ID: 1198737414

View in Genome Browser
Species Human (GRCh38)
Location X:139802057-139802079
Sequence TTCTGGGTTGATAGTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198737413_1198737414 -10 Left 1198737413 X:139802044-139802066 CCACAATGATTTATTCTGGGTTG 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1198737414 X:139802057-139802079 TTCTGGGTTGATAGTGAACAAGG 0: 1
1: 0
2: 1
3: 9
4: 157
1198737409_1198737414 -3 Left 1198737409 X:139802037-139802059 CCTGGGCCCACAATGATTTATTC 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1198737414 X:139802057-139802079 TTCTGGGTTGATAGTGAACAAGG 0: 1
1: 0
2: 1
3: 9
4: 157
1198737412_1198737414 -9 Left 1198737412 X:139802043-139802065 CCCACAATGATTTATTCTGGGTT 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1198737414 X:139802057-139802079 TTCTGGGTTGATAGTGAACAAGG 0: 1
1: 0
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198737414 Original CRISPR TTCTGGGTTGATAGTGAACA AGG Intronic
900361456 1:2291066-2291088 TTCTGGGGTGAGGGTGAACGGGG - Intronic
906977582 1:50592305-50592327 TTCTCAGTTGACAGTGAAGAAGG - Intronic
907661045 1:56392686-56392708 TACTTGATTGAGAGTGAACACGG - Intergenic
908532690 1:65048976-65048998 TTAGGGGTGGATAGTGGACAAGG - Intergenic
909255405 1:73414432-73414454 TACTGAGTTGGTAGTTAACAAGG + Intergenic
909346943 1:74601277-74601299 TTATTGATTGATAGTTAACAGGG - Intronic
910732404 1:90412292-90412314 CTCTGGGCTGATAGTCATCAAGG + Intergenic
914317360 1:146526370-146526392 TTCTGGGTTACTTGTGATCAAGG + Intergenic
914496996 1:148206990-148207012 TTCTGGGTTACTTGTGATCAAGG - Intergenic
920339700 1:205268109-205268131 AGCTGCGTTGTTAGTGAACATGG + Intronic
921431239 1:215068704-215068726 TACTGGGTTGATAGGGATAAGGG + Intronic
922687227 1:227651120-227651142 TTCTGGGTTCATAGTAGAGAGGG + Intronic
1064286822 10:13998842-13998864 TACTAGGTTGATAGAGAAGAAGG - Intronic
1067204928 10:44204551-44204573 TTCTGTGTTGATAGAGAATTTGG - Intergenic
1069137881 10:64786280-64786302 TTGTGGGTTCATAGTGAAGCAGG - Intergenic
1069296675 10:66854354-66854376 TTCTGCCTTGATAATGAACTAGG + Intronic
1071003051 10:80852900-80852922 GTCAGGGATGATAATGAACATGG + Intergenic
1071255840 10:83870764-83870786 TGCTGGGTTGGTAGTGATAAAGG + Intergenic
1072433611 10:95395876-95395898 TGCTGGGTTCAAAGTGAACCTGG - Intronic
1077842273 11:5987861-5987883 TTCAGGGTTGAGAGTGAATTGGG - Intergenic
1079206107 11:18416264-18416286 TTCTATGTTTATAGTGAACCAGG + Intronic
1079632070 11:22690096-22690118 TTCTTGGTTGATAGTTAATTTGG + Intronic
1080634775 11:34114122-34114144 TTCTGGAATGATATTGTACAAGG + Intronic
1084074010 11:66758196-66758218 TTCAGGGTAGACAGTGAATAAGG - Intronic
1084809601 11:71604141-71604163 TTCTGGGCTGCTGGGGAACAGGG + Intergenic
1085911050 11:80827311-80827333 TTTTTGGTTTATAGTGGACAGGG - Intergenic
1086879200 11:92134029-92134051 TCTTTGGTTGATAGTCAACAGGG + Intergenic
1088106548 11:106212898-106212920 TTCTGGTGTGTTAGTGACCAGGG - Intergenic
1088385651 11:109252336-109252358 TTCTGGTGTGATATTGCACAGGG - Intergenic
1088639967 11:111863048-111863070 TTCTGGGTTGGTAGTGCCCGTGG - Intronic
