAGG - Intronic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
963819873 3:149878294-149878316 GTCTAGGTAAGGAGGAAAGATGG + Intronic
964344637 3:155744106-155744128 GCCTCGGGAAGGAGGGGAGAGGG + Intronic
965464702 3:169013538-169013560 GCACAGGTAAGTAGGGCAGATGG - Intergenic
965853644 3:173062285-173062307 CACAAGGCAAGGAGGGAAGAAGG - Intronic
968107869 3:196015126-196015148 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
968650630 4:1758974-1758996 CCCCAGCAAAGGAGGGCACAGGG - Intergenic
968996943 4:3951744-3951766 CACATGGAAAGGAGGGCAGAGGG + Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
969817021 4:9694511-9694533 CACTTGGAAATGAGGGCAGAGGG - Intergenic
970004036 4:11393808-11393830 CCCTAGGAAAGCAGGGGAGTGGG + Exonic
971129858 4:23795793-23795815 CCCTAGCTGAGGATGACAGAGGG - Exonic
972730253 4:41788002-41788024 CCCCAGCTCAGGAGGGCACAAGG - Intergenic
972764601 4:42140925-42140947 CCCCAGCTAAAGAGGGCAGTGGG + Intronic
977053648 4:92162577-92162599 CCCCAGGTTGTGAGGGCAGAAGG - Intergenic
977354982 4:95934077-95934099 TCCTATGGCAGGAGGGCAGAGGG + Intergenic
978184155 4:105837287-105837309 CCCTAGGGTAGTAGGGCAGGGGG - Intronic
978542647 4:109835445-109835467 ACCTACGTCAGGAAGGCAGATGG - Exonic
979915791 4:126431915-126431937 CCCCAGGGAAGAAGGGAAGACGG - Intergenic
982190420 4:152848806-152848828 CCCTAGGGTAGGATGGCTGAAGG - Intronic
982316506 4:154037455-154037477 CCCTAGTAAAGGAAGGAAGAAGG + Intergenic
983344011 4:166502910-166502932 CCTTGGGTTATGAGGGCAGAGGG + Intergenic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
985469805 5:33193-33215 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
989546846 5:42684667-42684689 GCCTTGGTACTGAGGGCAGATGG - Intronic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
992522194 5:77565684-77565706 CACTAGGTAAGAAGGTCAGATGG - Intronic
997512371 5:134462407-134462429 AGCCAGGCAAGGAGGGCAGATGG + Intergenic
997532722 5:134592152-134592174 CCAGAGGCAAGGAGGCCAGAGGG + Intergenic
998040604 5:138948798-138948820 GCCTAGGTCAGGAGGGCAGCGGG + Intronic
998077500 5:139248365-139248387 CTTTAGGCAAGGGGGGCAGAAGG + Intronic
999094592 5:148966689-148966711 ACCTAGGCAAATAGGGCAGAAGG - Intronic
1001765515 5:174242838-174242860 CCCTAGGGAAGGAGGCCACCTGG + Intronic
1002003442 5:176212877-176212899 CCTGAGGTAAGTAAGGCAGATGG - Intergenic
1002936743 6:1680561-1680583 CCCAAGGGAGGGAGGCCAGAAGG - Intronic
1005928859 6:30466068-30466090 CCCTAGGGATGGAGAACAGAAGG + Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1007539386 6:42627092-42627114 GCCTAGGTTTGGAGGGCAGGGGG + Intronic
1008644578 6:53500877-53500899 CCCAGGGTAACGAAGGCAGAAGG + Intronic
1009280244 6:61741002-61741024 CTCTAGGAAATGAGGGCACAAGG + Intronic
1013255231 6:108378887-108378909 CCCTAGGCAAGCAGGGAAAAGGG - Intronic
1018391865 6:163347001-163347023 CCCTGGACAAGGAGGGCACATGG - Intergenic
1019183174 6:170205377-170205399 CCCAAGGCAAGGTGGGCAGTGGG - Intergenic
1019645873 7:2128723-2128745 CCCAGGGTGAGAAGGGCAGAGGG - Intronic
1020089736 7:5332538-5332560 CCCTAGGCTGGGAGGGGAGAGGG + Intronic
1020321236 7:6940126-6940148 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1021054481 7:16029987-16030009 CACTATGTAAGGAGGACAAATGG - Intergenic
