ID: 1198739298

View in Genome Browser
Species Human (GRCh38)
Location X:139823973-139823995
Sequence CTCCATTAAAAGCTGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12570
Summary {0: 2, 1: 15, 2: 322, 3: 2171, 4: 10060}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198739295_1198739298 19 Left 1198739295 X:139823931-139823953 CCAGAATCTATAAGGAACTCAAA 0: 112
1: 1873
2: 17922
3: 14077
4: 8648
Right 1198739298 X:139823973-139823995 CTCCATTAAAAGCTGGGCAAAGG 0: 2
1: 15
2: 322
3: 2171
4: 10060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198739298 Original CRISPR CTCCATTAAAAGCTGGGCAA AGG Intronic
Too many off-targets to display for this crispr