1090353725 11:126124843-126124865 TGCTGGTTTGAAAGTGGACATGG - Intergenic
1091031018 11:132187837-132187859 CTCTGCTTTGAAAGTGAACATGG + Intronic
1093748760 12:22774095-22774117 TTCTGTGTTGATTGTGGGCAAGG - Intergenic
1094295001 12:28895933-28895955 TTCTGAGTTGATTGTGAATTTGG + Intergenic
1098134168 12:67384089-67384111 GTCTGTGTTGATAGTGCAAAAGG + Intergenic
1098539303 12:71635632-71635654 TTGTGGATTGAAATTGAACAAGG - Intronic
1099524641 12:83704829-83704851 TTCTGTGTAGATAGTTAACTTGG - Intergenic
1100514122 12:95309713-95309735 TTCAGTGTTCATAATGAACAAGG - Intergenic
1109962185 13:69645198-69645220 CTCTGGATGGATAGGGAACATGG + Intergenic
1110571983 13:77014314-77014336 TCCTGGCTTCATAGTGTACAAGG - Intronic
1113501285 13:110776862-110776884 ATCTGAGTTGATTGTTAACATGG + Intergenic
1114976316 14:28105126-28105148 TACTGGTTTCAAAGTGAACAAGG - Intergenic
1115820861 14:37211212-37211234 TTCTGTGTAGATAGTTAACTTGG - Intronic
1118279106 14:64412534-64412556 TTATGAGTTGATTGTGAAGAGGG + Intronic
1119924822 14:78483514-78483536 TTATTGGATAATAGTGAACACGG - Intronic
1122192197 14:100054542-100054564 TTCTGGGTTGATTTAGAGCAGGG - Intronic
1122225029 14:100270764-100270786 TTCTGTGTTGAGTGTGAAGATGG - Intronic
1128163300 15:65438928-65438950 TTCTGGGTGGAAAGTGAAGTGGG + Intergenic
1130202745 15:81847986-81848008 GTGTGTGTTGCTAGTGAACACGG - Intergenic
1130908063 15:88253786-88253808 GTCTGGGAGGATAGTGAGCAGGG - Intronic
1132791776 16:1694117-1694139 TTCTGGGATGTAAGTGAAGAAGG + Intronic
1134848392 16:17460535-17460557 TTATGTCTTCATAGTGAACACGG + Intronic
1136113443 16:28079461-28079483 TTCTTGGTTGATAGAGAAGTGGG - Intergenic
1137603055 16:49769583-49769605 TTCTGAGTTGATGGGGAACCAGG - Intronic
1138090678 16:54171397-54171419 TTCTGGGTTGATTGTGAGCCTGG - Intergenic
1143727236 17:8857510-8857532 GCCTGGGTTAATAATGAACACGG + Intronic
1145968179 17:28936261-28936283 TTCTGGATGGATAATTAACATGG - Intronic
1149100954 17:52906374-52906396 TGCTGGGTTAATAGAGAAAACGG - Intergenic
1149668581 17:58384351-58384373 TCCTGGGTTGAGAGTTCACAGGG + Intronic
1150872718 17:68931212-68931234 TTATTGGTTGATTGTGAAGAAGG - Intronic
1152554790 17:81047431-81047453 TTCTGAGTAGATAGAAAACACGG + Intronic
1152785952 17:82248161-82248183 TTCTGGGTTGTTCGCCAACAGGG - Intronic
1153200684 18:2644580-2644602 TTCTGTGTTGTTAGGGAACCTGG + Intergenic
1156276012 18:35583080-35583102 TTCTGGGTACATGGTGAATAAGG + Intronic
1156285878 18:35695436-35695458 TTATGGGCTGAGAGTGAAGAAGG + Intronic
1156914037 18:42444480-42444502 TTGTGGGTCGATTCTGAACAAGG + Intergenic
1159801746 18:72908704-72908726 TTCAGTGCTGATGGTGAACAAGG + Intergenic
1163901640 19:20106820-20106842 CTCTGAATTGATAGTGAAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1167597909 19:50436925-50436947 TTCGGGGGTGAAAGTGTACAGGG + Intronic
932212008 2:69939375-69939397 TTTTGGGTTGATAGTTTAAAAGG + Exonic
932336692 2:70935785-70935807 CTCTAGGTTGACAGTAAACAAGG - Intergenic
935429576 2:102960677-102960699 TTTTGTGTTTTTAGTGAACACGG - Intergenic
938006986 2:127795039-127795061 CTGTAGGTTGATGGTGAACATGG + Intronic