1021549288 7:21852626-21852648 CACAAGGTAGGAAGGGCAGAGGG + Exonic
1023473578 7:40552293-40552315 ACAGAGGTATGGAGGGCAGAGGG - Intronic
1024291005 7:47803973-47803995 CCCCTGGTAGGGAGGGGAGAAGG - Intronic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024600187 7:50973843-50973865 CCCTATGTAAGGAGTACAGTGGG + Intergenic
1026830446 7:73607141-73607163 CCCTAGGTAAGGAGGCCGCTAGG + Intronic
1029606880 7:101604549-101604571 CCCTTGCTAAAGAGGGCAGTAGG + Intergenic
1029743260 7:102503146-102503168 ACCTCGGTGAGGAGGCCAGAGGG - Exonic
1029761249 7:102602307-102602329 ACCTCGGTGAGGAGGCCAGAGGG - Exonic
1032500215 7:132394320-132394342 CCCTAGCTAATGAGGGGAGCAGG + Intronic
1033617372 7:143029479-143029501 CCCTTGGGAAGAAGGGAAGAGGG - Intergenic
1033632892 7:143178334-143178356 CACAAAGTAAGGAGGGCTGAAGG + Intergenic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1035473312 7:159125385-159125407 CCCTGGGTGAGGAGGACACAAGG + Intronic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036651573 8:10647244-10647266 CCCCTGGGAAGGAGGTCAGAGGG - Intronic
1036849268 8:12190409-12190431 CACTTGGAACGGAGGGCAGAGGG + Intronic
1036870628 8:12432683-12432705 CACTTGGAACGGAGGGCAGAGGG + Intronic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1038150399 8:24938258-24938280 AGATAGGGAAGGAGGGCAGAAGG + Intergenic
1038162770 8:25055900-25055922 CCCTAGGTGATGAGGTCAAAAGG - Intergenic
1041753609 8:61288455-61288477 CCCGAGGTCCGCAGGGCAGAGGG + Intronic
1047381813 8:124371837-124371859 CCCAAGGTAAGGGGGGCAGGTGG - Exonic
1047526168 8:125636135-125636157 CCCTAGGTAAGCATGGTGGAGGG + Intergenic
1047939786 8:129818173-129818195 CCCTAGGGAAAAGGGGCAGATGG - Intergenic
1048887868 8:138923101-138923123 ACCTGGTTAAGGAGGGGAGAGGG + Intergenic
1050295311 9:4197908-4197930 CCCTAGGAAGGGAGGGGAAAGGG + Intronic
1050961834 9:11743669-11743691 GACTAGGTATGGAGGGCAGGGGG + Intergenic
1051509682 9:17863611-17863633 ACCTTGTGAAGGAGGGCAGAAGG + Intergenic
1052963586 9:34320726-34320748 CCCTTGGGAAGGAGGGGAGAGGG + Intronic
1056950319 9:91036312-91036334 CCCCAGGAGGGGAGGGCAGAAGG - Intergenic
1059716013 9:116913993-116914015 CCTTAGGTAAGGAGTGGAGTAGG + Intronic
1060417434 9:123442166-123442188 CCTTAGGAAAGGAGGCCAGCTGG - Intronic
1060939684 9:127536221-127536243 CCCCAGGTGTGGAGGCCAGAGGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062671347 9:137711734-137711756 CCCCAGGAAATGAGGGCAGGTGG + Intronic
1187632946 X:21195193-21195215 CCCTCTGAAAGGAGTGCAGAGGG - Intergenic
1187885340 X:23883810-23883832 CCCTAGGGAAAGCAGGCAGATGG - Intronic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1189908154 X:45783061-45783083 CCCTAGGCAGGAAGGGCTGAAGG + Intergenic
1192803672 X:74491998-74492020 CCCTATGTAAGCAGGACAGTGGG + Intronic
1194125260 X:90008623-90008645 CCCAGGGTGATGAGGGCAGAGGG + Intergenic
1194207759 X:91032335-91032357 CCCTAGGTTACAAAGGCAGAGGG - Intergenic
1198401951 X:136277315-136277337 CCCTAGGGAAGGAGTTCAGTGGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1199185217 X:144908578-144908600 CACTAGGTAAGGAGGTGAGTTGG + Intergenic
1199743580 X:150757825-150757847 CACTAGGTGAGCAGGGAAGAGGG - Intronic
1200553564 Y:4607367-4607389 CCCTAGGTTACAAAGGCAGAGGG - Intergenic