939495809 2:142926543-142926565 TTATGGGGTGATAGGGAAGAAGG + Intronic
942656388 2:178218492-178218514 TTCTGGGTTGGTAATGGAAATGG + Intronic
946159749 2:217828865-217828887 TTCTGTGTTGATAGGAAACCAGG + Intronic
948433223 2:237933967-237933989 TTCTGGGCTGACTGTGAAGATGG - Intergenic
1170655704 20:18286119-18286141 TGCTGGTTGGATAGTGAATAGGG - Intergenic
1172491982 20:35346708-35346730 TTCTAGGTTGCCAGTGATCAAGG + Intronic
1172857236 20:38014796-38014818 TCATGGGCTGACAGTGAACAAGG + Intronic
1174784658 20:53421209-53421231 ATCTGCGGTGATATTGAACATGG - Intronic
1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG + Intronic
1175431708 20:58909622-58909644 TTCTGTGTTGTTAGGGATCAGGG + Intronic
1175759683 20:61553343-61553365 TACTGGGTTAAAAGTGAAGATGG + Intronic
1179507534 21:41851786-41851808 TTCTGGAGAGGTAGTGAACATGG - Intronic
1181294428 22:21824147-21824169 TGCTGGATTGATAGTGACCTTGG - Intronic
1181975319 22:26724741-26724763 GTCTGGGATGATAGGGCACAAGG - Intergenic
1182153856 22:28050467-28050489 TTCTTGGCTCTTAGTGAACAAGG - Intronic
1182370205 22:29805319-29805341 TTCTGGCTTGACAGTGCCCAGGG - Intronic
952649610 3:35709506-35709528 TTCTGGGTTGTTAGCAAATATGG + Intronic
955588189 3:60505016-60505038 TTTTGGGGTGATAGTGGGCAGGG - Intronic
957071041 3:75568107-75568129 GTCTGGGCTCAGAGTGAACAGGG + Intergenic
957660332 3:83143301-83143323 TTCAGGGTTATTTGTGAACATGG - Intergenic
957738981 3:84238204-84238226 TTCTGGGTTAATCTTGAAGAAGG - Intergenic
961621535 3:128228427-128228449 TCCTGGGGTGATAGAGAGCATGG + Intronic
963945744 3:151144235-151144257 TACAGGGTTGATAGGGAAAAAGG + Intronic
967274644 3:187762080-187762102 TTCTCGATTGATAGTGAAATCGG + Intergenic
969014640 4:4095805-4095827 GTCTGGGCTCAGAGTGAACAGGG + Intergenic
969255433 4:5998597-5998619 CTCTGGGATGACAGTGGACAAGG + Intergenic
969739300 4:9012636-9012658 GTCTGGGCTCAGAGTGAACAGGG - Intergenic
970829259 4:20316876-20316898 TTCTTGGTTTATTGTGAACAAGG + Intronic
972170697 4:36342227-36342249 CTCTGGGTTGAAAGTGATGATGG + Intronic
974972118 4:68843343-68843365 TTCTGGGTAGATTGGGAACTTGG - Intergenic
975560962 4:75708103-75708125 TTCTGGTTTGAAATTGAAAAGGG - Intronic
985122524 4:186658742-186658764 TACTGGGCTGATTGTGAAGATGG - Intronic
989467187 5:41770091-41770113 CACTGGGTTGAAGGTGAACAGGG - Intronic
991450500 5:66745877-66745899 TTCTGGGTTGATAGAGTATGTGG + Intronic
994505334 5:100636410-100636432 TGCTCGGTTAATAGTGAACAGGG - Intergenic
994634073 5:102321656-102321678 TTCTGTGTAGATAGTTAACTTGG + Intergenic
995259180 5:110081899-110081921 TACTGGGGTGATTGTGCACAGGG + Intergenic
995896651 5:117020169-117020191 TCCTGGGTTGAGAGTCAAAAGGG - Intergenic
1000979713 5:167803498-167803520 TTCTGTGTTGATGTTGGACAGGG + Intronic
1001020514 5:168178602-168178624 TTCTGGGTTGAGAGTCAGCAGGG + Intronic
1004241906 6:13931263-13931285 TTCTGGATTGGAAATGAACAAGG + Intronic
1012793402 6:103730095-103730117 TTCTGTGCTGACATTGAACAGGG + Intergenic
1013306536 6:108851907-108851929 TTCTTGCTTGAGAGTGAAGACGG + Intronic
1013728952 6:113139676-113139698 ATATGGGTTGATAGAAAACATGG - Intergenic
1014663232 6:124200058-124200080 ATCTGGGTTCATGGAGAACAAGG - Intronic
1015355980 6:132277488-132277510 TTCAGGGTTGAAAGAGAAAATGG + Intergenic
1015904023 6:138097828-138097850 TTCTGGATTGTTAGTGGAGATGG - Intronic
1018513408 6:164551610-164551632 TTCTGCCTTAATAGTGACCAAGG + Intergenic
1018579055 6:165291904-165291926 TTCCTGGTAGATAGTAAACAAGG + Intronic
1020891402 7:13882393-13882415 TTGTGGGGAGAGAGTGAACACGG + Intergenic
1023090251 7:36610775-36610797 TGTTGGGTTGATGGTGGACAGGG + Intronic
1024525667 7:50346957-50346979 TTCTCAGTTGACAGTTAACATGG - Intronic
1027375629 7:77546214-77546236 TTCTGAGTTTTTGGTGAACATGG - Intronic
1027602221 7:80253482-80253504 TTCTAGGTTCATAGTGAATCAGG - Intergenic
1028879676 7:95865947-95865969 ATCTGGGTGTACAGTGAACAGGG + Intronic
1029050959 7:97687040-97687062 TTCAGTGATGATAATGAACAAGG + Intergenic
1030553999 7:111000218-111000240 TTCTGGGCTGATAGTCAGCAAGG - Intronic
1035112652 7:156496116-156496138 TTCTGGGATGACAGTGAAATTGG - Intergenic
1041629636 8:60072126-60072148 TTCTGGGCTGATATCCAACAAGG - Intergenic
1041834555 8:62197086-62197108 TTCTGGGACGATAGAGAAGATGG - Intergenic
1042383679 8:68149290-68149312 TTCAGGGTTGGAAGTGAGCAGGG + Intronic
1042419967 8:68575700-68575722 TCCTGTGTTGAGAGTGAACAGGG + Intronic
1042490304 8:69390152-69390174 TTCTGGGTTCACACTGAACATGG - Intergenic
1042516894 8:69668735-69668757 TTCTTGGTGGTTGGTGAACATGG + Exonic
1042657565 8:71116682-71116704 TTCTAGGGTGATTATGAACAAGG + Intergenic
1042730915 8:71934013-71934035 TGCTGGGTTGATATTAGACAAGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1044230893 8:89776563-89776585 TTTGGGGATGACAGTGAACAGGG + Intronic
1045113308 8:98953799-98953821 CTGTAGCTTGATAGTGAACAAGG - Intergenic
1045333687 8:101179625-101179647 TACTGAGATGATAGAGAACATGG - Intronic
1050574783 9:6982785-6982807 TTTTGGGTTGATAGAGAACATGG + Intronic
1051220663 9:14845188-14845210 CTATGGGATGATAGTTAACAAGG - Intronic
1051575663 9:18612482-18612504 TTCTAGGTGGACAGTGAACAGGG + Intronic
1051717391 9:19999251-19999273 TTCAGGGATGTTAATGAACATGG - Intergenic
1055370150 9:75589690-75589712 TTCTGTGATGATAGTGAAGAGGG + Intergenic
1055709720 9:79047335-79047357 TTCTGGGTTGATGATGTACTAGG - Intergenic
1056629032 9:88277506-88277528 TTCTGGGTTGATTTTGAATTTGG - Intergenic
1058753363 9:108061036-108061058 TTATGGGTTGGTGGTGGACAGGG + Intergenic
1060417307 9:123440538-123440560 TTGTGGGGTGAGAGGGAACATGG - Intronic
1062726445 9:138076638-138076660 TCCTGGTTTGAGAGTGAACTTGG + Intronic
1186413493 X:9363564-9363586 CTGTGGGTTCATGGTGAACAGGG + Intergenic
1187660065 X:21535038-21535060 TTTTGAGTTGATTGTGTACATGG + Intronic
1188909310 X:35826044-35826066 TTCTTGGTTGAAACTGAAAAAGG - Intergenic
1190497314 X:51039339-51039361 TCCAGGGTTTATAGTGAAGATGG - Intergenic
1193167216 X:78294738-78294760 TGCTGTGCTGATAGTGAGCAAGG + Intronic
1194581680 X:95680024-95680046 TTCTAGGATGATGGTGAATATGG - Intergenic
1194997444 X:100606713-100606735 TTGTGAGTTGATAGGCAACATGG - Intergenic
1198737414 X:139802057-139802079 TTCTGGGTTGATAGTGAACAAGG + Intronic
1199708373 X:150450593-150450615 TTCTGGGATGGTGATGAACAAGG + Intronic